![Page 1: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/1.jpg)
1
High Resolution Melts HRM
www.corbettresearch.com
Prepared by Andrea Tesoriero
Presented by Jennifer McMahon
corbett
LIFE SCIENCE
![Page 2: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/2.jpg)
2
High Resolution Melts
Analysis of change in fluorescence as a PCR product is melted
PCR amplify an amplicon with two primers and an intercalation dye and then melt the product – double stranded to single stranded
Detect difference between a single base pair change.
![Page 3: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/3.jpg)
3
High Resolution Melt Specifications
Instrument requires:
high-intensity + high sensitivity optics
high-speed data capture
very precise temperature control and resolution
saturating intercalation dye
![Page 4: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/4.jpg)
4
the world’s only real-time rotary thermo-optical analyser with HRM capabilities
![Page 5: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/5.jpg)
5
Cross-section of rotary optics
Reaction Chamber
PMT DetectorAssembly
LED Light Source
Assembly
Tubes Spin inRotor (Red)
Lens
Detection Filters
Spindle/Motor Assembly
![Page 6: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/6.jpg)
6
THERMAL UNIFORMITY- -/+0.01C
![Page 7: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/7.jpg)
7
Centrifugal fan drives air around chamber
Chamber vent seals to contain air
Heating mechanism
Note: holes in the rotor allow
free airflow
Heater elements switch on
![Page 8: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/8.jpg)
8
Cool air in
Centrifugal fan Drives air into chamber
Centrifugal fan drives air around chamber
Chamber vent opens expelling hot air
Cooling mechanism
Heater elements switch off
Note: holes in the rotor allow
free airflow
![Page 9: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/9.jpg)
9
Saturating dye technology for HRM -LCGreen™ I, EVA Green, Syto 9
LC Green™ I
Saturation dyes are less toxic, so concentration usedcan be high enough to allow all sites to be saturated
Saturation eliminates potential for dye relocation-ideal for HRM
SYBR™ Green I is toxic to PCR,so concentration used is very low
Intercalation Chemistries
SYBR® Green I
Unsaturated binding allows dye to relocate as melting begins
![Page 10: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/10.jpg)
10
Setting up a Reaction
Use standard PCR conditions as a starting point, typically 250nM primer, 1.5mM Magnesium chloride, 0.2mM dNTPs, 1.25 U Platinum Taq, 1.5μM SYTO 9, 50ng DNA
Don’t generally usually use real-time mix – decreases cost per assay
Set up cycling and add HRM step at the end
HRM step typically 0.1°C steps over 10 °C, HRM step takes around 20 minutes
![Page 11: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/11.jpg)
11
HRM Profile
0.02deg
![Page 12: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/12.jpg)
12
Data Acquisition
Melting curves-normalized by selecting linear regions before and after the melting transitionTwo regions defined-upper 100% double stranded and lower single stranded baseline
![Page 13: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/13.jpg)
13
Homoduplexes C or T
Homozygotes represented by a single base changeare differentiated by a difference in Tm melt.
T
A
C
G
![Page 14: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/14.jpg)
14
Heteroduplex C>T
Heterozygotes form heteroduplexes, the heterozygote (blue) trace is a mix of 4 duplexes
C
G
T
A
T
G
C
A
+C
G
T
A
++
![Page 15: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/15.jpg)
15
Mutants(T allele)
Wild types(C allele)
Heterozygotes
Mutants(T allele)
Wild types(C allele)
Heterozygotes
•ACTN3 (R577X) (C—T).•10 replicates.•40 cycle fast(~34 min).
SOFTWARE: Normalised HRM data
![Page 16: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/16.jpg)
16
Difference Graphs
Difference graph displays the difference between each sample and a given genotype control
Allows a calculated percentage confidence relative to a known genotype
![Page 17: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/17.jpg)
17
Confidence in HRM Results
Wildtype (72 Replicates)
Mean Tm 78.78 +0.04% Mean Tm 77.90 +0.04%
Mutant (72 Replicates)
![Page 18: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/18.jpg)
18
Applications
SNP genotyping/ Allelic discrimination Identify Candidate Predisposition Genes
Association Studies-eg.comparing cases and controls, genotype to phenotype
Prevalence -within population or different sub groups
Loss of Heterozygosity
DNA fingerprinting
Mutation Discovery/Screening/Scanning
Predictive Testing Penetrance/Linkage studies-variant track with disease within a family
Species Identification
![Page 19: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/19.jpg)
19
GenotypingClass 4 SNP SNP
ClassBase
ChangeTypical Tm
Shift
Rarity (in humans)
1 C/T and G/A Large>0.5oC
Very Small >0.2oC
64%
2 C/A and G/T 20%
3 C/G 9%
4 A/T 7%
Example of a class 4 SNP on the Rotor Gene (MCT A1470T)The rarest and most difficult SNP to discriminate.
SNP classes as described by Venter et al 2002
![Page 20: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/20.jpg)
20
“Spiking” Experiments
Royal Melbourne Hospital
Homozygous A(dark blue)
Homozygous B(Green)
![Page 21: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/21.jpg)
21
Tm Comparisons-Factor V G1691A
63bp tctgaaaggttacttcaaggacaaaatacctgtattccTtgcctgtccagggatctgctctta
89bp ggttacttcaaggacaaaatacctgtattccTtgcctgtccagggatctgctcttacagattagaagtagtcctattagcccagaggcg
169bp ttgaaggaaatgccccattatttagccaggagacctaacatgttctagccagaagaaattctcagaatttctgaaaggttacttcaaggac
aaaatacctgattccTtgcctgtccagggatctgctcttacagattagaagtagtcctattagcccagaggcgatgt
Amplicon size
Mutation Wildtype Tm Homozygote's
63bp 77.50 ± 0.04 78.18 ± 0.01 0.68 ± 0.05
89bp 79.46 ± 0.02 80.03 ± 0.02 0.57 ± 0.04
169bp 81.49 ± 0.02 82.21 ± 0.02 0.72 ± 0.04
![Page 22: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/22.jpg)
22
Sensitivity-Somatic Mutation Discovery 189 bp product 37% GC content
wt
?
Detect small quantities of mutant DNA in a background of wildtype DNA species-sensitivity 5%No homozygous spiking necessary
PMCI-Melbourne
![Page 23: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/23.jpg)
23
Sequencing –Somatic variants
wt
Patient 1838 G>A
Patient 13 35 G>T
Patient 6 34 G>T
Patient 22 35 G>T
Forward 3’ Reverse 5’
Sequence directly of the product-product column purified and not consumed
![Page 24: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/24.jpg)
24
Difference Graph
wt
38 G>A
35 G>T
34 G>T
35 G>T
38 G>A
35 G>C
![Page 25: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/25.jpg)
25
White et al. 2006 report
http://www.ngrl.org.uk/Wessex/downloads.htm
![Page 26: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/26.jpg)
26
White et al. 2006 report
![Page 27: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/27.jpg)
27
White et al. 2006 report
![Page 28: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/28.jpg)
28
White et al. 2006 report
![Page 29: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/29.jpg)
29
White et al. 2006 report
![Page 30: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/30.jpg)
30
DNA Quality
DNA quality-Multiplex 100, 200, 300, 400 and 600pb product
Amplification of 193bp product
![Page 31: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/31.jpg)
31
Poor Quality DNA in = poor results out!Important to view your data Real Time to check DNA quality
Guidleines:
Assess the CT values - integrity of your DNAAssess the amplification efficiencyAssess the derivative plot melt curves-is there one product? Is the PCR optimized? Primer-dimer issues?
Using the Real Time data allows you to make OBJECTIVE decisions about the changes observed
![Page 32: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/32.jpg)
32
Applications
Detect small quantities of mutant DNA in background of wildtype DNA species
Important in somatically acquired mutations
Pooling samples-up to 10 samples
Simple for diseases that cause no heterogeneity-like Factor V Leiden, haemochromotosis, sickle cell anemia
Newly identified genes-little information
![Page 33: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/33.jpg)
33
Summary
Simple, fast, cost effective method for gene scanning and detecting a single-base change in your sample Rapid cycle PCR with HRM analysis set up at one timeNO labeled probes, cheap intercalation dyeNO Post-PCR processing with additional reagents such as sequencing, DHPLC, RFLPExcellent sensitivity and specificity - capable of detecting BOTH heterozygous and homozygous changesCosts less than competing technologiesSequence directly off the product- sample not consumedDetect from a pool of 10 samples -1/20 alleles, 5% sensitivityAuto call softwareScanning and genotyping can be performed simultaneously in the same reaction
![Page 34: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/34.jpg)
34
Sydney AustraliaCorbett Research Pty Ltd14 Hilly StreetMortlake, NSW 2137T +61 2 9736 1320F +61 2 9736 1364
United KingdomCorbett Research UK LimitedUnit 296 Cambridge Science ParkMilton, Cambridge CB4 0WDT +44 (0)1223 424 288F +44 (0)1223 424 144
All slides 2006 Corbett Life Science. All rights reserved
E-mail [email protected]
USACorbett Robotics Inc185 Berry Street, Suite 5200San Francisco, CA 94107 USAT +1 415 348 1166F +1 415 348 1177
Brisbane AustraliaCorbett Robotics Pty Ltd42 McKechnie DriveEight Mile Plains, QLD 4113T +61 7 3841 7077F +61 7 3841 6077
Web www.corbettlifescience.com
Offices
![Page 35: 1 High Resolution Melts HRM Prepared by Andrea Tesoriero Presented by Jennifer McMahon corbett LIFE SCIENCE](https://reader030.vdocument.in/reader030/viewer/2022032802/56649de55503460f94addaba/html5/thumbnails/35.jpg)
35