Transcript
Page 1: 2013 UNC Asheville Baseball Media Guide

2013 UNC ASHEVILLE BASEBALL

Page 2: 2013 UNC Asheville Baseball Media Guide

BILLY CREIGHTONBILLY CREIGHTONIAN GRAHAMIAN GRAHAM

DILLON TABARDILLON TABARTODD JOYNERTODD JOYNER

Page 3: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

1/// F E A R T H E D O G ///

General InformationMedia Information ..................................................................................................................2Primary Media Outlets ..........................................................................................................3

Season PreviewOutlook .....................................................................................................................................4

PlayersRoster .........................................................................................................................................5Ian Graham ............................................................................................................................ 6-7Todd Joyner ........................................................................................................................... 8-9Billy Creighton ..................................................................................................................10-11Dillon Tabar .......................................................................................................................12-13Eli Miller .............................................................................................................................14-15Tommy Houmard .............................................................................................................16-17Sam Turner .........................................................................................................................18-19Dean Roland ......................................................................................................................20-21Robert McIntosh ..............................................................................................................22-23Ethan Steible ......................................................................................................................24-25Brian Connolly ..................................................................................................................26-27Andrew Kirkland ..............................................................................................................28-29Scott Robinson .......................................................................................................................30Rene Martinez .........................................................................................................................31Hunter Bryant ...................................................................................................................32-33Evan Joura ................................................................................................................................34Nick Schavone ........................................................................................................................35Elliot Criss .........................................................................................................................36-37Adam Spracklin .......................................................................................................................38Justin Hunt ...............................................................................................................................39Newcomers ......................................................................................................................40-44

Coaching Staff Head Coach Tom Smith ........................................................................................................45 Assistant Coach Jeremy Plexico .........................................................................................46Assistant Coach Brent Walsh ..............................................................................................47Volunteer Assistant Jordan Lurie ........................................................................................47

2011-12 Season2012 Season Stats ............................................................................................................50-522012 Results ............................................................................................................................532012 Miscellaneous Stats ................................................................................................54-552012 Leaders .....................................................................................................................56-57

UNC Asheville The Big South Conference .............................................................................................58-59The University ..................................................................................................................60-70The NCAA ..............................................................................................................................71The Bulldog Athletic Association ........................................................................................72

Bulldog Coaching Staff Head Coach.................................................................Tom Smith

.............................................................(Western Carolina, 1976)

Overall/years ....................................................... 58-101/3 years

at Asheville ........................................................... 58-101/3 years

Big South Conference Record .........................................30-51

Assistant Coach .................................................. Jeremy Plexico

........................................................................... (Winthrop, 2002)

Assistant Coach .......................................................Brent Walsh

................................................... (Colombia International, 2009)

Student Assistant .....................................................Jordan Lurie

2012 Team Information2012 Record .........................................................................25-30

2012 Big South Record/Finish .............................12-12/tie 4th

Home Record ......................................................................13-12

Away Record ........................................................................12-16

Neutral Record ....................................................................... 0-2

Starters Returning/Lost ........................................................ 4/5

Pitchers Returning/Lost ..........................................................9/6

Letterwinners Returning/Lost .......................................... 17/13

Baseball Support Staff Athletic Trainer ................................................ Eric Linnell, ATC

Athletics Communication ..................................Matt Pellegrin

FacilityPrimary Facility .............................................. Greenwood Field

Capacity .....................................................................................400

Seconday Facility.............................................McCormick Field

Capacity ................................................................................. 4,000

Message To MediaThis edition of the 2013 UNC Asheville baseball media guide has been prepared for you as you cover the Bulldogs during the season. For additional information, photographs, interviews with players and coaches, please contact Mike Gore or Matt Pellegrin in the Athletics Communication Offi ce.

CreditsDesigner:Matt PellegrinEditor:Mike GorePhotographers:Todd Drexler, Blake Madden, Mike Slade

UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.

UNC ASHEVILLE MISSION STATEMENT

Page 4: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

2 /// F E A R T H E D O G ///

Athletics Media Communication

Mike Gore Associate Athletics Director for

External AffairsOffi ce Phone: (828) 251-6923Cell Phone: (828) 575-6649

Email: [email protected]

Matt PellegrinDirector of Athletics Media

Communication / Baseball ContactOffi ce Phone: (828) 251-6931Cell Phone: (828) 707-0302Email: [email protected]

Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com

Mailing Address:One University Heights

Justice Center, CPO #2600Asheville, N.C. 28804

COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.

Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.

Broadcasts: There are no phone lines at Greenwood Field. There is also no internet lines so if you would like to broadcast a game please call well in advance to see what arrangements can be made.

Photographers: Photo passes are limited to working press photo-graphers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.

Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home baseball game. After the contest, each media member will receive a box score of the game.

Press Box: UNC Asheville’s working facilities are located directly behind home plate. Space is limited, so please contact us early. Only working press and game day operations personnel are allowed in the press box during games. No spouses, dates, children or friends are allowed. Your cooperation is appreciated.

Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the baseball coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Communication representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.

Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communication Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.

Video Streaming: UNC Asheville will once again stream a selection of home baseball games live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each game. For game highlights or video of games please contact Matt Pellegrin

MEDIA INFORMATION

Page 5: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

3/// F E A R T H E D O G ///

NEWSPAPERS

Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585

Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319

The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665

The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506

WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078

TELEVISION

WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618

WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430

WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305

RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310

WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835

WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875

Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteFacility (Capacity): Greenwood Field (4 00)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneAssociate Athletics Director of External Affairs: Mike GoreAthletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904

PRIMARY ATHLETICS LOGO

SECONDARY ATHLETICS LOGOS

MEDIA OUTLETS

Page 6: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

4 /// F E A R T H E D O G ///

ASHEVILLE, N.C. - The UNC Asheville baseball team is a preseason pick to fi nish in fi fth place in the Big South Conference’s South Divi-sion. The poll was announced by the league offi ce on Wednesday.

Defending Big South Champion Coastal Carolina was a unani-mous selection to win the South Division as it received all 12 fi rst-place votes and 72 points. Gardner-Webb placed second with 48 points, ahead of Charleston Southern who picked up 42 points. In fourth was Winthrop with 36 points and in the No. 5 slot was UNC Asheville with 28 points. Presbyterian College closed out the voting for the South Division with 26 points.

With a record 12 members in 2013, the Big South has added di-visional play in baseball for the fi rst time since 1985-87. Liberty is the preseason favorite to win the North Division with Coastal Carolina earning the plaudit for the South Division.

The Flames received seven top votes and 67 points to take the top spot, followed by Campbell who notched one top bid and 55 points. High Point’s four No. 1 votes and 53 points rounded out the top three in the North Division. Radford found itself at the No. 4 spot with 39 points, while VMI fi nished fi fth with 22 points. New Big South member Longwood rounded out the list for the North Divi-sion with 16 Points.

The Big South baseball season begins on Friday, Feb. 15 with 11 teams in action. The 2013 Big South Baseball Championship is slated for Tuesday, May 21-15 at the Liberty Baseball stadium in Lynchburg, Va.

Asheville is coming off a 25-30 season in 2012. The 25 wins are the most for the Bulldog program since the 2006 Big South-champi-onship season. Tom Smith’s club went 12-12 in Big South Conference play and fi nished in a tie for fourth place in the league standings de-spite being picked to fi nish in last place.

“We proved the pollsters wrong last year, and we’re looking for-ward to trying to do it again this year,” stated Smith. “I really like the team we have coming back this season and have added some depth that should help us compete better this season.

“We’ve got a solid nucleus returning,” added Smith. “I like the experience we have back and these guys have worked very hard in the off-season and in the fall. We’re looking quite forward to the 2013 season beginning.”

The Bulldogs return 17 letterwinners from last year’s club, in-cluding fi ve starters and two of its weekend starters on the mound.

Asheville opens the 2013 season on Feb. 15 when the Bulldogs take on #11 Kentucky in the USC Upstate/Wofford Invitational at USC Upstate.

The Blue & White’s home opener at Greenwood Field comes on Feb. 22 when Asheville welcomes Canisius College for a four-game series that weekend.

HUNTER BRYANT RECEIVES PRESEASON HONOR

ASHEVILLE, N.C. - UNC Asheville sophomore fi rst baseman Hunter Bryant has been named to the College Sports Madness Big South Preseason All-Conference second team. Bryant was the Bulldogs third leading hitter last season as he hit .303 with 10 doubles and 19 RBI. He became UNC Asheville’s starting fi rst baseman early in the year and was there the rest of the season. The former Erwin HS standout was one of 12 players on the second team with 12 players on the fi rst team, as well. Infi elder Michael Felton of Campbell was named the Big South Preseason Field Player of the Year, while Coastal Carolina hurler Aar-on Burke was named as the league’s Preseason Pitcher of the Year. Asheville opens the 2013 season on Feb. 15 when the Bulldogs take on #11 Kentucky in the USC Upstate/Wofford Invitational at USC Upstate. The Blue & White’s home opener at Greenwood Field comes on Feb. 22 when Asheville welcomes Canisius College for a four-game series that weekend.

BULLDOG BASEBALL PICKED 5TH IN SOUTH DIVISION

Page 7: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

5/// F E A R T H E D O G ///

No. Name. Pos. B/T Ht. Wt. Yr. Hometown/Previous school 1 Lucas Owens IF L/R 5-10 171 Fr. Forest City, N.C. (East Rutherford)2 Eli Miller IF R/R 5-11 183 Jr. Marion, N.C. (McDowell)3 Kyle Towles IF R/R 5-9 174 RSo. Columbia, S.C. (USC Lancaster)4 Tommy Houmard RHP L/R 6-2 173 Jr. Greenville, N.C. (JH Rose)6 PhillipTreadway IF R/R 5-11 175 Jr. Fletcher, N.C. (Middle Georgia JC)7 Hunter Bryant IF R/R 6-4 230 So. Asheville, N.C. (Erwin)8 Ian Graham C R/R 5-11 209 Sr. Marietta, Ga. (Greater Atlanta Christian)9 Justin Woods IF R/R 6-0 185 Fr. Waynesville, N.C. (Tuscola)10 Mitch Carstens C R/R 6-1 170 Fr. High Point, N.C. (Ragsdale)12 Andrew Madden OF R/R 6-2 176 Fr. High Point, N.C. (Southwest Guilford)15 Sam Turner C R/R 6-1 201 Jr. Asheville, N.C. (Asheville)16 Erik Connolly OF R/R 6-2 195 Fr. Thomasville, N.C. (Ledford)18 Evan Joura RHP R/R 6-1 185 So. Asheville, N.C. (Carolina Day)19 Dean Roland RHP R/R 6-4 200 Jr. West Chester, Pa. (Avon Grove)20 Todd Joyner OF L/L 6-1 205 Sr. Lexington, S.C. (Florence-Darlington Tech)21 Zack Wiseman LHP L/L 6-2 165 Fr. Burnsville, N,.C. (Mountain Heritage)22 Nick Schavone LHP L/L 5-10 169 So. Apex, N.C. (Middle Creek)23 Elliot Criss RHP R/R 6-4 214 So. Collegeville, Pa. (Springford)24 Robert McIntosh P/IF R/R 6-1 202 Sr. Greensboro, N.C. (NW Guilford)25 Corey Randall RHP R/R 6-1 185 Fr. Mocksville, N.C. (Davie County)26 Ethan Steible RHP R/R 6-2 175 Jr. Booneton, N.J. (Mt. Lakes)27 Lucas Clarke LHP L/L 6-3 170 Fr. Morganton, N.C. (Draughn)28 Adam Spracklin LHP L/L 6-1 185 So. Farmington, Conn. (Avon Old Farms)29 Brian Connolly RHP R/R 6-5 229 Jr. Thomasville, N.C. (Ledford)30 Billy Creighton P/IF R/L 6-5 252 Sr. Schenectady, N.Y. (Schenectady Co.CC)36 Andrew Kirkland OF R/R 5-10 179 Jr. Kennett Square , Pa. (Unionville)44 Justin Hunt RHP R/R 6-2 219 So. Kernersville, N.C. (Glenn)45 Scott Robinson RHP R/R 6-3 225 Jr. Seminole, Fla. (Lake Sumter CC)50 Dillon Tabar RHP R/R 6-2 200 RSr. Meadville, Penn. (Meadville)53 Rene Martinez RHP R/R 6-5 205 Jr. Miami, Fla. (Westminister Christian)

Head Coach: Tom Smith (17) Pitching Coach: Aaron Rembert (21) • Assistant Coach: Matt Henson (9)

Bulldogs By Class:Seniors: 6Juniors: 7

Sophomores: 8Freshmen: 15

North Carolina: 18Pennsylvania: 5

Florida: 2Maryland: 2

Connecticut: 1Georgia: 1

Ohio: 1Michigan: 1

New Jersey: 1New York: 1

South Carolina: 1Virginia: 1

Bulldogs By Position:Pitchers: 17Infi elders: 8

Outfi elders: 8 Catchers: 2

Pronunciation Guide:Cody Buch: BUKE

Grant Gajdosz: GUIDE-usNick Schavone: Shah-VOE-NeeTommy Houmard: HOE-mard

Dillon Tabar: TAY-burr

Bulldogs By State:

2013 UNC ASHEVILLE ROSTER

Page 8: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

6 /// F E A R T H E D O G ///

IAN GRAHAMC • 5-11 • SR • MARIETTA, GA

Overview: Became UNC Asheville’s starting catcher as a freshman and has been there for three seasons...has a enjoyed a solid and productive career for the Bulldogs...will compete for all-conference and all-region honors as a junior...cousin Tom Martin was a left-handed pitcher for 10 years in the major leagues as he played for the Los Angeles Dodgers, Houston Astros, Atlanta Braves and Colorado Rockies.

2012: Batted .279 while catching 44 games...Third on team in RBI (22) and fi fth in doubles (9)...Second in walks (23)...Exploded for a double and season-high fi ve RBI at N.C. Central (2/18)...Went 3-for-4 with two doubles and three RBI vs. VMI (3/18)...Had two RBI vs. Saint Peter’s (2/26)...Perfect 3-for-3 with double and two RBI at College of Charleston (5/11)...Only triple came at ACC power North Carolina (4/11)...Went 2-for-3 with two doubles in Big South Tournament vs. Liberty (5/22).

2011: Played in 44 games and started 37 times...hit .209 with 17 runs scored and 17 RBI...had two games where he drove in four runs...opening day vs. Murray State (2/18) went 3-for-4 with four RBI and a double...went 2-for-4 with four RBI in McCormick Field victory over Western Carolina (4/12)...had two key hits in win over Coastal Carolina (3/26)...drove in two runs without a hit a VMI (5/13).

2010: Finished third on the team in batting with a .306 average...third on team in doubles with 12...had seven-game hitting streak midway through the sea-son...went 4-for-5 with double and two runs scored vs. USC Upstate (4/14)...had three RBI and two doubles vs. Winthrop (4/16)...opened his collegiate career in grand style went 3-for-4 performance double and two RBI at Camp-bell (2/19)...went 4-for-4 with two runs scored at High Point (3/24)...had two hits and three RRI in crucial victory over Charleston Southern (5/14).

Before UNC Asheville: Attended Greater Atlanta Christian School in Nor-cross, Ga....as a senior hit .410 with two home runs, 14 stolen bases and 30 RBI...earned All-County honors in Gwinnett following senior campaign...junior season hit .379 with eight doubles...earned the team Hustle Award following junior year...was hit by a pitch 12 times junior season which set a school record.

8

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2010 .306 50-49 170 25 52 12 0 0 24 19 23 0-02011 .209 44-37 115 17 24 3 0 0 17 26 15 0-02012 .279 47-44 154 19 43 9 1 0 22 23 26 0-0TOTAL .271 141-130 439 61 119 24 1 0 63 68 64 0-0

SINGLE-GAME HIGHS:Hits: 4, at High Point, 03-24-10; USC Upstate, Apr 14, 2010Doubles: 2, vs Liberty, 05-22-12; Winthrop, Apr 16, 2010; VMI, Mar 18, 2012Triples: 1, at North Carolina, Apr 11, 2012Total bases: 5, at North Carolina, Apr 11, 2012; USC Upstate, Apr 14, 2010; VMI, Mar 18, 2012RBI: 5, at NC Central, Feb 18, 2012Runs scored: 2, 9 timesWalks: 3, High Point, 05-23-12; Gardner-Webb, May 20, 2010Hit by pitch: 2, Charleston Southern, May 14, 2010Struck out: 3, at High Point, 03-24-10; at Radford, 3-25-12Sac flies: 1, 4 timesSac bunts: 1, 4 timesAt bats: 7, Winthrop, Apr 16, 2010Field chances: 16, at Gardner-Webb, Mar 18, 2011Putouts: 14, at Gardner-Webb, Mar 18, 2011Assists: 5, at Eastern Kentucky, Mar 13, 2011Runners CS: 3, at Liberty, May 07, 2011

Page 9: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

7/// F E A R T H E D O G ///

Page 10: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

8 /// F E A R T H E D O G ///

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2012 .253 47-39 166 21 42 10 0 2 18 8 26 2-2TOTAL .253 47-39 166 21 42 10 0 2 18 8 26 2-2

SINGLE-GAME HIGHS:Hits: 4, VMI, Mar 16, 2012Doubles: 2, VMI, Mar 18, 2012Home runs: 1, at High Point, 05-04-12; VMI, Mar 16, 2012Total bases: 7, VMI, Mar 16, 2012RBI: 3, VMI, Mar 16, 2012Runs scored: 2, 5 timesWalks: 2, at NC Central, Feb 17, 2012Struck out: 3, Western Carolina, Mar 21, 2012Sac flies: 1, ETSU, Apr 10, 2012; Morehead State, Mar 11, 2012Sac bunts: 1, VMI, Mar 17, 2012At bats: 6, 4 timesStolen bases: 1, VMI, Mar 17, 2012; Garder-Webb, May 18, 2012Field chances: 12, vs NC State, Mar 02, 2012; Furman, Mar 06, 2012Putouts: 11, at NC Central, Feb 18, 2012; Furman, Mar 06, 2012Assists: 2, at NC Central, Feb 17, 2012; at UNCG, Feb 21, 2012; vs NC State, Mar 02, 2012

TODD JOYNEROF • 6-1 • SR • LEXINGTON, S.C.

Overview: Did a great job for the Bulldogs last year and started in both left-fi eld and right-fi eld in 2012...went to Florence-Darlington Tech in South Carolina...native of Lexington, S.C.

2012: Tied for fi rst on team in doubles (10)...Tied for fi fth with 18 RBI...Bat-ted .253 in 47 games while playing in outfi eld and at fi rst base...Biggest day at plate came against VMI (3/16) as he went 4-for-6 with a homer and three RBI...Went 3-for-4 at Wofford (3/28)...Drove in two runs with a double dur-ing 3-for-4 performance at High Point (5/5)...Concluded a four-game, 9-for-19 stretch by going 2-for-4 with a double at HPU (5/6)...Other home run came during that period (5/4) at High Point.

Before UNC Asheville: Had a great year in 2011 at Florence-Darlington...led team in hitting with a .422 average and on-base percentage of .486...also led team with 17 doubles...scored 19 runs and had 30 RBI...attended high school at White Knoll in Lexington, S.C.

20

Page 11: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

9/// F E A R T H E D O G ///

Page 12: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

10 /// F E A R T H E D O G ///

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2012 .306 49-41 160 22 49 10 0 6 32 22 25 0-0TOTAL .306 49-41 160 22 49 10 0 6 32 22 25 0-0

Year era w-l app gs cg sho sv ip h r er bb so2012 11.88 0-0 9 1 0 0/0 0 8.1 13 11 11 6 9TOTAL 11.88 0-0 9 1 0 0/0 0 8.1 13 11 11 6 9

SINGLE-GAME HIGHS:Hits: 3, at High Point, 05-06-12; at NC Central, Feb 18, 2012Doubles: 1, 10 timesHome runs: 2, at NC Central, Feb 18, 2012Total bases: 9, at NC Central, Feb 18, 2012RBI: 5, at NC Central, Feb 18, 2012Runs scored: 3, at NC Central, Feb 17, 2012; at NC Central, Feb 18, 2012Walks: 4, at NC Central, Feb 17, 2012Hit by pitch: 1, Morehead State, Mar 10, 2012Struck out: 2, Saint Peter's, Feb 25, 2012; at Wake Forest, Feb 28, 2012; at South Carolina, Mar 07, 2012Sac flies: 1, Saint Peter's, Feb 26, 2012; at UNCW, Mar 04, 2012At bats: 5, 9 timesInnings pitched: 3.0, at Radford, 3-23-12Walks allowed: 2, at Wake Forest, Feb 28, 2012; at Coll. of Charleston, May 13, 2012Strikeouts: 5, at Radford, 3-23-12Batters faced: 9, at Radford, 3-23-12Field chances: 3, at Furman, Apr 03, 2012; Georgia State, May 08, 2012Putouts: 2, at Furman, Apr 03, 2012Assists: 2, Georgia State, May 08, 2012Runners CS: 1, Western Carolina, Mar 21, 2012

BILLY CREIGHTONP/IF • 6-5 • SR • SCHENECTADY, N.Y.

Overview: JUCO product who did a great job for the Bulldogs last year at the plate...tremendous power...also saw some time on the mound...should hit in the middle of the line-up as as senior in 2013.

2012: Led team in RBI (32) and was second in home runs (6)...Tied for lead in doubles (10)...Third in batting average (.306)...Drew third-most walks (22)...Season-best performance came in third game of season at N.C. Central (2/18) as he went 3-for-5 with two homers and fi ve RBI...Another impressive day at the plate took place at High Point (3-for-4, HR, 4 RBI)...Drove in three runs with a double at ACC member Wake Forest (2/28)...Had two RBI each in opening two games at N.C. Central (2/17-18) and at Campbell (4/14)...Hit only home run at Greenwood Field against Liberty (4/22).

Before UNC Asheville: Enjoyed a superb sophomore season at Schenectady Community College as both a pitcher and a hitter...on the mound went 5-1 with 1.13 ERA...struck out 71 hitters in 56 innings of work...as a hitter hit a team-leading .393 with two home runs, 13 doubles and 27 RBI...freshman year hit .395 with 45 RBI and two home runs...went 3-1 on the mound with 3.05 ERA...struck out 41 hitters in 38.1 innings of work.

30

Page 13: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

11/// F E A R T H E D O G ///

Page 14: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

12 /// F E A R T H E D O G ///

DILLON TABARP • 6-2 • SR • MEADVILLE, PA

Overview: Senior right-handed pitcher who will be one of Asheville’s lead-ers on the mound in 2013...improved with each season and can serve the Bulldogs in any role.

2012: Posted best ERA on the pitching staff (1.72) while working the most games (22) and innings (36.2) in relief...His 1-1 record included a win at High Point (5/4) where he pitched 2.1 shutout innings...Worked a scoreless ninth at College of Charleston (5/11) to record his one save...Longest outing came in Big South Tournament fi nale at High Point (5/23) where he allowed no earned runs in four innings...Shut out Liberty (4/20) over three innings...Made 17 scoreless appearances.

2011: Made 21 appearances and earned three starts in the last month of the year...went 3-5 with 15 strikeouts in 30 innings of work...earned fi rst win of the season in relief against Murray State (2/9) in opening weekend of the sea-son as he pitched two innings...second win was a historic one as he tossed a shutout of relief in Bulldogs victory over Coastal Carolina (3/26) that broke Chanticleers 35-game winning streak in Big South Conference play...pitched two scoreless innings the next day as Bulldogs won the series against Chan-ticleers...picked up road win at Winthrop (4/10) with two scoreless innings of work...fi rst start of the year came at UNC Chapel Hill (5/11) and had a no-decision as he allowed just one run in three innings of work against the College World Series-bound Tar Heels.

2010: Did not play 2009: Made 10 appearances with no decisions...pitched a scoreless inning of relief in victory over Presbyterian (5-14) and allowed one hit...got two outs in road game at Liberty (4-10)...had seven strikeouts in 11 innings of work. Before UNC Asheville: Helped lead Meadville to 15-5 overall record as a senior...named Player of the Year and earned fi rst team all-conference honors following senior season...was a fi rst team all-conference pitcher and second team all-conference selection an an outfi elder...named team MVP.

50

Year era w-l app gs cg sho sv ip h r er bb so2009 18.00 0-0 10 0 0 0/0 0 11.0 27 26 22 9 72011 6 . 3 0 3-5 21 3 0 0/1 0 30.0 37 28 21 22 152012 1 . 7 2 1-1 22 0 0 0/0 1 36.2 34 10 7 10 19TOTAL 5 . 7 9 4-6 53 3 0 0/1 1 77.2 98 64 50 41 41

SINGLE-GAME HIGHS:Innings pitched: 5.0, Presbyterian College, May 19, 2011Walks allowed: 4, at North Carolina, May 11, 2011Strikeouts: 3, Garder-Webb, May 17, 2012; Presbyterian College, May 19, 2011Batters faced: 21, Presbyterian College, May 19, 2011Field chances: 2, at Wake Forest, Feb 28, 2012; at Eastern Kentucky, Mar 12, 2011Putouts: 1, Murray State, Feb 19, 2011; Coastal Carolina, Mar 26, 2011; Presbyterian College, May 19, 2011Assists: 2, at Wake Forest, Feb 28, 2012; at Eastern Kentucky, Mar 12, 2011Runners CS: 1, 4 times

Page 15: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

13/// F E A R T H E D O G ///

Page 16: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

14 /// F E A R T H E D O G ///

ELI MILLERIF • 5-11 • JR • MARION, N.C.

Overview: Junior infi elder who has steadily gotten better each year and should be a key player for the Bulldogs in 2013...enjoyed a great fall...played at nearby McDowell HS in Marion.

2012: Primary second baseman for the Bulldogs who ranked fourth on team in runs scored (24) and tied for third in stolen bases (5)...Finished 12-for-41 to push batting average to .233...Registered pair of four-hit games against VMI (3/16; 4-for-5) and Gardner-Webb (5/19; 4-for-4)...Most productive game came at High Point (5/6) where he went 2-for-4 with two doubles, two runs and three RBI...Went 2-for-4 with season-high three runs at N.C. Central (2/18)...Also registered two-hit games against Western Carolina (3/21), East Tennessee State (3/20 and 4/10), Presbyterian (3/30) and Liberty (4/22 and 5/22 in Big South Tournament).

2011: Played in 40 games and earned 20 starts...hit .202 on the season...had an incredible collegiate debut vs. Murray State (2-19) as he went 2-for-4 four fi ve RBI and a double...had clutch three-run double in that game...posted three doubles and had 13 RBI on the season...went 2-for-4 with two RBI at Gardner-Webb (3-20)...had two hits in fi ve different games. Before UNC Asheville: Enjoyed a sensational career for the Titans program under head coach Alex Smith...senior year played both in the infi eld and on the mound...hit .424 as a senior with eight home runs, 18 RBI and six stolen bases...as a pitcher he had a 4-4 record with 48 strikeouts in 54 innings of work...named to All-Conference team as a junior and senior...made All-Region team as a junior and senior...team MVP as a senior...lettered for four years...junior season hit .417 with three home runs, 27 RBI and 13 stolen bases...went 2-0 on the mound with a 2.12 ERA and 22 strikeouts...played for Region 8 in North Carolina State Games.

2

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2011 .202 40-20 84 9 17 3 0 0 13 11 18 0-12012 .233 49-42 163 24 38 7 0 0 12 11 25 5-7TOTAL .223 89-62 247 33 55 10 0 0 25 22 43 5-8

Year era w-l app gs cg sho sv ip h r er bb so2012 0 . 0 0 0-0 2 0 0 0/0 0 1.2 1 0 0 1 0TOTAL 0 . 0 0 0-0 2 0 0 0/0 0 1.2 1 0 0 1 0

SINGLE-GAME HIGHS:Hits: 4, VMI, Mar 16, 2012; Garder-Webb, May 18, 2012Doubles: 2, at High Point, 05-06-12Total bases: 5, VMI, Mar 16, 2012RBI: 5, Murray State, Feb 19, 2011Runs scored: 3, at NC Central, Feb 18, 2012Walks: 3, at Georgia State, Mar 08, 2011Hit by pitch: 1, Charleston Southern, Apr 07, 2012; at ETSU, May 09, 2011; at Coll. of Charleston, May 12, 2012Struck out: 3, at Gardner-Webb, Mar 18, 2011Sac flies: 1, at High Point, 05-06-12; at Radford, 3-23-12; at Western Carolina, Mar 16, 2011Sac bunts: 1, 6 timesAt bats: 5, 8 timesStolen bases: 1, 5 timesCaught stealing: 1, ETSU, Apr 10, 2012; High Point, Apr 15, 2011; Garder-Webb, May 18, 2012Innings pitched: 1.0, vs NC State, Mar 02, 2012Walks allowed: 1, Furman, Mar 06, 2012Batters faced: 4, vs NC State, Mar 02, 2012Field chances: 10, VMI, Mar 16, 2012Putouts: 5, VMI, Mar 16, 2012Assists: 8, Charleston Southern, Apr 06, 2012

Page 17: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

15/// F E A R T H E D O G ///

Page 18: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

16 /// F E A R T H E D O G ///

TOMMY HOUMARDP/OF • 6-2 • JR • GREENVILLE, N.C.

Overview: Exciting two-way player who enjoyed a solid freshman year...red-shirted last season with injury but should be fully healthy in 2013...comes to UNC Asheville from Rose HS in Greenville, N.C...sister Katie plays softball at UNC Wilmington.

2011: Hit a solid .271 at the plate and went 2-4 on the mound with 6.93 ERA...pitched in 13 games and earned 10 starts...earned fi rst career victory in collegiate debut on the mound as he tossed four shutout innings in 7-6 win over Murray State (2-20)...picked up second win in start over Big South foe High Point (4-17) as he went seven strong innngs of work...fi rst career start was a gem at Western Carolina (3-16) as the threw four shutout innings and allowed just one hit...drove in three runs at Campbell (2-26)...had two hits vs. Campbell (2-25) and Coastal Carolina (3-26).

Before UNC Asheville: Sensational senior season as he hit .390 from the plate and had a 2.00 ERA as a pitcher...named to All-Conference team as a junior and senior...led Rose to a conference championship as a junior and to the semifi nals of the state playoffs...played in the East-West All-Star Game in summer of 2010...excellent athlete who also lettered in cross country, soc-cer and swimming....was All-Conference in both soccer and cross country as a senior.

4

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2011 .271 30-22 48 4 13 1 0 0 7 5 8 0-1TOTAL .271 30-22 48 4 13 1 0 0 7 5 8 0-1

Year era w-l app gs cg sho sv ip h r er bb so2011 6 . 9 3 2-4 13 10 0 0/0 0 49.1 64 42 38 17 34TOTAL 6 . 9 3 2-4 13 10 0 0/0 0 49.1 64 42 38 17 34

SINGLE-GAME HIGHS:Hits: 2, at Campbell, Feb 25, 2011; at Georgia State, Mar 08, 2011; Coastal Carolina, Mar 26, 2011Doubles: 1, at Campbell, Feb 26, 2011Total bases: 2, 4 timesRBI: 3, at Campbell, Feb 26, 2011Runs scored: 2, vs Georgetown, Feb 16, 2013Walks: 2, vs Georgetown, Feb 16, 2013Struck out: 3, at Eastern Kentucky, Mar 12, 2011Sac flies: 1, Murray State, Feb 19, 2011At bats: 5, vs Kentucky, Feb. 15Caught stealing: 1, at Georgia State, Mar 08, 2011Innings pitched: 7.0, High Point, Apr 17, 2011Walks allowed: 3, at Gardner-Webb, Mar 20, 2011; Coastal Carolina, Mar 27, 2011Strikeouts: 6, at Winthrop, 04-10-11Batters faced: 30, High Point, Apr 17, 2011Field chances: 9, Coastal Carolina, Mar 26, 2011Putouts: 3, at Eastern Kentucky, Mar 13, 2011; Coastal Carolina, Mar 26, 2011; at Liberty, May 05, 2011Assists: 6, Coastal Carolina, Mar 26, 2011Runners CS: 1, at Charleston Southern, 04/03/2011

Page 19: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

17/// F E A R T H E D O G ///

Page 20: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

18 /// F E A R T H E D O G ///

SAM TURNERC • 6-1 • JR • ASHEVILLE, N.C.

Overview: Hard worker who will compete for playing time behind the plate and in the infi eld... enjoyed excellent prep career at Asheville HS for former Bulldog Billy Hillier, Jr.

2012: Backed up Ian Graham behind the plate..Made 10 starts in 21 games...Best day at the plate came against Charleston Southern (4/7) when he went 1-for-4 with two RBI...Also had singles against UNC-Greensboro (2/21), Saint Peter’s (2/26) and Georgia State (5/8).

2011: Played in 16 games and earned one start at Eastern Kentucky (3/12)...had three hits on the season with single at Campbell (2/26), at Eastern Ken-tucky (3/12) and at Tennessee (3/30)...scored a run at Tennessee...also had two walks on the year. Before UNC Asheville: Four-year letterman for Cougars...enjoyed sensa-tional senior year as he hit .429 with seven home runs, 23 RBI and 10 sto-len bases...helped Asheville HS reach conference tournament championship game as a senior...team MVP as a senior and was named to All-Conference and All-Region team...made the Region 8 state games as a junior.

15

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2011 .167 16-1 18 1 3 0 0 0 0 2 10 0-02012 .105 21-10 38 5 4 0 0 0 2 5 19 0-0TOTAL .125 37-11 56 6 7 0 0 0 2 7 29 0-0

SINGLE-GAME HIGHS:Hits: 1, 7 timesTotal bases: 1, 7 timesRBI: 2, Charleston Southern, Apr 07, 2012Runs scored: 1, 6 timesWalks: 2, Garder-Webb, May 18, 2012Hit by pitch: 1, at NC Central, Feb 18, 2012Struck out: 3, ETSU, Apr 10, 2012At bats: 4, Charleston Southern, Apr 07, 2012; ETSU, Apr 10, 2012; Georgia State, May 08, 2012Field chances: 8, Saint Peter's, Feb 25, 2012Putouts: 6, 4 timesAssists: 2, Saint Peter's, Feb 25, 2012Runners CS: 2, Saint Peter's, Feb 25, 2012

Page 21: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

19/// F E A R T H E D O G ///

Page 22: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

20 /// F E A R T H E D O G ///

DEAN ROLANDP • 6-4 • JR • WEST CHESTER, PA

Overview: Junior right-handed pitcher who became one of the Bulldogs weekend starters last season...wil compete for All-Conference honors in 2013...tough competitor.

2012: Led pitching staff in starts (15) and innings (96.1) and tied for most wins with 5-6 record...Posted second-best ERA (3.92) in the rotation while com-piling 61-to-29 strikeout-to-walk ratio...One of team’s two complete game came in loss at Campbell (4/13)...Received no-decision despite shutting out homestanding Radford on six hits in 10 innings (3/25)...Went 4-2 in fi rst six starts...Best performances during that stretch came in fi rst game against N.C. Central (2/18; one run in fi ve innings) and in a seven-inning, shutout effort against Morehead State (3/11)...Final win registered at College of Charleston (5/11) where he allowed one earned run in eight innings while striking out a season-high nine.

2011: Appeared in 17 games and earned one start vs. Wofford (4-20)...struck out 13 hitters in 27.2 innings of work...had won-loss record of 1-2...picked up fi rst collegiate victory in McCormick Field win vs. Western Carolina (4-20)...tossed two scoreless innings in collegiate debut vs. Murray State (2-19) as he allowed just one hit...had solid outing vs. Radford (4-23) with two scoreless innings and two strikeouts. Before UNC Asheville: Two-way player at Avon Grove...hit seven home runs as a senior with .458 average...on the mound, he went 7-1 with 2.10 ERA...helped lead team to Pennsylvania state playoffs...junior year went 8-0 on the hill with 1.30 ERA...earned All-Conference honors following senior season...served as captain of team...also played basketball in high school.

19

Year era w-l app gs cg sho sv ip h r er bb so2011 7 . 8 1 1-2 17 1 0 0/0 0 27.2 47 33 24 17 162012 3 . 9 2 5-6 16 15 1 0/1 0 96.1 93 50 42 29 61TOTAL 4 . 7 9 6-8 33 16 1 0/1 0 124.0 140 83 66 46 77

SINGLE-GAME HIGHS:Innings pitched: 10.0, at Radford, 3-25-12Walks allowed: 5, Liberty, 04-20-12Strikeouts: 9, at Coll. of Charleston, May 11, 2012Batters faced: 38, at Radford, 3-25-12Field chances: 4, Charleston Southern, Apr 06, 2012; Morehead State, Mar 11, 2012; at Presbyterian College, Mar 31, 2012Putouts: 2, Charleston Southern, Apr 06, 2012; vs NC State, Mar 02, 2012; VMI, Mar 18, 2012Assists: 3, Morehead State, Mar 11, 2012; at Presbyterian College, Mar 31, 2012Runners CS: 1, at Radford, 3-25-12; Saint Peter's, Feb 26, 2012; Morehead State, Mar 11, 2012

Page 23: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

21/// F E A R T H E D O G ///

Page 24: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

22 /// F E A R T H E D O G ///

ROBERT McINTOSHP/IF • 6-1 • JR • GREENSBORO, N.C.

Overview: Talented two-way player who can play anywhere in the infi eld and pitch...has been used as a closer for the Bulldogs in his career...red-shirted in 2012 and will compete in 2013 as a junior.

2012: Did not play.

2011: Led Bulldogs in hitting with .341 average...scored 29 runs and had 11 doubles...posted 15 multi-hit games, including three games with four hits...pitched in 11 games with six starts and 0-2 record...earned one save vs. High Point (4-17) as he got the fi nal two outs of the game in a 7-4 victory...opened the season with 4-for-6 performance at the plate vs. Murray State (2-18) as he had two RBI and a double...also had four hits at Tennessee (3-30) and tied a school record with three doubles...pounded out four hits and two RBI vs. High Point (4-15)...went 3-for-5 with two runs scored in win at Charleston Southern (4-1)...had three hits and scored three runs in victory over Western Carolina (4-12).

2010: Played and started in 47 games...second leading hitter with a .333 aver-age...drove in 25 runs with 12 doubles...third on team in hits with 63...fourth in runs scored with 31...also excelled on the mound...was Asheville’s closer and led team with three saves...began his college career with fi ve-game hitting streak (9-for-21) as he had two hits in four of those games...ended the season red-hot with hits in nine of the last 10 games...went 4-for-5 with two doubles and four RBI in crucial victory over Charleston Southern (5-16)...also had four hits and scored three runs vs. Gardner-Webb (5-22)...had homer, double and drove in four runs in road win at Wofford (3-4)...earned fi rst career save vs. Bryant (3-6) with scoreless inning of work...picked up save in league victory at Presbyterian College (4-11)...pitched season-high three innings to earn save in key league victory vs. Charleston Southern (5-14).

Before UNC Asheville: Excelled at Northwest Guilford HS in Greensboro...three-year starter for head coach Sonny Gann...led school to three trips to the state playoffs...named team MVP as a junior and earned Coaches Award as a senior.

24

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2010 .333 47-47 189 31 63 12 0 1 25 14 33 3-42011 .341 35-35 138 29 47 9 1 1 16 17 24 5-6TOTAL .336 82-82 327 60 110 21 1 2 41 31 57 8-10

Year era w-l app gs cg sho sv ip h r er bb so2010 7 . 5 0 1-1 10 0 0 0/1 3 12.0 20 14 10 3 92011 7 . 7 1 0-2 11 6 0 0/0 1 23.1 36 24 20 10 20TOTAL 7 . 6 4 1-3 21 6 0 0/1 4 35.1 56 38 30 13 29

SINGLE-GAME HIGHS:Hits: 4, 5 timesDoubles: 3, at Tennessee, Mar 30, 2011Triples: 1, at Eastern Kentucky, Mar 12, 2011Home runs: 1, High Point, Apr 17, 2011; at Wofford College, Mar 04, 2010Total bases: 7, at Wofford College, Mar 04, 2010; at Tennessee, Mar 30, 2011RBI: 4, at Wofford College, Mar 04, 2010; Charleston Southern, May 16, 2010Runs scored: 3, Western Carolina, Apr 12, 2011; at Campbell, Feb 19, 2010; Gardner-Webb, May 22, 2010Walks: 3, at Georgia State, Mar 08, 2011; at Furman, Mar 31, 2010Struck out: 3, at Coll. of Charleston, Feb 26, 2010; Gardner-Webb, May 22, 2010Sac flies: 1, Radford, Apr 23, 2011Sac bunts: 1, USC Upstate, Apr 14, 2010At bats: 7, Winthrop, Apr 16, 2010Stolen bases: 2, at North Carolina A&T, Mar 29, 2011Caught stealing: 1, at North Carolina A&T, Mar 29, 2011; at Furman, Mar 31, 2010Innings pitched: 4.0, ETSU, Mar 02, 2011; at Eastern Kentucky, Mar 13, 2011Walks allowed: 3, Murray State, Feb 19, 2011Strikeouts: 5, at Eastern Kentucky, Mar 13, 2011Batters faced: 22, at Eastern Kentucky, Mar 13, 2011

Page 25: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

23/// F E A R T H E D O G ///

Page 26: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

24 /// F E A R T H E D O G ///

ETHAN STEIBLEP • 6-2 • JR • BOONETON, N.J.

Overview: Right-handed pitcher who has really improved during his career...became the Bulldogs closer last season.

2012: Led team in saves with four...Struck out 23 and walked eight in 23.1 innings while posting 1-1 record...Second on team in appearances (21)...Win came at Presbyterian College (3/31) where he worked two scoreless innings...Registered saves against Saint Peter’s (2/26), Furman (4/3), East Ten-nessee State (4/10) and Campbell (4/14)...Longest outing was three innings at Radford (3/25) where he allowed one run.

2011: Pitched in 10 games, all in relief...did not allow an earned run in his last six outings...struck out 11 hitters in 11.2 innings of work...pitched an inning and struck out two hitters in McCormick Field victory over Western Carolina (4/12)...struck out two hitters at VMI (5/14)...pitched two innings in three different games. Before UNC Asheville: Enjoyed a solid prep career at Mountain Lakes HS in Mountain Lakes, N.J...as a senior had 68 strikeouts in 35 innings of work...earned the Nolan Ryan award for his work on the mound....named to All-County fi rst team following senior campaign...Senior League Rookie of the Year in 2006.

26

Year era w-l app gs cg sho sv ip h r er bb so2011 6 . 9 4 0-0 10 0 0 0/0 0 11.2 15 14 9 7 112012 5 . 0 1 1-1 21 0 0 0/0 4 23.1 27 15 13 8 23TOTAL 5 . 6 6 1-1 31 0 0 0/0 4 35.0 42 29 22 15 34

SINGLE-GAME HIGHS:Innings pitched: 3.0, at Radford, 3-25-12Walks allowed: 2, at High Point, 05-06-12; at Eastern Kentucky, Mar 12, 2011Strikeouts: 3, at Radford, 3-25-12; at Furman, Apr 03, 2012Batters faced: 13, at Gardner-Webb, Mar 20, 2011Field chances: 2, North Carolina, May 15, 2012Assists: 1, 5 timesRunners CS: 1, at Eastern Kentucky, Mar 12, 2011

Page 27: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

25/// F E A R T H E D O G ///

Page 28: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

26 /// F E A R T H E D O G ///

BRIAN CONNOLLYP • 6-5 • JR • THOMASVILLE, N.C.

Overview: Junior right-handed pitcher who has emereged as a weekend starter for the Bulldogs...came to UNC Asheville from Ledford HS in Thom-asville...brother Erik is a freshman on this year’s club.

2012: Versatile member of staff with eight starts and 10 relief appearanc-es ... Tied for team lead in wins with 5-5 record and was second with two saves...Posted third-best ERA (4.62) among starters ...Third in innings pitched (60.1)...Second in strikeout-to-walk ratio (4:1; 28 SO, 7 BB)...Earned wins in fi rst two appearances, in relief vs. N.C. Central (2/17) and in start vs. Saint Peter’s (2/26) ... That start stood as best outing of season (6 innings, two earned runs)...Also allowed two ER in starts vs. VMI (3/17) and Wofford (3/28)...Struck out season-high fi ve at Southern Conference power College of Charleston (5/13)...Recorded saves vs. Presbyterian College (3/31) and Liberty (4/21).

2011: Pitched in 12 games and earned two starts...fi rst career start was a gem as he tossed six shutout innings at Wofford (4-13)...allowed just four hits with two strikeouts as he earned the victory...struck out 13 hitters in 22.1 innings of work...pitched a scoreless inning vs. Big South champion Coastal Carolina (3-25)...had two strikeouts in one inning of work at Charleston Southern (4-2)...threw scoreless inning at VMI (5-14). Before UNC Asheville: Two-way player at Leford head coach Kemp Smith...went 5-3 with 3.10 ERA as a senior on the hill...hit .330 with fi ve home runs and 18 doubles senior season...earned All-Conference and All-County hon-ors as a junior and senior...named Most Valuable Offensive Player as a junior when he hit .391 with three home runs and 20 doubles...fi nished 3-3 with 2.90 ERA junior season...helped lead Ledford to berths in the state playoffs as a sophomore, junior and senior...also played football at Ledford.

29

Year era w-l app gs cg sho sv ip h r er bb so2011 4 . 4 3 1-1 12 2 0 0/1 0 22.1 29 13 11 6 132012 4 . 6 2 5-5 18 8 0 0/1 2 60.1 66 34 31 7 28TOTAL 4 . 5 7 6-6 30 10 0 0/2 2 82.2 95 47 42 13 41

SINGLE-GAME HIGHS:Innings pitched: 6.0, at Wofford College, Apr 13, 2011; Saint Peter's, Feb 26, 2012; Garder-Webb, May 19, 2012Walks allowed: 2, at Wofford, Mar 28, 2012; at Tennessee, Mar 30, 2011Strikeouts: 5, at Coll. of Charleston, May 13, 2012Batters faced: 24, Garder-Webb, May 19, 2012Field chances: 2, at Presbyterian College, Apr 01, 2012; Saint Peter's, Feb 26, 2012; VMI, Mar 17, 2012Putouts: 1, 5 timesAssists: 2, Saint Peter's, Feb 26, 2012Runners CS: 1, VMI, Mar 17, 2012; at Wofford, Mar 28, 2012; at Coll. of Charleston, May 13, 2012

Page 29: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

27/// F E A R T H E D O G ///

Page 30: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

28 /// F E A R T H E D O G ///

ANDREW KIRKLANDP/OF • 5-10 • JR • KENNETT SQUARE, PA

Overview: Junior outfi elder with good speed who will compete for playing time in 2012...had some big hits throughout the year as a sophomore.

2012: Started 12 games and came off the bench 31 times...went 2-for-7 as a pinch-hitter...collected an RBI in start vs. VMI (3/17)... also drove in a run against North Carolina (5/15 at McCormick Field) and with a double against Gardner-Webb (5/18)...other double came against Radford (3/24).

2011: Played in 31 games as a rookie and started six times... Had six hits and four RBI on the season ...earned a start at Campbell (2/26) and had run-scoring single, scored a run and earned two walks...drove in run with single at Eastern Kentucky (3/12)...drove in run as pinch-hitter at Winthrop (4/9)...scored four runs on the year.

Before UNC Asheville: Named Offensive Player of the Year at Unionville after senior season as he hit .416 with 10 home runs, 33 RBI and 10 stolen bases...also named fi rst team All-Conference and All-Region.

36

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2011 .214 31-6 28 4 6 0 0 0 4 2 15 0-02012 .204 43-12 54 9 11 2 0 0 3 9 20 1-2TOTAL .207 74-18 82 13 17 2 0 0 7 11 35 1-2

SINGLE-GAME HIGHS:Hits: 1, 17 timesDoubles: 1, at Radford, 3-24-12; Garder-Webb, May 18, 2012Total bases: 2, at Radford, 3-24-12; Garder-Webb, May 18, 2012RBI: 1, 7 timesRuns scored: 1, 13 timesWalks: 2, at Campbell, Feb 26, 2011; Morehead State, Mar 11, 2012; VMI, Mar 16, 2012Hit by pitch: 1, vs Liberty, 05-22-12; at Liberty, 05/07/11Struck out: 3, at Radford, 3-25-12; at UNCW, Mar 04, 2012Sac bunts: 1, at North Carolina, May 11, 2011At bats: 5, at UNCW, Mar 04, 2012Stolen bases: 1, VMI, Mar 17, 2012Caught stealing: 1, at ETSU, Mar 20, 2012Field chances: 6, at Radford, 3-25-12; VMI, Mar 18, 2012Putouts: 6, at Radford, 3-25-12Assists: 2, Western Carolina, Mar 21, 2012

Page 31: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

29/// F E A R T H E D O G ///

Page 32: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

30 /// F E A R T H E D O G ///

SCOTT ROBINSONP • 6-3 • JR • SEMINOLE, FL

Overview: Junior right-handed pitcher who will compete for time on the mound this season.

2012: Sat out the season due to injury

Before UNC Asheville: Attended Lake Sumter Community College

45

Page 33: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

31/// F E A R T H E D O G ///

RENE MARTINEZP • 6-5 • JR • MIAMI, FL

Overview: Junior right-handed pitcher who will compete for time on the mound this season.

2012: Worked 3.1 innings in seven relief appearances...Allowed only two earned runs in his fi rst three innings...Had scoreless outings against N.C. Cen-tral (2/17), UNC-Wilmington (3/2), Campbell (4/14) and Wofford (4/24).

2011: Had the lowest ERA on team with 0.59 mark in 19 appearances...only decision was a win in 7-6 extra inning victory over Coastal Carolina (3-27) that allowed Bulldogs to take a BSC series from the Chanticleers for the fi rst time in eight seasons...struck out four in 15.1 innings of work...only allowed one earned run the entire season...pitched 2.2 innings of scoreless relief at VMI (5-14)...did not allow any run, earned or unearned in last 14 outings...had 1.1 innings of scoreless work vs. Presbyterian College (5-20). Before UNC Asheville: Attended Westminster Christian HS in Miami...helped lead Westminster to 28-7 overall record senior season...went 3-1 on the mound senior season...named Most Improved at the end of senior year...helped lead school to state championships as a junior and senior.

53

Year era w-l app gs cg sho sv ip h r er bb so2011 0 . 5 9 1-0 19 0 0 0/0 0 15.1 14 4 1 2 42012 13.50 0-0 7 0 0 0/0 0 3.1 8 6 5 5 3TOTAL 2 . 8 9 1-0 26 0 0 0/0 0 18.2 22 10 6 7 7

SINGLE-GAME HIGHS:Innings pitched: 2.2, at VMI, May 14, 2011Walks allowed: 2, at Coll. of Charleston, May 13, 2012Strikeouts: 2, Wofford, Apr 24, 2012Batters faced: 11, at VMI, May 14, 2011Field chances: 1, at ETSU, May 09, 2011; at VMI, May 14, 2011Assists: 1, at ETSU, May 09, 2011; at VMI, May 14, 2011Runners CS: 1, at Coll. of Charleston, May 13, 2012

Page 34: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

32 /// F E A R T H E D O G ///

HUNTER BRYANTIF • 6-4 • SO • ASHEVILLE, N.C.

Overview: Talented sophomore who became UNC Asheville’s starter at fi rst base last season...played at nearby Erwin HS for former Bulldog pitcher Granville Gehris...father is former Bulldog assistant men’s basketball coach Pat Bryant.

2012: Enjoyed impressive freshman season as the regular fi rst baseman (44 starts)... One of four Bulldogs to bat .300 (.303)...Tied for team lead in doubles (10) and was third in hits (50)...Went 5-for-8 with two RBI in three games vs. Saint Peter’s (2/25-26) in team’s second series of the season...Collected sea-son-high two doubles vs. Morehead State (3/11) as part of 3-for-5, two-RBI day...Other three-hit games came against VMI (3/18; 3-for-5), East Tennessee State (4/10; 3-for-4) and High Point (5/23; 3-for-4) in Big South Tournament fi nale...Drove in season-best three runs against Charleston Southern (4/7).

Before UNC Asheville: Played at Erwin where he played for former Bull-dog pitcher Granville Gehris...named to All-Conference team and All-Region team as a junior and senior...led Warriors in hitting as a senior with .441 average with 10 home runs and 28 RBI...junior season hit .482 with seven home runs...was ranked as 24th best prospect in North Carolina by Impact Baseball...played for Dirtbags Elite team and was a member of the Asheville American Legion Post 70...also excellent in basketball at Erwin where he was a three-year starter for the Warriors and helped lead Erwin to two confer-ence titles.

7

Year avg gp-gs ab r h 2b 3b hr rbi bb so sb-att2012 .303 47-44 165 8 50 10 0 0 19 15 36 1-1TOTAL .303 47-44 165 8 50 10 0 0 19 15 36 1-1

SINGLE-GAME HIGHS:Hits: 3, 4 timesDoubles: 2, Morehead State, Mar 11, 2012Total bases: 5, Morehead State, Mar 11, 2012RBI: 3, Charleston Southern, Apr 07, 2012Runs scored: 1, 8 timesWalks: 2, Charleston Southern, Apr 07, 2012Hit by pitch: 1, at UNCW, Mar 04, 2012Struck out: 2, 6 timesSac bunts: 1, at Radford, 3-25-12At bats: 5, 8 timesStolen bases: 1, at Presbyterian College, Mar 31, 2012Field chances: 20, Liberty, 04-20-12Putouts: 17, Liberty, 04-20-12Assists: 3, Liberty, 04-20-12

Page 35: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

33/// F E A R T H E D O G ///

Page 36: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

34 /// F E A R T H E D O G ///

EVAN JOURAP • 6-1 • SO • ASHEVILLE, N.C.

Overview: Sophomre right-handed pitcher from Asheville who did a nice job for the Bulldogs out of the bullpen as a freshman...attended Carolina Day.

2012: Posted second-best ERA on team (2.77)...Worked 13 innings in 14 appearances...Five of nine runs allowed were unearned...Did not allow a run in fi rst 10 games covering 7.1 innings...Worked three shutout innings with season-high three strikeouts at Presbyterian College (3/30)...Allowed one earned run in four innings against Georgia State (5/8) in his longest outing of season.

Before UNC Asheville: Had a strong career at Carolina Day...earned All-Conference honors as a senior and named Honorable Mention All-Region. ..as a hitter hit .486 as he played shortstop as well as pitched...also ran cross country.

18

Year era w-l app gs cg sho sv ip h r er bb so2012 2 . 7 7 0-0 14 0 0 0/0 0 13.0 15 9 4 4 6TOTAL 2 . 7 7 0-0 14 0 0 0/0 0 13.0 15 9 4 4 6

SINGLE-GAME HIGHS:Innings pitched: 4.0, Georgia State, May 08, 2012Walks allowed: 1, 4 timesStrikeouts: 3, at Presbyterian College, Mar 30, 2012Batters faced: 14, Georgia State, May 08, 2012Field chances: 1, 4 timesAssists: 1, at Furman, Apr 03, 2012; Charleston Southern, Apr 07, 2012; Western Carolina, Mar 21, 2012

Page 37: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

35/// F E A R T H E D O G ///

NICK SCHAVONEP • 5-10 • SO • APEX, N.C.

Overview: Sophomore left-hander pitcher who missed most of 2011 season with injury...bounced back last season and gave the Bulldogs a real lift on the mound....role should expand in 2013...last name is pronounced Shah-VOE-Nee.

2012: Made 12 appearances out of the bullpen, working 5.1 innings...Re-corded shutout innings against Western Carolina (3/21) and Gardner-Webb (5/17)...Had six other scoreless outings, highlighted by a two-out effort at North Carolina (4/11).

2011: Pitched in just two games before being red-shirted...earned a strikeout in 0.2 innings of work vs. Murray State (2/19)...also pitched at Eastern Ken-tucky (3/12). Before UNC Asheville: Attended Middle Creek HS in Apex...went 2-0 with four saves in 16 appearances with 1.33 ERA senior year...as a junior went 2-1 with three saves and 2.50 ERA...helped lead Middle Creek to confer-ence championship as a junior and school went to state playoffs junior and senior year...earned Mustang Award for team leadership two straight years...played in the North Carolina East-West All-State Game in summer of 2010...was named West Raleigh Exchange Club Youth of the Year...awarded a Leaf Scholarship in 2010.

22

Year era w-l app gs cg sho sv ip h r er bb so2011 18.00 0-0 2 0 0 0/0 0 1.0 1 2 2 5 12012 11.81 0-0 12 0 0 0/0 0 5.1 7 9 7 5 3TOTAL 12.79 0-0 14 0 0 0/0 0 6.1 8 11 9 10 4

SINGLE-GAME HIGHS:Innings pitched: 1.0, Western Carolina, Mar 21, 2012; Garder-Webb, May 17, 2012Walks allowed: 4, Murray State, Feb 19, 2011Strikeouts: 1, 4 timesBatters faced: 7, Murray State, Feb 19, 2011Field chances: 2, at North Carolina, Apr 11, 2012Assists: 2, at North Carolina, Apr 11, 2012Runners CS: 1, Western Carolina, Mar 21, 2012

Page 38: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

36 /// F E A R T H E D O G ///

ELLIOT CRISSP • 6-4 • SO • COLLEGEVILLE, PA

Overview: Was awarded a red-shirt after missing most of 2011 season with injury...did solid job for the Bulldogs on the mound in 2012 and should be contributor for UNC Asheville this season.

2012: Tied for third on staff in appearances (20)...Finished tied for second in saves with two...Struck out 25 and walked 13 in 35 innings...Best of three starts took place against East Tennessee State (4/10) with one run allowed in four innings...Most impressive appearances were four innings of shutout relief for win vs. Liberty (4/20) and three scoreless innings at Radford (3/24)...Posted saves against Saint Peter’s (2/26) and at High Point (5/6)...First win came against VMI (3/16) after recording fi nal out in the top of the last inning.

2011: Pitched in four games before being shut down...earned a start in open-ing weekend of the season vs. Murray State (2/20)...pitched four innings and allowed six runs but all were unearned...also had a start at Campbell (2/26)...pitched twice for one-third of an inning at Eastern Kentucky (3/12 & 13). Before UNC Asheville: Enjoyed solid career for Spring-Ford....senior year had an ERA of 1.94 with a 3-2 record...struck out 66 and walked just 20...junior season posted a 1.81 ERA with a 3-2 worksheet and struck out 62 with 17 walks....was named to All-Area team as a junior and senior...as a sophomore helped lead school to state championship game...also lettered in football in high school.

23

Year era w-l app gs cg sho sv ip h r er bb so2011 8 . 4 4 0-1 4 2 0 0/0 0 5.1 8 14 5 1 12012 6 . 4 3 2-3 20 3 0 0/0 2 35.0 40 34 25 13 25TOTAL 6 . 6 9 2-4 24 5 0 0/0 2 40.1 48 48 30 14 26

SINGLE-GAME HIGHS:Innings pitched: 4.0, Liberty, 04-20-12; ETSU, Apr 10, 2012; Murray State, Feb 20, 2011Walks allowed: 2, 4 timesStrikeouts: 4, Liberty, 04-20-12; at Coll. of Charleston, May 12, 2012Batters faced: 21, Murray State, Feb 20, 2011Field chances: 3, Liberty, 04-20-12Putouts: 2, Liberty, 04-20-12Assists: 1, 8 timesRunners CS: 1, at UNCW, Mar 02, 2012; VMI, Mar 16, 2012

Page 39: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

37/// F E A R T H E D O G ///

Page 40: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

38 /// F E A R T H E D O G ///

ADAM SPRACKLINP • 6-1 • SO • FARMINGTON, CT

Overview: Talented left-hander who showed great deal of promise on the mound as a freshman last season...was used as a part-time starter but mainly came out of the bullpen ... will sit out the 2013 season due to injury.

2012: Started three games and came out of bullpen 17 times...His 2-4 record included a win in a 3.2-inning start at Furman (4/3) where he allowed one run and struck out three...Picked up a victory in his fi nal game as he worked 1.2 innings of scoreless relief against Gardner-Webb (5/18)...Longest appearance was 4.1 innings of relief against Liberty (4/22)...Also started at East Tennessee State (3/20), where he allowed one run in 2.2 innings, and at North Carolina (4/11).

Before UNC Asheville: Helped lead Old Farms to 17-1 record as a senior plus county and conference championships...as a junior had 2.00 ERA with 42 strikeouts in 35 innings of work...member of Unionville American Legion that advanced to state playoffs in summer of 2011...MVP of Old Farms football team as a senior.

28

Year era w-l app gs cg sho sv ip h r er bb so2012 6 . 1 2 2-4 20 3 0 0/0 0 32.1 39 30 22 20 20TOTAL 6 . 1 2 2-4 20 3 0 0/0 0 32.1 39 30 22 20 20

SINGLE-GAME HIGHS:Runs scored: 1, vs Liberty, 05-22-12Innings pitched: 4.1, Liberty, 04-22-12Walks allowed: 4, at Radford, 3-23-12Strikeouts: 3, at Radford, 3-23-12; at Furman, Apr 03, 2012Batters faced: 20, Liberty, 04-22-12Field chances: 2, at UNCG, Feb 21, 2012; VMI, Mar 16, 2012; at ETSU, Mar 20, 2012Putouts: 1, at Wake Forest, Feb 28, 2012Assists: 2, VMI, Mar 16, 2012; at ETSU, Mar 20, 2012Runners CS: 1, at South Carolina, Mar 07, 2012

Page 41: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

39/// F E A R T H E D O G ///

JUSTIN HUNTP • 6-2 • SO • KERNERSVILLE, N.C.

Overview: Right-handed pitcher who red-shirted in 2011 but helped in 2012...will compete for more time on the mound in 2013.

2012: Worked 10.2 innings in eight relief appearances...Only decision was a win in thrilling extra-inning game against rival Western Carolina at McCor-mick Field (3/21) when he worked a one-run 12th...Posted scoreless outings against South Carolina (3/7), East Tennessee State (3/20 and 4/10) and Liberty (5/22 in Big South Tournament).

2011: Did not play Before UNC Asheville: Named Pitcher of the Year as senior as he had a 5-5 record with one save, 2.90 ERA and 68 strikeouts...junior year went 4-1 with two saves...posted an ERA of 1.70 with 52 strikeouts...lettered in football and swimming at Glenn...was all-conference in swimming fi ve different times.

44

Year era w-l app gs cg sho sv ip h r er bb so2012 5 . 0 6 1-0 8 0 0 0/0 0 10.2 13 6 6 4 3TOTAL 5 . 0 6 1-0 8 0 0 0/0 0 10.2 13 6 6 4 3

SINGLE-GAME HIGHS:Innings pitched: 3.0, vs NC State, Mar 02, 2012Walks allowed: 2, at UNCG, Feb 21, 2012; vs NC State, Mar 02, 2012Strikeouts: 1, at UNCG, Feb 21, 2012; Western Carolina, Mar 21, 2012; Georgia State, May 08, 2012Batters faced: 14, vs NC State, Mar 02, 2012Field chances: 1, at UNCG, Feb 21, 2012; at South Carolina, Mar 07, 2012Putouts: 1, at UNCG, Feb 21, 2012Assists: 1, at South Carolina, Mar 07, 2012

Page 42: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

40 /// F E A R T H E D O G ///

KYLE TOWLESIF • 5-9 • SO • COLUMBIA, S.C.

Overview: Red-shirted last season after playing one season at USC-Lancast-er...Three-sport athlete who could play more than one infi eld position...Likely will bat at top of the order...Plans to major in Accounting.

Before UNC Asheville: Hit .370 in leadoff spot for USC-Lancaster in 2011...Batted .571 as a senior at Hammond School...Selected SCISA Player of the Year in 2010...Also played football and basketball in high school.

3

PHILLIP TREADWAYIF/OF • 5-11 • JR • FLETCHER, N.C.

Overview: Speed makes him a defensive asset in center fi eld...Played for coach Brian Craig’s perennially successful program at nearby A.C. Reynolds High School...Plans to major in Marketing.

Before UNC Asheville: Set the ACR season record for home runs with 15 as a senior while batting .494 with on-base percentage of .526...All-Mountain Athletic Conference selection from 2008-10 and all-state choice as a senior...Played last season for Middle Georgia’s standout junior college program and for Western Carolina in 2011.

6

Page 43: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

41/// F E A R T H E D O G ///

LUCAS OWENSIF • 5-10 • FR • FOREST CITY, N.C.

Overview: Part of East Rutherford’s powerhouse 2-A program that pro-duced state title in his sophomore season and a runner-up fi nish the follow-ing season...One of only two left-handed hitting position players on Bulldog roster.

Before UNC Asheville: Batted .477 as a junior and .455 as a senior with 10 doubles, 3 triples and 3 home runs...Selected to 2-A all-state team in 2011 and 2012...Played in 2011 State Games.

1

JUSTIN WOODSIF • 6-0 • FR • WAYNESVILLE, N.C.

Overview: Freshman infi elder from nearby Waynesville who could push for playing time...enjoyed great prep career at Tuscola HS.

Before UNC Asheville: Helped lead Tuscola to three straight conference championships...played for head coach Caleb McConnell...was All-Confer-ence selection as a junior and senior...junior year was named second team All-Region...team MVP as a junior and Offensive Player of the Year as senior...hit .421 as a junior with three home runs and 26 RBI...senior season hit .425 with two home runs and 28 RBI...excellent athlete who also lettered in bas-ketball, cross country and track & fi eld.

9

Page 44: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

42 /// F E A R T H E D O G ///

MITCH CARSTENSC • 6-1 • FR • HIGH POINT, N.C.

Overview: Talented freshman catcher who will battle for playing time as a rookie...comes to UNC Asheville via Ragsdale HS in Jamestown.

Before UNC Asheville: Team MVP at Ragsdale as a junior and senior...was a scholar-athlete all four of his years in high school...played for head coach Donnie Maness...earned All-Conference honors as a junior hitting .420 with one home run and 20 RBI...hit .340 as a senior with one home run and 15 RBI.

10

ANDREW MADDENOF • 6-2 • FR • HIGH POINT, N.C.

Overview: One of four outfi elders on roster who will be competing for playing time and should progress with seasoning...Will be counted upon to supply offensive punch after an impressive fall season...Plans on career in engineering.

Before UNC Asheville: Chosen Southwest Guilford’s offensive most valu-able player his junior and senior seasons...Picked All-Piedmont Triad 4-A Con-ference both years...Led his team to share of conference titles in 2011 and 2012.

12

Page 45: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

43/// F E A R T H E D O G ///

ERIK CONNOLLYOF • 6-2 • FR • THOMASVILLE, N.C.

Overview: Brother of Bulldog junior RHP Brian Connolly...Will battle three other outfi elders for playing time...Plans to major in Economics.

Before UNC Asheville: Batted .354 with 4 home runs as a senior...Chosen All-Mid-Piedmont 3-A Conference last season...Also played football in high school.

16

ZACK WISEMANP • 6-2 • FR • BURNSVILLE, N.C.

Overview: Freshman left-hander pitcher from nearby Burnsville who will compete for playing time on the mound in 2013.

Before UNC Asheville: Attended Mountain Heritage HS in Burnsville...earned All-Conference honors and was the team MVP as a senior...played for head coach Rick Flynn.

21

Page 46: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

44 /// F E A R T H E D O G ///

COREY RANDALLP • 6-1 • FR • MOCKSVILLE, N.C.

Overview: Expected to see time in infi eld and outfi eld as well as on mound...Owns outstanding change-up for an incoming freshman...Lists most infl u-ential person as New York Yankees second baseman Robinson Cano (“So smooth!”).

Before UNC Asheville: Hit .506 senior season with 6 home runs while post-ing a 1.92 ERA on the mound...As junior his numbers were .423, 8 HRs, 2.46 ERA...Named all-state and Central Piedmont 4-A Conference Player of the Year as senior...Led team to back-to-back conference titles last two seasons.

25

LUCAS CLARKEP • 6-3 • FR • MORGANTON, N.C.

Overview: Arrives at UNC Asheville with four seasons of varsity experi-ence...Joins three other lefties on the Bulldog pitching staff...Two-way player who will see time in the outfi eld...Expects to major in Computer Science.

Before UNC Asheville: Earned All-Catawba Valley 2-A Conference recogni-tion as junior and senior...First pitcher in school history to post a win, hit and RBI in same game.

27

Page 47: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

45/// F E A R T H E D O G ///

The 2013 season will be Hall of Fame coach Tom Smith’s fourth year as head of the UNC Asheville baseball program.

In 2012, Smith directed the Asheville program to 25 victories and a fourth-place fi nish in the Big South Conference. The Bulldogs were a preseason pick to fi nish in last place but recorded 12 league victories, the second highest in the program’s history. Asheville recorded two wins at NCAA participant College of Charleston plus an exciting 12-inning win over Western Carolina to highlight the season.

The 2011 campaign saw Smith guide the Bulldogs to 15 victories and won a Big South Conference series from league champion Coastal Carolina for the fi rst time in eight years. Asheville also picked up its fi rst ever sweep of mountain rival Western Carolina.

In his fi rst year, the Bulldogs moved from nine wins to 17 victories. Asheville was a preseason pick to fi nish in last place in the Big South Conference. The Bulldogs used a late-season surge to fi nish in seventh place and qualify for the Big South Tournament. Smith’s club won fi ve straight conference games to move from 10th place to the seventh spot. Other highlights included an impressive non-conference victory over Southern Conference champion College of Charleston plus win-ning conference series from Liberty and Charleston Southern.

He has served as a volunteer assistant coach at Asheville in 2008 and a part-time assistant in 2009 before being named head coach.

Before coming to UNC Asheville, Smith was one of the top high school coaches in the nation at T.C. Roberson HS in Asheville. He coached the Rams program for 28 years and led the school to three 3-A state titles in 1983, 2000 and 2002. The Rams won 14 conference titles during his tenure.

“Tom Smith is a proven leader with tremendous desire who will di-rect our baseball program forward,” stated Director of Athletics Janet R Cone upon Smith’s hiring. “He has the knowledge of the game of baseball and is a proven recruiter.

“We are confi dent that Tom Smith will get the job done with our baseball program in the classroom and the community,” stated Cone. “We are equally as confi dent he will lead our program to being just as competitive on the fi eld.

Smith had 20 players drafted by major league teams during his time at Roberson. The list includes pitcher Darren Holmes who went to pitch 17 years in the major leagues, current left-hander pitcher Chris Narveson of the Milwaukee Brewers and outfi elder Cameron Maybin of the San Diego Padres, who was drafted in the fi rst round in 2005. In January of 2010, January Smith was inducted into the North Caro-lina Baseball Coaches Association Hall of Fame. The Association is made up of coaches of amateur baseball throughout the state. Smith was honored by Roberson in May of 2012 when he was named to the school’s Ring of Honor. Tom and his wife Karen have two children, Kenny and Katie. Kenny enjoyed a standout collegiate career at UNC Wilmington and West-ern Carolina. He served as a volunteer assistant for two years at Asheville before being hired by MEAC power Bethune-Cookman in the fall of 2011.

TOM SMITHHEAD COACH - FOURTH SEASON

Page 48: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

46 /// F E A R T H E D O G ///

Former Ball State assistant coach and former Winthrop standout Jeremy Plexico joined Tom Smith’s coaching staff in July 2012. He re-places Aaron Rembert, who left in June to take the head coaching position at Mars Hill College.

“We’re delighted to have Jeremy Plexico as a part of our program,” stated Smith. “Jeremy enjoyed an outstanding career as a player both in college and in pro ball. He’s picked up a lot of experience in coach-ing and is going to help our program in a lot of different ways. We’re glad that Jeremy’s a Bulldog.”

Plexico, a native of Chapin, S.C., had been at Ball State the past two years. In 2011, he helped the Cardinals post an 11-15 record in Mid-American Conference play. Under his guidance, junior right-hander Cal Bowling posted a career-high four complete games, which led the MAC in 2011. Bowling’s 89.2 innings worked ranked eighth in the MAC.

Plexico spent the 2010 season as the pitching coach at Young Harris College (Ga.) where he helped the Mountain Lions to a 39-17 over-all record. Under his tutelage, freshman left-hander Mitchell Knox earned All-Conference honors while posting an 8-3 record with 48 strikeouts compared to just 20 walks.

Plexico was a left-handed standout at Winthrop where he earned Third Team All-America honors as a senior in 2003 after leading the Big South Conference with an 11-3 record. He appeared in 17 games and posted a league-high fi ve complete games while logging a 2.90 ERA in 108.2 innings pitched. As a junior, he had a 9-5 record with a 4.38 ERA in 109 innings of work. He had transferred to Winthrop from the University of South Carolina.

Plexico excelled not only on the playing fi eld at Winthrop but in the classroom as well. As a senior, he was voted by the Big South Con-ference’s sports information directors as the league’s Male Scholar Athlete of the Year. Also, he earned the Winthrop Senior Academic Award for the highest GPA for a senior male and Big South Presiden-tial Scholar accolades.

Plexico was drafted out of Winthrop in the 19th round of the 2003 Major League Baseball First-Year Player Draft by the Montreal Expos. In his fi rst professional stop, he tied for the Vermont Expos’ team lead in victories in the short-season New York-Penn League in 2003.

In 2004, he had one of his best years posting an (8-5) record with six saves and a 2.63 ERA. He also struck out 102 batters in 82 innings while holding opponents to a .195 batting average. After having shoulder surgery in December 2004, Plexico started an impressive 2006 season with Potomac of the Carolina League, posting a 3-0 record and a 1.93 ERA out of the bullpen before being promot-ed to Double-A Harrisburg. He made 34 appearances for Harrisburg and posted a 4-3 record with a 4.00 ERA. He also made 43 appear-ances, including 40 out of the bullpen, in 2007 for the Senators. Plexico returned to his role as a starter in 2008 when he joined the Gary Southshore Railcats of the Northern League. He posted a 10-3 record with a 2.79 ERA while being named the Northern League Pitcher of the Year. He held opponents to a .250 batting average while striking out 68 batters and walking just 32. His 135.1 innings pitched led the league, while his 2.79 ERA was third. He was also the winning pitcher for the Northern League All-Star Game and was named to Baseball America’s All-Independent League Second Team. Plexico received his bachelor’s degree in history in 2002 and his mas-ter’s degree in teaching (social studies) in 2008 from Winthrop.

JEREMY PLEXICOASSISTANT COACH - FIRST SEASON

Page 49: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

47/// F E A R T H E D O G ///

UNC Asheville head baseball coach Tom Smith is pleased to announce the addition of former College of Charleston assistant coach Brent Walsh to the Bulldog coaching staff for the 2013 season.

“The team and I are quite excited having Coach Walsh as a part of our pro-gram,” stated Smith. “His energy and knowledge of the game have made prac-tices and scrimmages much more challenging. He’s doing a great job working with our infi elders and hitters and I can already see a big difference in our execution and production.

“Coach Walsh was part of a great program at College of Charleston,” added Smith. “His experience is a real asset to our program.”

Walsh coached at the College of Charleston for four seasons. He served as the infi elders coach and assisted with the hitters. He also coached third base during his tenure. The Cougars won 156 games during Walsh’s time in

Charleston and received at-large bids to the NCAA Tournament in 2010 and 2012.

Walsh started coaching as an assistant at Richland Northeast High School, and the Cavaliers won two South Carolina 4A Lower state titles, a 4A State Title and numerous region titles during his tenure. Before coaching at the College of Charleston, Walsh served as the head coach at Ben Lippen HS in Columbia, S.C. where he led the Falcons to two state championship series and one state title in his three years in charge. In the summer and fall, he has served four years as a head coach for the prestigious fi ve-time national champion South Carolina Diamond Devils pro-gram. He and his wife Jennifer and had their fi rst child, Gideon, in May 2012.

BRENT WALSHASSISTANT COACH - FIRST SEASON

Former Bulldog second baseman Jordie Lurie is helping the UNC Asheville program this year as a student assistant.

Lurie was a valuable player for the Bulldogs during his career. His best season was his junior year as Jordan led Asheville in total bases (91), at bats (229), runs scored (34) and hits (75). He was second in hitting with a .339 average. The Ohio native was the only Asheville player to play in all 52 games, earning 51 starts. He started and played in 49 games last year and hit .294 with 10

doubles and helped lead the Bulldogs to a fourth-place fi nish in the Big South Conference. “We’re delighted Jordan is with us this year,” said Bulldog head coach Tom Smith. “He was a hard-worker who played hard every day he wore an Asheville uniform.”

JORDAN LURIEVOLUNTEER COACH - FIRST SEASON

Page 50: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

48 /// F E A R T H E D O G ///

Page 51: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

49/// F E A R T H E D O G ///

Page 52: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

50 /// F E A R T H E D O G ///

2012 UNC ASHEVILLE STATISTICSRecord: 25-30 Home: 13-12 Away: 12-16 Neutral: 0-2 Conference: 12-12

Player avg gp-gs ab r h 2b 3b hr rbi tb slg% bb hp so gdp ob% sf sh sb-att po a e fld%34 WRIGHT, Aaron . 3 4 0 31-10 53 6 18 1 0 3 10 28 . 5 2 8 4 1 13 0 . 3 9 7 0 0 0-0 0 0 0 . 0 0 0 4 BUCH, Cody . 3 0 7 54-49 176 25 54 8 0 4 16 74 . 4 2 0 15 0 36 6 . 3 5 8 2 0 0-3 29 93 12 . 9 1 030 CREIGHTON, Billy . 3 0 6 49-41 160 22 49 10 0 6 32 77 . 4 8 1 22 1 25 6 . 3 8 9 2 0 0-0 2 3 1 . 8 3 3 7 BRYANT, Hunter . 3 0 3 47-44 165 8 50 10 0 0 19 60 . 3 6 4 15 1 36 2 . 3 6 5 0 1 1-1 394 19 3 . 9 9 3 6 BESS, Thomas . 2 9 9 50-40 154 20 46 4 1 0 17 52 . 3 3 8 14 4 37 2 . 3 7 2 0 11 10-13 119 2 1 . 9 9 216 KOONTZ, Patrick . 2 9 8 51-45 161 28 48 8 2 8 28 84 . 5 2 2 13 5 30 1 . 3 6 9 0 3 5-6 82 3 3 . 9 6 614 LURIE, Jordan . 2 9 4 49-49 194 29 57 10 0 0 18 67 . 3 4 5 26 6 17 0 . 3 9 2 1 7 13-17 85 144 12 . 9 5 0 8 GRAHAM, Ian . 2 7 9 47-44 154 19 43 9 1 0 22 54 . 3 5 1 23 6 26 2 . 3 9 1 1 1 0-0 273 35 7 . 9 7 8 3 ADKINS, Cody . 2 5 6 36-23 86 14 22 1 0 2 14 29 . 3 3 7 7 5 18 1 . 3 4 3 1 1 2-3 56 0 0 1.000

32 JOYNER, Todd . 2 5 3 47-39 166 21 42 10 0 2 18 58 . 3 4 9 8 0 26 3 . 2 8 4 2 1 2-2 162 8 5 . 9 7 113 WESTON, Kyle . 2 3 6 28-16 55 12 13 2 0 0 5 15 . 2 7 3 10 0 10 1 . 3 4 8 1 1 0-0 7 34 9 . 8 2 0 2 MILLER, Eli . 2 3 3 49-42 163 24 38 7 0 0 12 45 . 2 7 6 11 2 25 1 . 2 8 7 2 4 5-7 75 114 8 . 9 5 933 GAJDOSZ, Grant . 2 0 7 37-23 87 11 18 2 0 1 8 23 . 2 6 4 8 1 21 1 . 2 7 8 1 1 1-1 25 0 2 . 9 2 636 KIRKLAND, Andrew . 2 0 4 43-12 54 9 11 2 0 0 3 13 . 2 4 1 9 1 20 0 . 3 2 8 0 0 1-2 38 3 1 . 9 7 6--------------------25 EBERSOLE, Casey . 2 5 0 18-8 28 3 7 2 0 0 2 9 . 3 2 1 5 0 6 1 . 3 6 4 0 1 0-1 17 21 3 . 9 2 715 TURNER, Sam . 1 0 5 21-10 38 5 4 0 0 0 2 4 . 1 0 5 5 1 19 3 . 2 2 7 0 0 0-0 59 6 0 1.000

1 SHAW, Trent . 0 0 0 2-0 2 0 0 0 0 0 0 0 . 0 0 0 0 0 1 0 . 0 0 0 0 0 0-0 0 0 0 . 0 0 018 BYRD, Kyle . 0 0 0 1-0 1 0 0 0 0 0 0 0 . 0 0 0 0 0 0 0 . 0 0 0 0 0 0-0 0 0 0 . 0 0 047 JOURA, Evan . 0 0 0 1-0 0 0 0 0 0 0 0 0 . 0 0 0 0 0 0 0 . 0 0 0 0 0 0-0 0 3 1 . 7 5 028 SPRACKLIN, Adam . 0 0 0 1-0 0 1 0 0 0 0 0 0 . 0 0 0 0 0 0 0 . 0 0 0 0 0 0-0 1 9 1 . 9 0 9Totals . 2 7 4 55 1897 257 520 86 4 26 226 692 . 3 6 5 195 34 366 30 . 3 5 0 13 32 40-56 1450 563 80 . 9 6 2

Opponents . 2 8 7 55 1909 327 548 101 14 29 297 764 . 4 0 0 171 52 337 24 . 3 5 8 22 41 66-86 1464 586 69 . 9 6 7

LOB - Team (451), Opp (418). DPs turned - Team (38), Opp (46). CI - Team (0), Opp (1). IBB - Team (7), CREIGHTON, B 4,BRYANT, H. 1, ADKINS, C. 1, BUCH, C. 1. Picked off - LURIE, J. 3, GRAHAM, I. 2, KOONTZ, P. 2, BRYANT, H. 2, BUCH, C. 1, BESS,T. 1, WRIGHT, A. 1.

(All games Sorted by Earned run avg)

Player era w-l app gs cg sho sv ip h r er bb so 2b 3b hr b/avg wp hp bk sfa sha50 TABAR, Dillon 1 . 7 2 1-1 22 0 0 0/0 1 36.2 34 10 7 10 19 3 0 1 . 2 5 0 3 1 0 2 147 JOURA, Evan 2 . 7 7 0-0 14 0 0 0/0 0 13.0 15 9 4 4 6 2 1 0 . 3 0 6 1 3 0 2 111 DULL, Ryan 3 . 5 5 5-5 14 14 1 1/1 0 83.2 93 39 33 13 84 14 4 5 . 2 8 0 3 9 0 1 619 ROLAND, Dean 3 . 9 2 5-6 16 15 1 0/1 0 96.1 93 50 42 29 61 15 1 2 . 2 5 7 10 16 1 3 729 CONNOLLY, Brian 4 . 6 2 5-5 18 8 0 0/1 2 60.1 66 34 31 7 28 13 5 4 . 2 8 1 0 3 2 5 426 STEIBLE, Ethan 5 . 0 1 1-1 21 0 0 0/0 4 23.1 27 15 13 8 23 7 1 2 . 2 8 7 2 3 2 1 144 HUNT, Justin 5 . 0 6 1-0 8 0 0 0/0 0 10.2 13 6 6 4 3 5 1 1 . 3 0 2 0 1 0 0 031 SPEAR, Drew 5 . 9 6 2-4 13 10 0 0/0 1 45.1 63 39 30 24 31 12 1 2 . 3 2 5 3 4 0 3 728 SPRACKLIN, Adam 6 . 1 2 2-4 20 3 0 0/0 0 32.1 39 30 22 20 20 4 0 5 . 3 1 0 2 3 1 3 723 CRISS, Elliot 6 . 4 3 2-3 20 3 0 0/0 2 35.0 40 34 25 13 25 7 0 4 . 2 8 8 7 4 0 0 527 KRUGH, Taylor 9 . 0 0 0-0 15 0 0 0/1 0 15.0 17 15 15 10 11 4 0 0 . 2 7 4 0 1 0 0 040 DAVIS, Klint 9 . 6 9 1-1 15 1 0 0/1 0 13.0 19 20 14 12 11 6 0 0 . 3 3 3 5 1 0 1 1-------------------- 2 MILLER, Eli 0 . 0 0 0-0 2 0 0 0/0 0 1.2 1 0 0 1 0 0 0 0 . 2 0 0 0 0 0 1 022 SCHAVONE, Nick 11.81 0-0 12 0 0 0/0 0 5.1 7 9 7 5 3 2 0 0 . 3 1 8 0 1 0 0 130 CREIGHTON, Billy 11.88 0-0 9 1 0 0/0 0 8.1 13 11 11 6 9 6 0 2 . 3 6 1 1 1 2 0 053 MARTINEZ, Rene 13.50 0-0 7 0 0 0/0 0 3.1 8 6 5 5 3 1 0 1 . 4 7 1 1 1 0 0 0Totals 4 . 9 0 25-30 55 55 2 3/2 10 483.1 548 327 263 171 337 101 14 29 . 2 8 7 38 52 8 22 41

Opponents 3 . 7 8 30-25 55 55 0 2/2 9 488.0 520 257 205 195 366 86 4 26 . 2 7 4 59 34 1 13 32

PB - Team (6), TURNER, S. 5, GRAHAM, I. 1, Opp (14). Pickoffs - Team (15), ROLAND, D. 7, DULL, R. 3, GRAHAM, I. 2, TURNER, S.1, CRISS, E. 1, SPRACKLIN, A 1, Opp (11). SBA/ATT - GRAHAM, I. (44-60), TURNER, S. (21-23), SPEAR, D. (15-19), CRISS, E.(10-12), TABAR, D. (7-9), CONNOLLY, B. (4-7), DULL, R. (4-6), ROLAND, D. (3-6), SPRACKLIN, A (4-5), KRUGH, T. (5-5),MARTINEZ, R. (3-4), CREIGHTON, B (3-4), DAVIS, K. (3-3), JOURA, E. (3-3), SCHAVONE, N. (1-2), HUNT, J. (1-1), MILLER, E.(1-1).

Page 53: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

51/// F E A R T H E D O G ///

2012 UNC ASHEVILLE STATISTICSy ( )

Batting (All games)

Date Opponent ab r h rbi 2b 3b hr bb ibb sb cs hbp sac sf gdp k po a e avgFeb 17 at NC Central 39 13 12 11 0 0 1 14 0 2 0 2 0 0 0 6 27 8 0 . 3 0 8Feb 18 at NC Central 31 9 11 9 3 0 1 5 0 5 0 0 1 0 0 1 21 9 1 . 3 2 9Feb 18 at NC Central 41 10 12 9 5 0 3 3 0 0 0 1 1 0 0 4 27 15 1 . 3 1 5Feb 21 at UNCG 36 5 10 5 3 0 0 5 0 1 0 0 0 0 1 10 24 8 5 . 3 0 6Feb 25 SAINT PETER'S 23 3 6 3 0 1 0 2 1 0 2 0 0 0 0 7 21 5 1 . 3 0 0Feb 25 SAINT PETER'S 26 1 8 1 0 0 0 3 0 1 0 0 0 1 2 3 21 12 4 . 3 0 1Feb 26 SAINT PETER'S 25 7 7 5 1 0 0 4 0 0 1 2 0 1 0 7 21 11 2 . 2 9 9Feb 26 SAINT PETER'S 24 4 7 4 0 0 0 2 0 0 0 2 1 1 0 2 21 12 3 . 2 9 8Feb 28 at Wake Forest 34 8 8 8 1 0 0 4 0 0 0 1 0 0 0 11 24 12 0 . 2 9 0Mar 02 vs NC State 33 1 7 1 1 0 0 1 0 1 0 1 0 0 1 7 27 11 1 . 2 8 2Mar 02 at UNCW 28 1 4 1 1 0 0 7 1 0 0 2 2 0 1 12 24 5 3 . 2 7 1Mar 04 at UNCW 37 7 10 7 3 0 1 5 0 0 0 1 0 1 0 5 27 8 3 . 2 7 1Mar 06 FURMAN 30 1 4 1 1 0 0 0 0 0 0 0 0 0 2 6 27 11 1 . 2 6 0Mar 07 at South Carolina 31 1 4 1 1 0 0 5 0 0 0 0 0 0 0 8 24 15 0 . 2 5 1Mar 09 MOREHEAD STATE 38 3 11 2 2 0 0 2 1 2 1 0 1 0 0 8 27 10 0 . 2 5 4Mar 10 MOREHEAD STATE 34 5 12 5 1 0 0 4 0 1 0 1 0 1 2 2 27 11 6 . 2 6 1Mar 11 MOREHEAD STATE 38 13 15 10 3 0 0 7 0 0 0 0 0 1 1 2 27 11 0 . 2 7 0

*Mar 16 VMI 42 5 18 4 2 0 1 5 1 0 0 1 1 0 0 12 30 12 2 . 2 8 1*Mar 17 VMI 33 6 9 5 0 0 0 0 0 3 0 0 2 0 0 4 27 7 3 . 2 8 1*Mar 18 VMI 38 9 14 7 5 0 1 4 0 3 0 0 1 0 0 4 27 7 3 . 2 8 6Mar 20 at ETSU 29 1 5 0 0 0 0 1 0 0 1 0 0 0 2 3 24 12 1 . 2 8 1Mar 21 WESTERN CAROLINA 45 3 11 3 3 0 1 7 1 0 1 0 1 0 0 9 36 11 2 . 2 7 9

*3-23-12 at Radford 29 1 3 1 2 0 0 1 0 1 0 1 0 1 0 9 24 1 2 . 2 7 2*3-24-12 at Radford 33 0 8 0 3 0 0 1 0 0 0 0 0 0 2 3 24 7 2 . 2 7 1*3-25-12 at Radford 47 1 8 0 1 0 0 0 0 0 0 0 3 0 1 17 40 19 0 . 2 6 5Mar 28 at Wofford 37 3 11 3 1 0 0 1 0 0 1 0 0 0 0 9 24 14 3 . 2 6 7

*Mar 30 at Presbyterian College 33 0 9 0 1 0 0 0 0 0 1 1 0 0 0 7 24 9 0 . 2 6 7*Mar 31 at Presbyterian College 36 5 11 5 2 0 0 2 0 3 0 0 2 0 0 6 27 8 2 . 2 6 8*Apr 01 at Presbyterian College 29 2 6 2 1 0 0 4 0 0 0 2 2 0 0 3 24 8 1 . 2 6 7Apr 03 at Furman 34 5 9 5 0 0 1 6 0 0 0 0 1 0 0 5 27 11 1 . 2 6 7

*Apr 06 CHARLESTON SOUTH 34 1 8 0 0 0 0 0 0 2 0 0 1 0 1 6 27 17 1 . 2 6 6*Apr 07 CHARLESTON SOUTH 35 2 6 2 2 0 0 3 0 0 1 1 0 0 1 5 30 11 2 . 2 6 2*Apr 07 CHARLESTON SOUTH 39 11 15 11 2 0 2 7 0 1 0 0 0 0 0 5 27 6 1 . 2 6 7Apr 10 ETSU 32 7 11 5 1 0 1 4 0 1 1 0 0 2 0 6 27 11 0 . 2 6 9Apr 11 at North Carolina 35 5 7 5 1 1 0 5 0 1 0 1 0 0 0 13 24 8 1 . 2 6 7

*Apr 13 at Campbell 33 3 6 3 2 1 0 2 0 0 0 0 0 0 0 6 24 6 0 . 2 6 5*Apr 14 at Campbell 31 3 5 3 0 0 0 5 0 1 0 0 1 0 0 4 27 13 0 . 2 6 2*Apr 14 at Campbell 38 6 12 5 2 0 1 2 0 0 0 0 0 0 1 9 24 12 2 . 2 6 4*04-20-12 LIBERTY 47 7 14 5 1 1 0 7 1 2 2 0 2 0 1 10 39 19 2 . 2 6 5*04-21-12 LIBERTY 25 2 7 2 1 0 1 4 1 0 0 0 2 0 4 5 27 7 0 . 2 6 5*04-22-12 LIBERTY 35 6 10 6 0 0 2 4 0 0 0 0 1 0 1 2 27 10 3 . 2 6 6Apr 24 WOFFORD 39 4 10 4 2 0 1 3 0 0 0 0 0 0 0 5 27 10 1 . 2 6 5

*05-04-12 at High Point 30 5 6 3 0 0 1 4 0 0 1 2 1 0 0 6 27 13 1 . 2 6 4*May 05 at High Point 40 7 14 7 4 0 1 2 0 1 0 0 0 0 0 4 27 8 1 . 2 6 6*05-06-12 at High Point 37 11 16 11 3 0 1 4 0 3 0 0 3 2 0 8 27 11 1 . 2 7 0May 08 GEORGIA STATE 39 8 15 8 2 0 3 2 0 0 0 0 0 0 2 5 27 14 1 . 2 7 3May 11 at Coll. of Charleston 35 4 7 3 2 0 1 2 0 0 0 0 1 0 0 10 27 7 0 . 2 7 1May 12 at Coll. of Charleston 35 8 10 6 0 0 1 8 0 1 1 6 1 0 0 9 27 4 1 . 2 7 2May 13 at Coll. of Charleston 41 6 13 5 2 0 0 0 0 1 0 0 0 1 0 10 24 8 0 . 2 7 3May 15 NORTH CAROLINA 35 4 10 3 4 0 0 3 0 0 0 0 0 1 0 10 27 6 1 . 2 7 3

*May 17 GARDER-WEBB 32 1 7 1 1 0 0 2 0 1 0 5 0 0 2 8 27 14 4 . 2 7 2*May 18 GARDER-WEBB 36 7 14 5 1 0 0 7 0 1 1 0 0 0 1 8 27 17 0 . 2 7 4*May 19 GARDER-WEBB 34 3 11 3 2 0 0 3 0 1 1 0 0 0 1 5 27 10 2 . 2 7 505-22-12 vs Liberty 33 2 7 2 2 0 0 2 0 0 0 1 0 0 0 6 24 8 1 . 2 7 405-23-12 at High Point 34 1 9 0 2 0 0 5 0 0 0 0 0 0 0 9 27 13 1 . 2 7 4Totals 1897 257 520 226 86 4 26 195 7 40 16 34 32 13 30 366 1450 563 80 . 2 7 4

Page 54: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

52 /// F E A R T H E D O G ///

2012 UNC ASHEVILLE STATISTICSy ( )

Pitching (All games)

Date Opponent ip h r er bb so 2b 3b hr wp bk hbp dp ibb score w-l sv eraFeb 17 at NC Central 9.0 7 3 3 5 8 0 0 0 0 0 2 0 0 13-3 1-0 0 3.00Feb 18 at NC Central 7.0 5 3 3 1 4 3 0 1 2 0 3 2 0 9-3 2-0 0 3.38Feb 18 at NC Central 9.0 7 2 2 1 6 2 0 0 0 0 0 1 0 10-2 3-0 0 2.88Feb 21 at UNCG 8.0 13 13 1 1 5 6 3 0 2 1 0 1 1 0 5-13 3-1 0 5.18Feb 25 SAINT PETER'S 7.0 3 0 0 1 10 1 0 0 0 0 2 1 0 3-0 4-1 0 4.28Feb 25 SAINT PETER'S 7.0 5 3 0 2 6 0 0 0 1 0 1 0 0 1-3 4-2 0 3.64Feb 26 SAINT PETER'S 7.0 4 3 2 4 4 0 0 0 0 0 1 1 0 7-3 5-2 1 3.50Feb 26 SAINT PETER'S 7.0 6 3 2 0 4 0 1 0 0 0 1 0 0 4-3 6-2 2 3.39Feb 28 at Wake Forest 8.0 8 9 9 6 5 3 0 1 4 1 0 0 0 8-9 6-3 2 4.17Mar 02 vs NC State 9.0 15 10 1 0 4 4 3 1 0 1 0 0 1 0 1-10 6-4 2 4.85Mar 02 at UNCW 8.0 10 8 2 1 4 3 0 2 0 0 1 1 0 1-8 6-5 2 4.60Mar 04 at UNCW 9.0 5 2 1 4 9 3 0 0 0 0 0 0 0 7-2 7-5 2 4.26Mar 06 FURMAN 9.0 12 6 6 3 5 1 2 0 0 0 0 1 0 1-6 7-6 2 4.41Mar 07 at South Carolina 8.0 11 8 8 6 3 2 0 0 0 0 2 1 0 1-8 7-7 2 4.74Mar 09 MOREHEAD STATE 9.0 8 4 4 3 10 0 1 1 0 0 0 1 0 3-4 7-8 2 4.69Mar 10 MOREHEAD STATE 9.0 10 7 4 0 5 0 1 0 0 1 2 0 0 5-7 7-9 2 4.64Mar 11 MOREHEAD STATE 9.0 4 0 0 1 9 0 0 0 0 0 1 0 0 13-0 8-9 2 4.34

*Mar 16 VMI 10.0 13 4 2 1 7 2 0 0 1 0 1 1 0 5-4 9-9 2 4.17*Mar 17 VMI 9.0 10 4 3 2 8 1 0 1 0 0 1 0 0 6-4 10-9 3 4.10*Mar 18 VMI 9.0 9 5 3 2 9 4 0 0 1 0 0 0 0 9-5 11-9 3 4.04Mar 20 at ETSU 8.0 8 3 2 3 1 0 0 0 1 0 0 1 0 1-3 11-10 3 3.96Mar 21 WESTERN CAROLINA 12.0 12 1 1 0 6 1 0 1 0 0 0 1 0 3-1 12-10 3 3.75

*3-23-12 at Radford 8.0 13 16 1 3 5 11 5 1 1 0 0 2 0 0 1-16 12-11 3 4.20*3-24-12 at Radford 8.0 11 9 7 2 6 3 0 1 1 0 2 0 0 0-9 12-12 3 4.34*3-25-12 at Radford 13.1 10 2 2 3 10 0 0 0 2 0 1 0 0 1-2 12-13 3 4.16Mar 28 at Wofford 8.0 3 4 3 5 5 0 0 0 0 1 0 0 0 3-4 12-14 3 4.13

*Mar 30 at Presbyterian College 8.0 10 5 5 2 6 1 0 0 1 0 1 0 0 0-5 12-15 3 4.18*Mar 31 at Presbyterian College 9.0 11 3 3 3 6 5 0 0 1 0 1 1 0 5-3 13-15 4 4.14*Apr 01 at Presbyterian College 8.0 10 6 4 3 4 4 0 1 0 0 2 0 0 2-6 13-16 4 4.15Apr 03 at Furman 9.0 7 4 4 7 8 1 0 1 1 1 0 0 0 5-4 14-16 5 4.15

*Apr 06 CHARLESTON SOUTH 9.0 8 6 3 1 2 2 0 1 0 0 0 1 0 1-6 14-17 5 4.11*Apr 07 CHARLESTON SOUTH 10.0 19 10 8 2 11 3 0 0 1 0 1 0 0 2-10 14-18 5 4.22*Apr 07 CHARLESTON SOUTH 9.0 13 6 5 3 4 4 1 1 0 0 1 1 0 11-6 15-18 5 4.24Apr 10 ETSU 9.0 8 3 3 4 6 1 0 1 0 1 0 2 0 7-3 16-18 6 4.21Apr 11 at North Carolina 8.0 8 10 7 4 1 1 0 1 0 1 1 0 0 5-10 16-19 6 4.30

*Apr 13 at Campbell 8.0 4 4 4 1 3 0 0 0 0 1 4 0 0 3-4 16-20 6 4.31*Apr 14 at Campbell 9.0 11 2 2 0 9 1 0 0 0 0 0 1 0 3-2 17-20 7 4.24*Apr 14 at Campbell 8.0 19 13 1 0 4 3 4 0 0 3 0 1 0 0 6-13 17-21 7 4.41*04-20-12 LIBERTY 13.0 12 6 5 8 10 2 0 0 1 0 2 2 0 7-6 18-21 7 4.38*04-21-12 LIBERTY 9.0 7 0 0 1 11 3 0 0 0 0 0 0 0 2-0 19-21 8 4.26*04-22-12 LIBERTY 9.0 13 16 .10 11 3 0 0 2 1 0 1 0 0 6-16 19-22 8 4.41Apr 24 WOFFORD 9.0 12 9 8 5 7 2 1 1 1 0 0 0 0 4-9 19-23 8 4.50

*05-04-12 at High Point 9.0 11 4 3 5 7 2 0 0 2 0 0 3 0 5-4 20-23 8 4.46*May 05 at High Point 9.0 4 1 1 0 6 0 0 1 1 0 1 1 0 7-1 21-23 8 4.38*05-06-12 at High Point 9.0 15 8 7 3 1 5 0 0 0 0 1 1 0 11-8 22-23 9 4.44May 08 GEORGIA STATE 9.0 17 13 8 4 4 3 2 0 3 0 2 2 0 8-13 22-24 9 4.52May 11 at Coll. of Charleston 9.0 4 2 1 2 11 1 0 0 0 0 3 0 0 4-2 23-24 10 4.44May 12 at Coll. of Charleston 9.0 6 4 3 4 11 1 1 1 0 0 1 1 0 8-4 24-24 10 4.41May 13 at Coll. of Charleston 8.0 12 11 1 1 7 8 3 0 3 1 1 0 0 0 6-11 24-25 10 4.56May 15 NORTH CAROLINA 9.0 17 10 9 5 5 5 0 1 1 0 1 1 0 4-10 24-26 10 4.65

*May 17 GARDER-WEBB 9.0 13 7 6 2 6 1 0 0 2 0 1 1 0 1-7 24-27 10 4.68*May 18 GARDER-WEBB 9.0 12 6 6 2 4 1 0 1 2 0 2 2 0 7-6 25-27 10 4.70*May 19 GARDER-WEBB 9.0 14 10 1 0 3 3 2 1 1 0 0 1 1 0 3-10 25-28 10 4.8105-22-12 vs Liberty 8.0 15 9 8 2 5 2 0 1 1 0 0 1 0 2-9 25-29 10 4.8805-23-12 at High Point 9.0 14 7 6 3 7 1 1 0 0 0 0 2 0 1-7 25-30 10 4.90Totals 483.1 548 327 263 171 337 101 14 29 38 8 52 38 0 257-327 25-30 10 4.90

Page 55: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

53/// F E A R T H E D O G ///

2012 UNC ASHEVILLE RESULTSDate Opponent Score Inns Overall Conference Pitcher of record Attend TimeFeb 17, 2012 at NC Central W 13-3 9 1-0-0 0-0-0 CONNOLLY, B. (W 1-0) 2 7 5 3:47Feb 18, 2012 at NC Central-1 W 9-3 7 2-0-0 0-0-0 ROLAND, D. (W 1-0) 1 2 9 2:08Feb 18, 2012 at NC Central-2 W 10-2 9 3-0-0 0-0-0 SPEAR, D. (W 1-0) 2 0 3 2:36Feb 21, 2012 at UNCG L 5-13 9 3-1-0 0-0-0 CRISS, E. (L 0-1) 2 4 3 3:14Feb 25, 2012 SAINT PETER'S-1 W 3-0 7 4-1-0 0-0-0 DULL, R. (W 2-0) 2 2 6 1:44Feb 25, 2012 SAINT PETER'S-2 L 1-3 7 4-2-0 0-0-0 SPEAR, D. (L 1-1) 2 2 6 2:00Feb 26, 2012 SAINT PETER'S-1 W 7-3 7 5-2-0 0-0-0 ROLAND, D. (W 2-0) 2 1 3 1:53Feb 26, 2012 SAINT PETER'S-2 W 4-3 7 6-2-0 0-0-0 CONNOLLY, B. (W 1-0) 1 8 7 1:40Feb 28, 2012 at Wake Forest L 8-9 9 6-3-0 0-0-0 TABAR, D. (L 0-1) 2 0 5 2:47Mar 02, 2012 vs NC State L 1-10 9 6-4-0 0-0-0 ROLAND, D. (L 2-1) 0 2:26Mar 02, 2012 at UNCW L 1-8 9 6-5-0 0-0-0 DULL, R. (L 2-1) 8 1 2 2:22Mar 04, 2012 at UNCW W 7-2 9 7-5-0 0-0-0 SPEAR, D. (W 2-1) 0 2:44Mar 06, 2012 FURMAN L 1-6 9 7-6-0 0-0-0 CONNOLLY, B. (L 1-1) 1 1 6 2:20Mar 07, 2012 at #2 South Carolina L 1-8 9 7-7-0 0-0-0 ROLAND, D. (L 2-2) 6 4 0 3 2:32Mar 09, 2012 MOREHEAD STATE L 3-4 9 7-8-0 0-0-0 DULL, R. (L 2-2) 0 2:35Mar 10, 2012 MOREHEAD STATE L 5-7 9 7-9-0 0-0-0 SPEAR, D. (L 2-2) 2 2 1 2:48Mar 11, 2012 MOREHEAD STATE W 13-0 9 8-9-0 0-0-0 ROLAND, D. (W 3-2) 2 0 6 2:30

* Mar 16, 2012 VMI W 5-4 (10) 9-9-0 1-0-0 CRISS, E. (W 1-1) 1 8 7 3:02* Mar 17, 2012 VMI W 6-4 9 10-9-0 2-0-0 CONNOLLY, B. (W 2-1) 1 9 1 2:17* Mar 18, 2012 VMI W 9-5 9 11-9-0 3-0-0 ROLAND, D. (W 4-2) 2 1 5 2:46

Mar 20, 2012 at ETSU L 1-3 9 11-10-0 3-0-0 SPRACKLIN, A (L 0-1) 2 1 2 2:49Mar 21, 2012 WESTERN CAROLINA W 3-1 (12) 12-10-0 3-0-0 HUNT, J. (W 1-0) 6 5 9 3:49

* 3-23-12 at Radford L 1-16 9 12-11-0 3-1-0 DULL, R. (L 2-3) 3 1 4 2:32* 3-24-12 at Radford-1 L 0-9 9 12-12-0 3-2-0 CONNOLLY, B. (L 2-2) 3 4 5 2:52* 3-25-12 at Radford L 1-2 (14) 12-13-0 3-3-0 STEIBLE, E. (L 0-1) 1 0 0 3:21

Mar 28, 2012 at Wofford L 3-4 9 12-14-0 3-3-0 CRISS, E. (L 1-2) 1 7 6 2:56* Mar 30, 2012 at Presbyterian College L 0-5 9 12-15-0 3-4-0 DULL, R. (L 3-3) 1 5 6 2:16* Mar 31, 2012 at Presbyterian College W 5-3 9 13-15-0 4-4-0 STEIBLE, E. (W 1-1) 1 8 8 2:46* Apr 01, 2012 at Presbyterian College L 2-6 9 13-16-0 4-5-0 CONNOLLY, B. (L 2-3) 2 2 4 2:30

Apr 03, 2012 at Furman W 5-4 9 14-16-0 4-5-0 SPRACKLIN, A (W 1-1) 2 7 1 3:21* Apr 06, 2012 CHARLESTON SOUTHERN L 1-6 9 14-17-0 4-6-0 ROLAND, D. (L 4-3) 2 4 8 2:02* Apr 07, 2012 CHARLESTON SOUTHERN-1 L 2-10 (10) 14-18-0 4-7-0 SPRACKLIN, A (L 1-2) 3 1 4 3:01* Apr 07, 2012 CHARLESTON SOUTHERN-2 W 11-6 9 15-18-0 5-7-0 CONNOLLY, B. (W 3-3) 3 1 4 2:40

Apr 10, 2012 ETSU W 7-3 9 16-18-0 5-7-0 DAVIS, K. (W 1-0) 1 2 5 2:39Apr 11, 2012 at #8 North Carolina L 5-10 9 16-19-0 5-7-0 SPRACKLIN, A (L 1-3) 1 0 8 2 2:56

* Apr 13, 2012 at Campbell L 3-4 9 16-20-0 5-8-0 ROLAND, D. (L 4-4) 3 1 9 1:58* Apr 14, 2012 at Campbell-1 W 3-2 9 17-20-0 6-8-0 DULL, R. (W 2-4) - 2:29* Apr 14, 2012 at Campbell-2 L 6-13 9 17-21-0 6-9-0 SPEAR, D. (L 2-3) 2 7 8 3:01* 04-20-12 LIBERTY W 7-6 (13) 18-21-0 7-9-0 CRISS, E. (W 2-2) 1 7 1 4:03* 04-21-12 LIBERTY W 2-0 9 19-21-0 8-9-0 DULL, R. (W 3-4) 1 9 2 2:10* 04-22-12 LIBERTY L 6-16 9 19-22-0 8-10-0 SPRACKLIN, A (L 1-4) 1 7 8 2:57

Apr 24, 2012 WOFFORD L 4-9 9 19-23-0 8-10-0 CRISS, E. (L 2-3) 1 4 6 3:12* 05-04-12 at High Point W 5-4 9 20-23-0 9-10-0 TABAR, D. (W 1-1) 4 8 1 2:46* May 05, 2012 at High Point W 7-1 9 21-23-0 10-10-0 DULL, R. (W 4-4) 4 4 2 2:26* 05-06-12 at High Point W 11-8 9 22-23-0 11-10-0 CONNOLLY, B. (W 5-3) 4 2 2 3:07

May 08, 2012 GEORGIA STATE L 8-13 9 22-24-0 11-10-0 SPEAR, D. (L 2-4) 1 2 5 2:53May 11, 2012 at Coll. of Charleston W 4-2 9 23-24-0 11-10-0 ROLAND, D. (W 5-4) 5 0 3 2:40May 12, 2012 at Coll. of Charleston W 8-4 9 24-24-0 11-10-0 DULL, R. (W 5-4) 4 3 7 3:00May 13, 2012 at Coll. of Charleston L 6-11 9 24-25-0 11-10-0 CONNOLLY, B. (L 5-4) 2 4 9 2:00May 15, 2012 #6 NORTH CAROLINA L 4-10 9 24-26-0 11-10-0 DAVIS, K. (L 1-1) 2 8 4 7 3:20

* May 17, 2012 GARDER-WEBB L 1-7 9 24-27-0 11-11-0 ROLAND, D. (L 5-5) 1 4 9 2:48* May 18, 2012 GARDER-WEBB W 7-6 9 25-27-0 12-11-0 SPRACKLIN, A (W 2-4) 2 4 5 3:10* May 19, 2012 GARDER-WEBB L 3-10 9 25-28-0 12-12-0 CONNOLLY, B. (L 5-5) 3 2 7 2:34

05-22-12 vs Liberty L 2-9 9 25-29-0 12-12-0 ROLAND, D. (L 5-6) 4 1 5 2:3705-23-12 at High Point L 1-7 9 25-30-0 12-12-0 DULL, R. (L 5-5) 4 8 7 2:50

* = Conference game() extra inning game

Page 56: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

54 /// F E A R T H E D O G ///

2012 UNC ASHEVILLE STATISTICSScore by innings 1 2 3 4 5 6 7 8 9 EX TotalUNC Asheville 15 33 28 43 30 39 17 23 21 8 257Opponents 50 19 47 32 49 24 30 43 20 13 327

Record when ...Overall 25-30

Conference 12-12Non-Conference 13-18

Home games 13-12Away games 12-16Neutral site 0-2Day games 21-26

Night games 4-4vs Left starter 3-7

vs Right starter 22-231-Run games 7-52-Run games 5-3

5+Run games 7-21Extra innings 3-2

Shutouts 3-2

Scoring 0-2 runs 1-16....... 3-5 runs 9-9....... 6-9 runs 10-5

....... 10+ runs 5-0

Opponent 0-2 runs 9-1........ 3-5 runs 12-6........ 6-9 runs 4-12

........ 10+ runs 0-11

Scored in 1st inning 6-3Opp. scored in 1st 7-14

Scores first 12-6Opp. scores first 13-24

After 6 leading 20-0....... trailing 3-26

....... tied 2-4After 7 leading 17-0

....... trailing 2-26....... tied 2-3

After 8 leading 18-0....... trailing 1-26

....... tied 2-3

Hit 0 home runs 9-26... 1 home run 14-2

... 2+ home runs 2-2

Opponent 0 home runs 16-15........ 1 home run 9-11

........ 2+ HRs 0-4

Made 0 errors 7-7.... 1 error 9-11

.... 2+ errors 9-12

Opp. made 0 errors 3-15......... 1 error 10-8

......... 2+ errors 12-7

Out-hit opponent 19-6Out-hit by opponent 4-22

Hits are tied 2-2

Record when team scores:Runs 0 1 2 3 4 5 6 7 8 9 10+W-L 0-2 0-11 1-3 3-4 2-2 4-3 1-3 6-0 1-2 2-0 5-0

Record when opponent scores:Runs 0 1 2 3 4 5 6 7 8 9 10+W-L 3-0 2-0 4-1 6-2 5-3 1-1 3-3 0-3 1-2 0-4 0-11

Record when leading after:Inn. 1 2 3 4 5 6 7 8W-L 5-1 9-3 13-2 14-4 18-2 20-0 17-0 18-0

Record when trailing after:Inn. 1 2 3 4 5 6 7 8W-L 6-14 5-18 5-23 4-21 4-24 3-26 2-26 1-26

Record when tied after:Inn. 1 2 3 4 5 6 7 8W-L 14-15 11-9 7-5 7-5 3-4 2-4 2-3 2-3

Current losing streak: 3Longest winning streak: 4Longest losing streak: 5

Home attendance : 8028 ( 25 dates avg = 321 )Away attendance : 15371 ( 29 dates avg = 530 )Total attendance: 23399 ( 54 dates avg = 433 )

Page 57: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

55/// F E A R T H E D O G ///

2012 UNC ASHEVILLE STATISTICSMultiple Hit Games 2 3 4 5+ Total14 LURIE, Jordan 14 4 - - 1816 KOONTZ, Patrick 14 2 - - 1630 CREIGHTON, Billy 14 2 - - 16 7 BRYANT, Hunter 11 4 - - 15 4 BUCH, Cody 12 2 - - 14 6 BESS, Thomas 10 2 1 - 1332 JOYNER, Todd 9 2 1 - 12 8 GRAHAM, Ian 8 3 - - 11 2 MILLER, Eli 8 - 2 - 1013 WESTON, Kyle 4 - - - 4 3 ADKINS, Cody 3 1 - - 434 WRIGHT, Aaron 3 1 - - 433 GAJDOSZ, Grant 2 - 1 - 325 EBERSOLE, Casey 1 - - - 1TEAM 113 23 5 0 141

Multiple RBI Games 2 3 4 5+ Total16 KOONTZ, Patrick 4 2 - - 630 CREIGHTON, Billy 3 1 1 1 632 JOYNER, Todd 5 1 - - 6 6 BESS, Thomas 4 1 - - 5 7 BRYANT, Hunter 4 1 - - 5 3 ADKINS, Cody 4 - - - 4 4 BUCH, Cody 4 - - - 4 8 GRAHAM, Ian 2 1 - 1 414 LURIE, Jordan 1 1 - - 2 2 MILLER, Eli 1 1 - - 234 WRIGHT, Aaron 1 1 - - 233 GAJDOSZ, Grant 1 - - - 125 EBERSOLE, Casey 1 - - - 115 TURNER, Sam 1 - - - 1TEAM 36 10 1 2 49

Hitting Streaks Longest Current 6 BESS, Thomas 9 1 4 BUCH, Cody 9 314 LURIE, Jordan 9 1 2 MILLER, Eli 7 - 8 GRAHAM, Ian 7 230 CREIGHTON, Billy 6 - 7 BRYANT, Hunter 6 234 WRIGHT, Aaron 5 116 KOONTZ, Patrick 5 -32 JOYNER, Todd 4 -36 KIRKLAND, Andrew 4 2 3 ADKINS, Cody 4 125 EBERSOLE, Casey 3 113 WESTON, Kyle 2 133 GAJDOSZ, Grant 2 -15 TURNER, Sam 1 -

Reached Base Streaks Longest Current 6 BESS, Thomas 19 114 LURIE, Jordan 18 1 4 BUCH, Cody 14 330 CREIGHTON, Billy 14 4 8 GRAHAM, Ian 13 2 7 BRYANT, Hunter 11 216 KOONTZ, Patrick 10 - 3 ADKINS, Cody 9 134 WRIGHT, Aaron 8 136 KIRKLAND, Andrew 8 2 2 MILLER, Eli 7 -25 EBERSOLE, Casey 5 133 GAJDOSZ, Grant 4 -32 JOYNER, Todd 4 -13 WESTON, Kyle 3 115 TURNER, Sam 2 -

Page 58: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

56 /// F E A R T H E D O G ///

2012 UNC ASHEVILLE BATTING STATISTICSBatting avg

1. 34 WRIGHT, Aaron . 3 4 02. 4 BUCH, Cody . 3 0 73. 30 CREIGHTON, Billy . 3 0 64. 7 BRYANT, Hunter . 3 0 35. 6 BESS, Thomas . 2 9 9

Runs scored1. 14 LURIE, Jordan 2 92. 16 KOONTZ, Patrick 2 83. 4 BUCH, Cody 2 54. 2 MILLER, Eli 2 45. 30 CREIGHTON, Billy 2 2

Doubles1. 30 CREIGHTON, Billy 1 0

7 BRYANT, Hunter 1 032 JOYNER, Todd 1 014 LURIE, Jordan 1 0

5. 8 GRAHAM, Ian 9

Total bases1. 16 KOONTZ, Patrick 8 42. 30 CREIGHTON, Billy 7 73. 4 BUCH, Cody 7 44. 14 LURIE, Jordan 6 75. 7 BRYANT, Hunter 6 0

Sac bunts1. 6 BESS, Thomas 1 12. 14 LURIE, Jordan 73. 2 MILLER, Eli 44. 16 KOONTZ, Patrick 35. 7 tied at........ 1

Caught stealing1. 14 LURIE, Jordan 42. 6 BESS, Thomas 3

4 BUCH, Cody 34. 2 MILLER, Eli 25. 4 tied at......... 1

Strikeouts1. 6 BESS, Thomas 3 72. 7 BRYANT, Hunter 3 6

4 BUCH, Cody 3 64. 16 KOONTZ, Patrick 3 05. 2 tied at..... 2 6

At bats1. 14 LURIE, Jordan 1 9 42. 4 BUCH, Cody 1 7 63. 32 JOYNER, Todd 1 6 64. 7 BRYANT, Hunter 1 6 55. 2 MILLER, Eli 1 6 3

Games as sub1. 36 KIRKLAND, Andrew 3 12. 34 WRIGHT, Aaron 2 13. 33 GAJDOSZ, Grant 1 44. 3 ADKINS, Cody 1 35. 13 WESTON, Kyle 1 2

Slugging pct1. 34 WRIGHT, Aaron . 5 2 82. 16 KOONTZ, Patrick . 5 2 23. 30 CREIGHTON, Billy . 4 8 14. 4 BUCH, Cody . 4 2 05. 7 BRYANT, Hunter . 3 6 4

Hits1. 14 LURIE, Jordan 5 72. 4 BUCH, Cody 5 43. 7 BRYANT, Hunter 5 04. 30 CREIGHTON, Billy 4 95. 16 KOONTZ, Patrick 4 8

Triples1. 16 KOONTZ, Patrick 22. 8 GRAHAM, Ian 1

6 BESS, Thomas 1

Walks1. 14 LURIE, Jordan 2 62. 8 GRAHAM, Ian 2 33. 30 CREIGHTON, Billy 2 24. 7 BRYANT, Hunter 1 5

4 BUCH, Cody 1 5

Sac flies1. 32 JOYNER, Todd 2

2 MILLER, Eli 230 CREIGHTON, Billy 2 4 BUCH, Cody 2

5. 5 tied at........ 1

Steal attempts1. 14 LURIE, Jordan 1 72. 6 BESS, Thomas 1 33. 2 MILLER, Eli 74. 16 KOONTZ, Patrick 65. 2 tied at.... 3

Grounded into DP1. 30 CREIGHTON, Billy 6

4 BUCH, Cody 63. 32 JOYNER, Todd 3

15 TURNER, Sam 35. 3 tied at..... 2

Games played1. 4 BUCH, Cody 5 42. 16 KOONTZ, Patrick 5 13. 6 BESS, Thomas 5 04. 3 tied at..... 4 9

On base pct1. 34 WRIGHT, Aaron . 3 9 72. 14 LURIE, Jordan . 3 9 23. 8 GRAHAM, Ian . 3 9 14. 30 CREIGHTON, Billy . 3 8 95. 6 BESS, Thomas . 3 7 2

Runs batted in1. 30 CREIGHTON, Billy 3 22. 16 KOONTZ, Patrick 2 83. 8 GRAHAM, Ian 2 24. 7 BRYANT, Hunter 1 95. 2 tied at...... 1 8

Home runs1. 16 KOONTZ, Patrick 82. 30 CREIGHTON, Billy 63. 4 BUCH, Cody 44. 34 WRIGHT, Aaron 35. 2 tied at...... 2

Hit by pitch1. 14 LURIE, Jordan 6

8 GRAHAM, Ian 63. 16 KOONTZ, Patrick 5

3 ADKINS, Cody 55. 6 BESS, Thomas 4

Stolen bases1. 14 LURIE, Jordan 1 32. 6 BESS, Thomas 1 03. 16 KOONTZ, Patrick 5

2 MILLER, Eli 55. 2 tied at...... 2

Stolen base pct1. 32 JOYNER, Todd 1.000

7 BRYANT, Hunter 1.00033 GAJDOSZ, Grant 1.000

4. 16 KOONTZ, Patrick . 8 3 35. 6 BESS, Thomas . 7 6 9

Total plate appearances1. 14 LURIE, Jordan 2 3 42. 4 BUCH, Cody 1 9 33. 8 GRAHAM, Ian 1 8 5

30 CREIGHTON, Billy 1 8 55. 6 BESS, Thomas 1 8 3

Game starts1. 14 LURIE, Jordan 4 9

4 BUCH, Cody 4 93. 16 KOONTZ, Patrick 4 54. 7 BRYANT, Hunter 4 4

8 GRAHAM, Ian 4 4

Page 59: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

57/// F E A R T H E D O G ///

2012 UNC ASHEVILLE PITCHING STATISTICSEarned run avg

1. 50 TABAR, Dillon 1 . 7 22. 47 JOURA, Evan 2 . 7 73. 11 DULL, Ryan 3 . 5 54. 19 ROLAND, Dean 3 . 9 25. 29 CONNOLLY, Brian 4 . 6 2

Wins1. 11 DULL, Ryan 5

29 CONNOLLY, Brian 519 ROLAND, Dean 5

4. 3 tied at....... 2

Innings pitched1. 19 ROLAND, Dean 9 6 . 12. 11 DULL, Ryan 8 3 . 23. 29 CONNOLLY, Brian 6 0 . 14. 31 SPEAR, Drew 4 5 . 15. 50 TABAR, Dillon 3 6 . 2

Games started1. 19 ROLAND, Dean 1 52. 11 DULL, Ryan 1 43. 31 SPEAR, Drew 1 04. 29 CONNOLLY, Brian 85. 2 tied at....... 3

Wild pitches1. 19 ROLAND, Dean 1 02. 23 CRISS, Elliot 73. 40 DAVIS, Klint 54. 3 tied at.... 3

Intentional BB allowed

Sac bunts allowed1. 19 ROLAND, Dean 7

31 SPEAR, Drew 728 SPRACKLIN, Adam 7

4. 11 DULL, Ryan 65. 23 CRISS, Elliot 5

Runs allowed1. 44 HUNT, Justin 62. 47 JOURA, Evan 93. 50 TABAR, Dillon 1 04. 27 KRUGH, Taylor 1 5

26 STEIBLE, Ethan 1 5

Doubles allowed1. 47 JOURA, Evan 22. 50 TABAR, Dillon 33. 28 SPRACKLIN, Adam 4

27 KRUGH, Taylor 45. 44 HUNT, Justin 5

Opposing bat avg1. 50 TABAR, Dillon . 2 5 02. 19 ROLAND, Dean . 2 5 73. 27 KRUGH, Taylor . 2 7 44. 11 DULL, Ryan . 2 8 05. 29 CONNOLLY, Brian . 2 8 1

Losses1. 19 ROLAND, Dean 62. 29 CONNOLLY, Brian 5

11 DULL, Ryan 54. 28 SPRACKLIN, Adam 4

31 SPEAR, Drew 4

Batters struck out1. 11 DULL, Ryan 8 42. 19 ROLAND, Dean 6 13. 31 SPEAR, Drew 3 14. 29 CONNOLLY, Brian 2 85. 23 CRISS, Elliot 2 5

Games finished1. 23 CRISS, Elliot 92. 26 STEIBLE, Ethan 8

50 TABAR, Dillon 84. 44 HUNT, Justin 55. 4 tied at....... 3

Balks1. 29 CONNOLLY, Brian 2

26 STEIBLE, Ethan 230 CREIGHTON, Billy 2

4. 28 SPRACKLIN, Adam 119 ROLAND, Dean 1

Runners picked off1. 19 ROLAND, Dean 72. 11 DULL, Ryan 33. 8 GRAHAM, Ian 24. 3 tied at....... 1

Sac flies allowed1. 29 CONNOLLY, Brian 52. 28 SPRACKLIN, Adam 3

19 ROLAND, Dean 331 SPEAR, Drew 3

5. 2 tied at..... 2

Earned runs allowed1. 47 JOURA, Evan 42. 44 HUNT, Justin 63. 50 TABAR, Dillon 74. 26 STEIBLE, Ethan 1 35. 40 DAVIS, Klint 1 4

Triples allowed1. 23 CRISS, Elliot 0

50 TABAR, Dillon 028 SPRACKLIN, Adam 027 KRUGH, Taylor 040 DAVIS, Klint 0

Won-loss pct1. 44 HUNT, Justin 1.0002. 29 CONNOLLY, Brian . 5 0 0

11 DULL, Ryan . 5 0 050 TABAR, Dillon . 5 0 040 DAVIS, Klint . 5 0 0

Saves1. 26 STEIBLE, Ethan 42. 23 CRISS, Elliot 2

29 CONNOLLY, Brian 24. 50 TABAR, Dillon 1

31 SPEAR, Drew 1

Appearances1. 50 TABAR, Dillon 2 22. 26 STEIBLE, Ethan 2 13. 28 SPRACKLIN, Adam 2 0

23 CRISS, Elliot 2 05. 29 CONNOLLY, Brian 1 8

Games in relief1. 50 TABAR, Dillon 2 22. 26 STEIBLE, Ethan 2 13. 28 SPRACKLIN, Adam 1 7

23 CRISS, Elliot 1 75. 27 KRUGH, Taylor 1 5

Hit batters1. 19 ROLAND, Dean 1 62. 11 DULL, Ryan 93. 23 CRISS, Elliot 4

31 SPEAR, Drew 45. 4 tied at......... 3

Batters SO out looking1. 11 DULL, Ryan 2 62. 19 ROLAND, Dean 1 43. 29 CONNOLLY, Brian 94. 26 STEIBLE, Ethan 8

28 SPRACKLIN, Adam 8

Hits allowed1. 44 HUNT, Justin 1 32. 47 JOURA, Evan 1 53. 27 KRUGH, Taylor 1 74. 40 DAVIS, Klint 1 95. 26 STEIBLE, Ethan 2 7

Walks allowed1. 47 JOURA, Evan 4

44 HUNT, Justin 43. 29 CONNOLLY, Brian 74. 26 STEIBLE, Ethan 85. 50 TABAR, Dillon 1 0

Home runs allowed1. 47 JOURA, Evan 0

40 DAVIS, Klint 027 KRUGH, Taylor 0

4. 50 TABAR, Dillon 144 HUNT, Justin 1

Page 60: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

58 /// F E A R T H E D O G ///

GameMost Runs: 24 vs. Augusta (1989)Most at Bats: 61 vs. Winthrop (2000)Most Hits: 28 vs. Campbell (1990)Longest Game (Inns): 18 vs. Winthrop (2000) Most Doubles: 12, vs. Campbell (1990)Most Triples: 4, vs. Limestone (1989)Most Home Runs: 7 vs. Augusta (1989) Most RBI: 20 vs. Augusta (1989)

SeasonMost Games: 63 (2006)Most Victories: 28 (2006)Most At Bats: 2228 (2006)Most Runs: 419 (1998)Most Hits: 654 (2006)Most Doubles: 129 (1998)Most Triples: 16 (1999 and 2007)Most Home Runs: 62 (1998)Most Stolen Bases: 100 (2004)Most Walks: 223 (2008)Highest Batting Avg.: .322 (1998)Longest Win Streak: 10 games (1990)Most Shutouts: 5 (1990)Most Complete Games: 15 (1991)Most Saves: 13 (2000)Lowest ERA: 4.61 (2000)

At Bats: Game: 9, Jason Ronai vs. Winthrop (2000) Season: 256, Elliott Arrington (2006) Career: 917, Elliott Arrington (2005-08)

Runs: Game: 6, Matt Swaim vs. Western Carolina (1992) Season: 67, Ty Wigginton (1998) Career: 192, Kevin Mattison (2005-08) Hits: Game: 6, Eddie Woods, vs. Samford (1998) Season: 97, Rob Vernon (2007) Career: 296, Elliott Arrington (2005-08)

Doubles: Game: 3, many, last Mike Vaughn (2010) Season: 26, Ty Wigginton (1998) Career: 65, Elliott Arrington (2005-08)

Triples: Game: 2, Brian Lancaster, vs. Limestone (1989) 2, Kevin Mattison, vs. VMI, 4/22/06 2, Kevin Mattison, vs. New Orleans, 3/2/07 2, Rob Vernon, vs. Charleston Sou., 4/7/07 Season: 8, Kevin Mattison (2006 and 2007) Career: 23, Kevin Mattison (2005-08)

Home Runs: Game: 3, Keith DiYeso vs. App. State (1993) 3, Ty Wigginton vs. ETSU (1998) Season: 19, Brian Shehan (1989) Career: 42, Brian Shehan (1987-90)

RBI: Game: 9, Brian Shehan vs. Campbell (1989) Season: 59, Brian Shehan (1989) Career: 169, Elliott Arrington (2005-08)

Total Bases: Game: 14, Ty Wigginton vs. ETSU (1998) Season: 153, Rob Vernon (2007) Career: 423, Kevin Mattison (2005-08) Average: Season: .394, Rob Vernon (2007) Career: .367, Rob Vernon (2006-07)

Stolen Bases: Game: 5, Brian Kelly vs. Duquense (1993) Season: 33, Brian Kelly (1992) Career: 57, Kevin Hawkins (1986-90)

Hit by Pitch: Season: 17, Brett Muhlhan (2000) Career: 28, Brett Muhlhan (1999-2001)

Longest Hitting Streak: 31, Kevin Weidenbacher (2008)

Victories: Season: 11, Marc Rosenbalm (1991) Career: 24, Aaron Rembert (2000-04)

Appearances: Season: 31, Jason Walker (2001) Career: 90, Jason Walker (1999-2002) Complete Gms: Season: 11, Marc Rosenbalm (1991) Career: 13, Marc Rosenbalm (1987-91) 13, Billy Hillier (1995, 1997-98)

Innings: Game: 14.2, Billy Hillier vs. Liberty (1995) Season: 117.2, Marc Rosenbalm (1991) Career: 365.2, Alan DeRatt (2005-08)

Strikeouts: Game: 13, Fred Rask vs. Wofford (1997) Season: 101, Josh White (1998) Career: 247, Alan DeRatt (2005-08) ERA: Season: 1.37, Seth Denton (2003) Career: 3.21, Marc Rosenbalm (1987-91)

Saves: Season: 8, Seth Denton (2003) Justin Schumer (2008) Career: 15, Ben Buchanan (2005-08)

Shutouts: Season: 3, Marc Rosenbalm (1991) Career: 4, Marc Rosenbalm (1987-91)

No Hitter: Jason Walker (7 inn.) vs. April 29, 2000 vs. Liberty (3-0)

TEAM RECORDS INDIVIDUAL PITCHING RECORDS

INDIVIDUAL HITTING RECORDS

Page 61: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

59/// F E A R T H E D O G ///

BATTING RECORDS (CAREER)At bats 1. 917 Elliott Arrington (2005-08)2. 861 Kevin Mattison (2005-08)3. 798 Danny Baatz (2008-11)4. 744 Catlin Carter (2008-11)5. 734 Steve Burnich (2003-07)6. 728 Stephen Deyo (1997-2000)7. 727 Jason Ronai (1998-2001)8. 672 Justin Schumer (2007-10)9. 634 Todd Bess (1990-93)10. 632 Eddie Woods (1997-1999)

Runs1. 192 Kevin Mattison (2005-08)2. 180 Kevin Hawkins (1986-90)3. 148 Elliott Arrington (2005-08)4. 144 Matt Swaim (1991-94)5. 141 Todd Bess (1990-93)6. 133 Jason Ronai (1998-2001)7. 128 Ty Wigginton (1996-98)8. 126 Brian Shehan (1987-90)9. 125 Steve Burnich (2003-07)10. 124 Jeff Fox (1988-91)

Average1. .367 Rob Vernon (2006-07)2. .364 Chad Faircloth (1996-97)3. .341 Kevin Hawkins (1986-90) .341 Brian Shehan (1987-90)5. .339 Eddie Woods (1997-1999)6. .336 Robert McIntosh (2010-Present)7. .331 Matt Swaim (1991-94) .331 Steve Sherman (2003-04)9. .330 Justin Schumer (2007-10)10. .327 David Williams (2004-07)

Hits1. 296 Elliott Arrington (2005-08)2. 250 Kevin Mattison (2005-08)3. 231 Kevin Hawkins (1986-90)4. 222 Justin Schumer (2007-20)5. 214 Eddie Woods (1997-1999)6. 211 Brian Shehan (1987-90)7. 206 Matt Swaim (1991-94) 206 Stephen Deyo (1997-2000)9. 204 Jason Ronai (1998-2001)10. 202 Erik Filipek (1993-96)

Doubles1. 65 Elliott Arrington (2005-08)2. 56 Brian Shehan (1987-90)3. 50 Matt Swaim (1991-94) 50 Ty Wigginton (1996-98)5. 46 Kevin Mattison (2005-08)6. 43 Justin Schumer (2007-10)7. 37 Erik Filipek (1993-96) 37 Stephen Deyo (1997-2000) 37 Jason Ronai (1998-2001)10. 36 John Turner (1989-91)

Triples1. 23 Kevin Mattison (2005-08)2. 9 Jeff Fox (1988-91) 9 Todd Bess (1990-93)4. 8 Rob Vernon (2006-07)5. 7 Brian Lancaster (1989-90) 7 Kevin Hawkins (1986-90) 7 Ty Wigginton (1996-98) 7 Stephen Deyo (1997-2000)9. 6 Scott Pastushok (1996-97) 6 Eddie Woods (1997-1999) 6 Grant Rembert (2002-04)

Home runs1. 42 Brian Shehan (1987-90)2. 28 Billy Hillier (1995-98) 28 Curtis Moncus (2000-02)4. 27 Kevin Mattison (2005-08)5. 26 Todd Bess (1990-93)6. 25 Ty Wigginton (1996-98)7. 24 Eddie Woods (1997-1999) 24 Justin Schumer (2007-10)9. 21 Erik Filipek (1993-96)10. 19 Steve Sherman (2003-04)

RBI1. 169 Elliott Arrington (2005-08)2. 164 Brian Shehan (1987-90)3. 139 Todd Bess (1990-93)4. 135 Kevin Mattison (2005-08)5. 128 Justin Schumer (2007-10)6. 125 Billy Hillier (1995-98)7. 123 Eddie Woods (1997-1999)8. 120 Erik Filipek (1993-96)9. 106 Stephen Deyo (1997-2000)10. 102 Ty Wigginton (1996-98)

Total bases1. 423 Kevin Mattison (2005-08)2. 410 Elliott Arrington (2005-08)3. 397 Brian Shehan (1987-90)4. 341 Justin Schumer (2007-10)5. 331 Todd Bess (1990-93)6. 326 Eddie Woods (1997-1999)7. 308 Ty Wigginton (1996-98)8. 306 Kevin Hawkins (1986-90)9. 304 Erik Filipek (1993-96)10. 299 Stephen Deyo (1997-2000)

Slugging Pct1. .652 Brian Shehan (1987-90)2. .591 Rob Vernon (2006-07)3. .585 Chad Faircloth (1996-97)4. .564 Ty Wigginton (1996-98)5. .548 Curtis Moncus (2000-02)6. .547 Steve Sherman (2003-04)7. .539 Nick Jaksa (2001-04)8. .530 Billy Hillier (1995-98)9. .522 Todd Bess (1990-93)10. .516 Eddie Woods (1997-1999)

Walks1. 155 Kevin Hawkins (1986-90)2. 101 Todd Bess (1990-93)3. 97 Matt Swaim (1991-94)4. 95 Jeff Fox (1988-91) 95 Elliott Arrington (2005-08)6. 89 Kevin Mattison (2005-08)7. 85 Willie Stewart (1997-2000)8. 77 Jason Ronai (1998-2001)9. 75 Billy Hillier (1995-98)10. 74 Brian Shehan (1987-90) 74 Justin Schumer (2007-10)

Strikeouts 1. 187 Elliott Arrington (2005-08)2. 162 Kevin Mattison (2005-08)3. 135 Stephen Deyo (1997-2000)4. 133 Eddie Woods (1997-1999)5. 126 Danny Baatz (2008-11)6. 120 Steve Burnich (2003-07) 120 Justin Schumer (2007-10) 120 Cody Buch (2008-12)8. 119 Nick Jaksa (2001-04)9. 117 Brian Shehan (1987-90)10. 116 Ty Wigginton (1996-98)

Hit By Pitch1. 28 Brett Muhlhan (1999-2001)2. 26 Steve Burnich (2003-07)3. 20 Kevin Mattison (2005-08)4. 19 Beau Zinman (2008-11)5. 18 Billy Hillier (1995-98)6. 17 Rob Vernon (2006-07)7. 16 Reed Kreiser (2008-09) 16 Beau Zinman (2008-10)8. 15 Nick Jaksa (2001-04)9. 14 four players tied

Sacrifi ces1. 32 Steve Burnich (2003-07)2. 25 Matt Roberts (2002-04)3. 19 John Whited (2004-07)4. 17 Danny Baatz (2008-11) 17 Catlin Carter (2008-11) 17 Beau Zinman (2008-11)6. 15 Willie Stewart (1997-2000)7. 14 Kyle Smith (2006-07)8. 12 Brett Muhlhan (1999-2001)9. 13 Jason Ronai (1998-2001)10. 12 Jordan Lurie (2009-Present) Stolen Bases1. 57 Kevin Hawkins (1986-90)2. 54 Brian Kelly (1992-93) 3. 51 Kevin Mattison (2005-08)4. 45 Jason Ronai (1998-2001)5. 38 Steve Burnich (2003-07)6. 36 Jake McConiga (2002-03)7. 34 Matt Roberts (2002-04)8. 31 Wayne Faircloth (1990-92)9. 28 Steve Sherman (2003-04)10. 27 Todd Bess (1990-93) 27 Chad Faircloth (1996-97)

Page 62: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

60 /// F E A R T H E D O G ///

BATTING RECORDS (SEASON)At bats 1. 256 Elliott Arrington (2006)2. 255 Kevin Weidenbacher (2008)3. 246 Rob Vernon (2007)4. 241 Kevin Mattison (2008)5. 236 Elliott Arrington (2007)6. 233 Elliott Arrington (2008)7. 232 David Williams (2007)8. 230 Justin Schumer (2008)9. 229 Jason Ronai (2000)10. 228 Eddie Woods (1999)

Average (min 150 AB)1. .394 Rob Vernon (2007)2. .384 Chad Faircloth (1996)3. .376 Brian Shehan (1989)4. .374 Jamie Pietraszko (1998)5. .371 Wayne Faircloth (1992) .371 Erik Filipek (1994)7. .368 Eddie Woods (1998)8. .365 Grant Rembert (2002)9. .360 Kevin Hawkins (1990) .360 John Turner (1990) .360 Matt Swaim (1993) .360 Todd Bess (1991) .360 Steve Sherman (2004)

Runs 1. 67 Ty Wigginton (1998)2. 66 Kevin Mattison (2008)3. 56 Ryan Moffett (1999)4. 55 Kevin Hawkins (1986)5. 53 Billy Hillier (1998)6. 51 Rob Vernon (2007)7. 50 Kevin Hawkins (1989) 50 Kevin Hawkins (1990) 50 Brian Shehan (1989) 50 Kevin Mattison (2007)

Hits 1. 97 Rob Vernon (2007)2. 90 Elliott Arrington (2006)3. 86 Kevin Weidenbacher (2008)4. 81 Eddie Woods (1998)5. 78 Ryan Moffett (1999)6. 77 Eddie Woods (1999) 77 David Williams (2004)8. 75 Elliott Arrington (2008) 75 Justin Schumer (2008) 75 Jordan Lurie (2011)10. 73 Ty Wigginton (1998)

Doubles 1. 26 Ty Wigginton (1998)2. 23 Elliott Arrington (2006)3. 20 Wayne Faircloth (1992) 20 Ty Wigginton (1997) 20 Rob Vernon (2007)6. 19 Kevin Mattison (2008)7. 18 Brian Shehan (1990) 18 Erik Filipek (1994) 18 David Williams (2007)10. 17 Four players tied

Triples 1. 8 Kevin Mattison (2006) 8 Kevin Mattison (2007)3. 7 Ryan Moffett (1999)4. 6 Rob Vernon (2007)5. 5 Ty Wigginton (1997)6. 4 Jeff Fox (1988) 4 Ross Tomberlin (1988) 4 Grant Rembert (2003) 4 Kevin Mattison (2008)10. 3 12 Players tied

Home runs 1. 19 Brian Shehan (1989)2. 16 Ty Wigginton (1998) 16 Steve Sherman (2004)4. 14 Billy Hillier (1997)5. 13 Trevor Moore (1993) 13 Eddie Woods (1998)7. 12 Todd Bess (1991) 12 Ryan Moffett (1999) 12 Reed Kreiser (2008)10. 11 Josh White (1999) 11 Curtis Moncus (2000) 11 Kevin Mattison (2008)

RBI 1. 59 Brian Shehan (1989)2. 57 Rob Vernon (2007)3. 56 Eddie Woods (1998)4. 54 Billy Hillier (1998) 54 Elliott Arrington (2008)6. 53 Steve Sherman (2004)7. 51 Ty Wigginton (1998)8. 50 Brian Shehan (1990) 50 Justin Schumer (2008)10. 49 Trevor Moore (1993)

Total bases 1. 153 Rob Vernon (2007)2. 149 Ty Wigginton (1998)3. 145 Ryan Moffett (1999)4. 140 Brian Shehan (1989)5. 137 Eddie Woods (1998)6. 136 Elliott Arrington (2006)7. 130 Steve Sherman (2004)8. 129 Kevin Mattison (2008)9. 125 Kevin Mattison (2006)10. 120 Chad Faircloth (1996)

Slugging Pct 1. .787 Brian Shehan (1989)2. .706 John Smith (1987)3. .693 Todd Bess (1991)4. .687 Trevor Moore (1993) .687 Ty Wigginton (1998)6. .668 Ryan Moffett (1999)7. .650 Steve Sherman (2004)8. .649 Chad Faircloth (1996)9. .629 Brian Lancaster (1989)10. .627 Brian Shehan (1987)

Walks 1. 48 Kevin Hawkins (1989)2. 44 Kevin Hawkins (1990)3. 41 Jeff Fox (1988) 41 Ty Wigginton (1998) 41 Steve Sherman (2004)6. 39 Kevin Hawkins (1986)7. 38 Todd Johnson (1986)8. 37 Kevin Mattison (2008)9. 36 Greg Starbuck (1986) 36 Matt Swaim (1992)

Strikeouts 1. 54 Kevin Mattison (2007)2. 53 Elliott Arrington (2006)3. 52 Reed Kreiser (2009) 52 Patrick Koontz (2011)4. 50 Eddie Woods (1999) 50 Reed Kreiser (2008)6. 49 Chad Faircloth (1997) 49 Elliott Arrington (2007)7. 46 Kevin Mattison (2006)8. 45 Elliott Arrington (2008)9. 44 Ty Wigginton (1997) 44 Eddie Woods (1998)

Hit By Pitch 1. 17 Brett Muhlhan (2000)2. 13 Rob Vernon (2007)3. 12 Wayne Faircloth (1991)4. 10 Grant Rembert (2002) 10 Steve Burnich (2006) 10 Steve Burnich (2007)7. 9 Billy Hillier (1998) 9 Ryan Moffett (1999) 9 Bill Carley (2002) 9 Billy Hillier (1997)

Sacrifi ces 1. 16 Matt Roberts (2004)2. 15 Steve Burnich (2006)3. 11 Thomas Bess (2012)4. 10 John Whited (2007)5. 9 Steve Burnich (2004)6. 8 Willie Stewart (2000) 8 Matt Henson (2006) 8 Matt Henson (2007) 8 Six players tied

Stolen Bases 1. 33 Brian Kelly (1992)2. 21 Brian Kelly (1993) 21 Steve Sherman (2004)4. 20 Matt Roberts (2004) 20 Jake McConiga (2003)6. 18 Kevin Hawkins (1986) 18 Rob Vernon (2007)8. 17 Wayne Faircloth (1991) 17 Chad Faircloth (1997) 17 Jason Ronai (2000) 17 Steve Burnich (2004)

Page 63: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

61/// F E A R T H E D O G ///

PITCHING RECORDS (CAREER)Appearances1. 94 Ben Buchanan (2005-08)2. 90 Jason Walker (1999-2002)3. 82 Nick Brannon (1997-2001)4. 80 Steven Cook (2001-04)5. 79 Chris Nigro (2004-07)6. 75 Graham Baughn (2005-08)7. 73 Grier Harrington (2008-11)8. 70 Alan DeRatt (2005-08)9. 69 Judson Ballard (1999-2003) 10. 61 Aaron Rembert (2000-03)

Games Started1. 55 Alan DeRatt (2005-08)2. 51 Ryan Dull (2008-12)3. 49 Judson Ballard (1999-2002)4. 41 Michael Bogaert (2006-09)5. 40 Steven Cook (2001-04)6. 34 Fred Rask (1995-97)7. 34 Billy Hillier (1995-98) 34 Josh White (1997-99)9. 33 Mike Moore (1989-90)10. 31 Jamon Deal (1989-92) 31 Graham Baughn (2005-08)

ERA (min 100 IP)1. 3.16 Marc Rosenbalm (1987-91)2. 4.14 Jamon Deal (1989-92)3. 4.37 Jason Walker (1999-2002)4. 4.49 Aaron Rembert (2000-03)5. 4.50 Alan DeRatt (2005-08)6. 4.65 Ryan Dull (2009-12)7. 4.74 Brad Beck (2002-03)8. 4.76 Mark Schuurman (2001-02)9. 5.08 Judson Ballard (1999-2003)10. 5.17 Graham Baughn (2005-08)

Complete Games1. 14 Marc Rosenbalm (1987-91)2. 11 Billy Hillier (1995-98)3. 10 Mike Moore (1988-90) 10 Ryan Dull (2009-125. 9 Rob Masse (1993-94)6. 8 Steven Cook (2001-04)7. 7 Bo Thomas (1986-87) 7 Judson Ballard (1999-2003)9. 6 Jamon Deal (1989-92) 6 Brad Kastor (1989-93) 6 Fred Rask (1995-97) 6 Josh White (1997-99) 6 Ryan Dull (2009-10)

Shutouts1. 3 Marc Rosenbalm (1987-91)2. 2 Nick Brannon (1997-2002) 2 Alan DeRatt (2005-08) 2 Ryan Dull (2009-12)5. 1 13 players tied

Saves1. 15 Ben Buchanan (2005-08)2. 12 Justin Schumer (2007-10)3. 11 Jason Walker (1999-2002)4. 8 Phillip Millinax (1989-90) 8 Nick Brannon (1997-2001) 8 Seth Denton (2001-03)7. 6 Sonny Moss (1997-98)8. 5 Shon Norris (1997-98)9. 4 7 players tied

Innings Pitched1. 365.2 Alan DeRatt (2005-08)2. 341.1 Steven Cook (2001-04)3. 329.2 Judson Ballard (1999-03)4. 323.1 Ryan Dull (2009-12)5. 253.0 Ben Buchanan (2005-08)6. 245.1 Graham Baughn (2005-08)7. 244.1 Nick Brannon (1997-2001)8. 231.1 Chris Nigro (2004-07)9. 231.0 Fred Rask (1995-97)10. 214.2 Billy Hillier (1995-98)

Hits allowed (min 100 IP)1. 131 Todd Interdonato (1999-00)2. 132 Kenny Hall (1992-94)3. 134 Brad Beck (2002-03)4. 138 Brad Wilson (1995-96)5. 148 Bo Thomas (1986-87)6. 160 Jamon Deal (1989-92)7. 162 Mike Bailey (1998-90) 162 Sonny Moss (1997-98)9. 163 Mark Schuurman (2001-02)10. 164 Brad Kastor (1989-93)

Runs allowed (min 100 IP)1. 83 Brad Beck (2002-03)2. 85 Kenny Hall (1992-94) 3. 99 Marc Rosenbalm (1987-91)4. 102 Sonny Moss (1997-98)5. 104 Aaron Rembert (2000-03)6. 111 Rob Masse (1993-94)7. 116 Brad Kastor (1989-93)8. 117 Jason White (1999-2002)9. 119 Dustin Sode (1999-2003)10. 121 Bo Thomas (1986-87)

Earned Runs (min 100 IP)1. 63 Brad Beck (2002-03)2. 71 Kenny Hall (1992-94)3. 72 Marc Rosenbalm (1987-91)4. 73 Brad Watson (1995-96)5. 75 Mike Bailey (1988-90)6. 76 Mark Schuurman (2001-02)7. 80 Sonny Moss (1997-98)8. 84 Rob Masse (1993-94)9. 87 Aaron Rembert (2000-03)10. 90 Brad Kastor (1989-93)

Walks allowed 1. 178 Jamon Deal (1989-92)2. 155 Brian Shehan (1988-90)3. 131 Michael Bogaert (2006-09)4. 130 Nick Brannon (1997-2001)5. 122 Ben Buchanan (2005-08)6. 119 Ronnie Honeycutt (1989-90) 119 Josh White (1997-99)8. 109 Eddie Woods (1996-99) 109 Alan DeRatt (2005-08)10. 108 Mike Moore (1988-90)

Strikeouts1. 247 Alan DeRatt (2005-08)2. 238 Ryan Dull (2009-12)3. 231 Josh White (1997-99)4. 221 Steven Cook (2001-04)5. 218 Judson Ballard (1999-2003)6. 209 Nick Brannon (1997-2001)7. 188 Michael Bogaert (2006-09)8. 187 Ben Buchanan (2005-08)9. 171 Fred Rask (1995-97)10. 170 Jamon Deal (1989-92)

Hit batters1. 41 Graham Baughn (2005-08)2. 35 Michael Bogaert (2006-09)2. 33 Judson Ballard (1999-20033. 29 Nick Brannon (1997-2001) 29 Alan DeRatt (2005-08)6. 26 Ben Buchanan (2005-08) 26 Justin Schumer (2007-10)8. 25 Steven Cook (2001-04)9. 19 Aaron Rembert (2000-03)10. 18 Billy Hillier (1995-98)

Wins1. 24 Aaron Rembert (2000-04)2. 23 Steven Cook (2001-04)3. 22 Alan DeRatt (2005-08)4. 19 Marc Rosenbalm (1987-91)5. 16 Ryan Dull (2009-12)6. 15 Judson Jamon Deal (1989-92) 15 Judson Ballard (1999-2003) 15 Graham Baughn (2005-08)9. 14 Billy Hillier (1995-98)10. 13 Josh White (1997-99) 13 Ben Buchanan (2005-08)

Page 64: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

62 /// F E A R T H E D O G ///

PITCHING RECORDS (SEASON)Appearances1. 31 Jason Walker (2001)2. 27 Jason White (1999) 27 Ben Buchanan (2006) 27 Ben Buchanan (2007) 27 Chris Brookey (2008)6. 26 Aaron Rembert (2000)7. 25 Jason Bowman (1996) 25 Grant Rembert (2004)9. 24 Nick Brannon (1998)10. 24 Nick Brannon (2002) 24 Jason Walker (2002) 24 Steven Cook (2001) 24 Chris Nigro (2005) 24 Justin Schumer (2008)

Games Started1. 18 Eddie Woods (1999)2. 17 Nate Gardner (1997)3. 16 Steven Cook (2004) 16 Marc Rosenbalm (1991) 16 Chris Nigro (2006) 16 Alan DeRatt (2006)7. 15 Jamon Deal (1992) 15 Nick Brannon (2001) 15 Steven Cook (2003) 15 Graham Baughn (2007) 15 Alan DeRatt (2007) 15 Dean Roland (2012)

ERA (min 30 IP)1. 1.50 Marc Rosenbalm (1990)2. 1.72 Dillon Tabar (2012)3. 1.74 Alan DeRatt (2008)4. 2.69 Jamon Deal (1990)5. 2.70 Mike Bailey (1990)6. 2.84 David Williams (2004)7. 2.98 Marc Rosenbalm (1991)8. 3.09 Nick Brannon (2000)9. 3.13 Jason Walker (2002)10. 3.14 Jason Walker (2000) 3.14 Aaron Rembert (2000)

Complete Games1. 11 Marc Rosenbalm (1991)2. 7 Mike Moore (1988) 7 Rob Masse (1994)4. 6 Bo Thomas (1986) 6 Steven Cook (2004)6. 5 Brian Shehan (1988) 5 Brad Kastor (1993) 5 Billy Hillier (1995) 5 Josh White (1998)10. 4 Jamon Deal (1992) 4 Doug Baird (1991)

Shutouts1. 3 Marc Rosenbalm (1991)2. 1 19 players tied

Saves1. 8 Seth Denton (2003) 8 Justin Schumer (2008)3. 7 Ben Buchanan (2007) 7 Nick Brannon (2000)5. 6 Jason Walker (2001) 6 Ben Buchanan (2006)7. 5 Shon Norris (1998)8. 4 Phillip Mullinax (1989) 4 Phillip Mullinax (1990) 4 Sonny Moss (1998) 4 Jason Walker (2002) 4 Aaron Rembert (2000) 4 Ethan Steible (2012)

Innings Pitched1. 126.1 Steven Cook (2004)2. 115.0 Alan DeRatt (2006)3. 117.2 Marc Rosenbalm (1991)4. 105.1 Steven Cook (2003)5. 104.1 Graham Baughn (2007)6. 103.1 Chris Nigro (2006)7. 101.0 Alan DeRatt (2007)8. 98.2 Grant Rembert (2004)9. 98.0 Alan DeRatt (2008)10. 96.2 Jamon Deal (1992)

Hits allowed (min 30 IP)1. 21 Phillip Mullinax (1990)2. 28 Phillip Lowdermilk (1992)3. 29 John Smith (1987)4. 31 Kenny Hall (1993)5. 33 Jamon Deal (1989)6. 36 Marc Rosenbalm (1987)7. 37 Chris Walker (1993) 37 Dillon Tabar (2011)9. 38 Phillip Mullinax (1989)10. 39 Chris Brookey (2008)

Runs allowed (min 30 IP)1. 15 Phillip Mullinax (1990)2. 16 Marc Rosenbalm (1990)3. 18 Mike Bailey (1990)4. 18 Phillip Lowdermilk (1992)5. 20 Phillip Mullinax (1989)6. 20 Jason Walker (2000)7. 23 Chris Brookey (2008)8. 25 John Smith (1987) 25 Kenny Hall (1993) 25 Nelson Jenkins (1994) 25 Jason Walker (2002)

Earned Runs allowed (min 30 IP)1. 8 Marc Rosenbalm (1990)2. 13 Mike Bailey (1990)3. 15 Phillip Mullinax (1990) 15 Phillip Lowdermilk (1992)5. 16 Phillip Mullinax (1989) 16 Jason Walker (2002)7. 17 Kenny Hall (1993)8. 18 Chris Brookey (2008)9. 20 Four players tied

Walks allowed1. 72 Brian Shehan (1988)2. 67 Ronnie Honeycutt (1990)3. 62 Tim Johnson (2005)4. 52 Ronnie Honeycutt (1989)5. 50 Jamon Deal (1990) 50 Michael Bogaert (2008)7. 49 Brian Shehan (1990) 49 Eddie Woods (1999)9. 48 Josh White (1999) 48 Nick Brannon (1998)

Strikeouts1. 101 Josh White (1998)2. 93 Steven Cook (2004)3. 85 Fred Rask (1997)4. 84 Jamon Deal (1992) 84 Ryan Dull (2012)6. 78 Josh White (1999)7. 77 Nate Gardner (1997)8. 73 Marc Rosenbalm (1991)9. 72 Grant Rembert (2004)10. 71 David Williams (2004) 71 Alan DeRatt (2006)

Hit batters1. 16 Michael Bogaert (2006) 16 Dean Roland (2012)3. 14 Nick Brannon (2001)4. 13 Judson Ballard (2001) 13 Judson Ballard (2002) 13 Graham Baughn (2006)7. 12 Graham Baughn (2007)8. 11 David Williams (2004) 11 Ben Buchanan (2005) 11 Graham Baughn (2008)

Wins1. 11 Mark Rosenbalm (1991)2. 9 Aaron Rembert (2000) 9 Steven Cook (2003)4. 8 Steven Cook (2004) 8 David Williams (2004) 8 Grant Rembert (2004) 8 Alan DeRatt (2006) 8 Alan DeRatt (2008)9. 7 Jamon Deal (1992) 7 Josh White (1998) 7 Graham Baughn (2007)

Page 65: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

63/// F E A R T H E D O G ///

YEAR BY YEAR RECORDS (BATTING) Batting Average Home Runs RBI1985: David Hampton (.353) Lance Day & Todd Johnson (35)1986: David Hampton (.349) Greg Starbuck (8) Greg Starbuck (39)1987: John Smith (.353) John Smith (10) John Smith (25)1988: Brian Shehan (.344) Brian Shehan (6) Brian Shehan (36)1989: Brian Shehan (.376) Brian Shehan (19) Brian Shehan (59)1990: John Turner & Kevin Hawkins (.360) Brian Shehan (10) Brian Shehan (50)1991: Todd Bess (.360) Todd Bess (12) Todd Bess (41)1992: Wayne Faircloth (.371) Trevor Moore (9) Keith DiYeso (45)1993: Matt Swaim (.360) Trevor Moore (13) Trevor Moore (48)1994: Eric Filipek (.371) Eric Filipek (7) Eric Filipek (42)1995: Eric Filipek (.315) Patrick Jenkins (10) Eric Filipek (28)1996: Chad Faircloth (.384) Chad Faircloth (10) Scott Pastushok (47)1997: Chad Faircloth (.343) Billy Hillier (14) Billy Hillier (42)1998: Jamie Pietraszko (.374) Eddie Woods (16) Ty Wigginton (56)1999: Ryan Moffett (.359) Ryan Moffett (12) Ryan Moffett (48)2000: Curtis Moncus (.321) Curtis Moncus (11) Todd Interdonato (36)2001: Curtis Moncus (.343) Curtis Moncus (10) Curtis Moncus (44)2002: Grant Rembert (.365) Denver Edick (8) Grant Rembert (40)2003: Nick Jaksa (.324) Grant Rembert (8) Grant Rembert (46)2004: Steve Sherman (.360) Steve Sherman (26) Steve Sherman (53)2005: Elliott Arrington (.354) Josh Coyle (5) Josh Coyle (34)2006: Elliott Arrington (.352) Kevin Mattison (8) Elliott Arrington (47)2007: Rob Vernon (.394) Rob Vernon (8) Rob Vernon (57)2008: Kevin Weidenbacher (.337) Reed Kreiser (12) Elliott Arrington (54)2009: Kevin Weidenbacher (.309) Mike Vaughn (7) Justin Schumber (31)2010: Justin Schumer (.384) Justin Schumer (9) Justin Schumber (37)2011: Robert McIntosh (.341) Patrick Koontz (5) Grant Gajdosz (27)2012: Cody Buch (.307) Patrick Koontz (8) Billy Creighton (32)

Runs Scored Total Bases Stolen Bases1985: Greg Starbuck (41) 1986: Kevin Hawkins (55) Greg Starbuck Kevin Hawkins (18)1987: John Smith & Kevin Hawkins (25) John Smith (82) Kevin Hawkins (15)1988: Jeff Fox (43) Brian Shehan (82) Jeff Fox (8)1989: Brian Shehan & Kevin Hawkins (50) Brian Shehan (140) Kevin Hawkins (12)1990: Kevin Hawkins (50) Brian Shehan (109) Kevin Hawkins (12)1991: Todd Bess (37) Todd Bess (104) Wayne Faircloth (17)1992: Matt Swam & Brian Kelly (49) Wayne Faircloth (102) Brian Kelly (33) 1993: Matt Swaim (45) Trevor Moore (106) Brian Kelly (21)1994: Shawn Gallaher (34) Eric Filipek (92) Eddie Bauer (9)1995: Billy Hillier (29) Billy Hillier (65) Jason Faunt (10)1996: Chad Faircloth (47) Chad Faircloth (120) Jason Faunt (11)1997: Chad Faircloth (42) Ty Wigginton (108) Chad Faircloth (17)1998: Ty Wigginton (67) Ty Wigginton (149) Stephen Deyo & Ty Wigginton (10)1999: Ryan Moffett (56) Ryan Moffett (145) Ryan Moffett (14)2000: Jason Ronai (40) Willie Stewart&Todd Interdonato(99) Jason Ronai (17)2001: Corey Mercer (43) Curtis Moncus (115) Corey Mercer (18)2002: Jake McConiga (38) Bill Carley (90) Jake McConiga (16)2003: Grant Rembert (41) Grant Rembert (113) Jake McConiga (20)2004: Matt Roberts (44) Steve Sherman (130) Steve Sherman (21)2005: Tony Campana (38) Josh Coyle (96) Kevin Mattison (14)2006: Kevin Mattison (49) Elliott Arrington (136) Kevin Mattison (13)2007: Rob Vernon (51) Rob Vernon (153) Rob Vernon (18)2008: Kevin Mattison (66) Kevin Mattison (129) Kevin Mattison (12)2009: Reed Kreiser (30) Justin Schumer (82) Kevin Weidenbacher (3)2010: Justin Schumer (39) Justin Schumer (118) Danny Baatz (7)2011: Jordan Lurie (34) Jordan Lurie (91) Danny Baatz (14)2012: Jordan Lurie (29) Patrick Koontz (84) Jordan Lurie (13)

Hits1985: Greg Starbuck (42)1986: Kevin Hawkins (55)1987: Kevin Hawkins & Gordon Ramsey (38)1988: Brian Shehan (52)1989: Brian Shehan (67)1990: John Turner & Kevin Hawkins (63)1991: Matt Swaim (56)1992: Wayne Faircloth (65)1993: Matt Swain (61)

1994: Eric Filipek (53)1995: Eric Filipek (45)1996: Chad Faircloth (61)1997: Ty Wigginton (66)1998: Eddie Woods (81)1999: Ryan Moffett (78)2000: Jason Ronai (70)2001: Curtis Moncus (71)2002: Grant Rembert & Bill Carley (61)2003: Grant Rembert (66)

2004: David Williams (77)2005: Elliott Arrington & Tony Campana (68)2006: Elliott Arrington (90)2007: Rob Vernon (97)2008: Kevin Weidenbacher (86)2009: Kevin Weidenbacher (642010: Justin Schumber (73)2011: Jordan Lurie (75)2012: Jordan Lurie (57)

Bold indicates school record

Page 66: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

64 /// F E A R T H E D O G ///

YEAR BY YEAR RECORDS (PITCHING) Wins ERA Strikeouts1985: Beau Thomas (4) Beau Thomas (4.50) Lance Day (37)1986: Beau Thomas (4) Bill Pfeiffer (5.66) Beau Thomas (47)1987: Marc Rosenbalm (4) Marc Rosenbalm (5.68) Marc Rosenbalm (24)1988: Brian Shehan (3) Mike Moore (5.03) Brian Shehan (68)1989: Joel Perkins (5) Joel Perkins (4.98) Mike Moore (34)1990: Jamon Deal (6) Marc Rosenbalm (1.50) Jamon Deal (51)1991: Marc Rosenbalm (11) Marc Rosenbalm (2.98) Marc Rosenbalm (73) 1992: Jamon Deal (7) Philip Lowdermilk(4.31) Jamon Deal (84)1993: Rob Masse (5) Kenny Hall (4.64) Rob Masse (50) 1994: Rob Masse & George Young (4) Rob Masse (4.86) Rob Masse (55)1995: Billy Hillier (5) Billy Hillier (7.84) Billy Hillier (58)1996: Freddie Rask (5) Eddie Woods (3.64) Gus Brown (51)1997: Nate Gardner (6) Sonny Moss (4.06) Fred Rask (85)1998: Josh White (7) Billy Hillier (4.98) Josh White (101) 1999: Jason White (6) Judson Ballard (5.35) Josh White (78)2000: Aaron Rembert (9) Nick Brannon (3.09) Nick Brannon (66)2001: Nick Brannon (5) Mark Schuurman (4.28) Nick Brannon (67)2002: Steven Cook & Judson Ballard (4) Jason Walker (3.13) Mark Schuurman (53)2003: Steven Cook (9) Seth Denton (1.37) Steven Cook (65) 2004: Steven Cook & David Williams (8) David Williams (2.84) Steven Cook (91)2005: Ben Buchanan (3) Andrew Alexander (2.70) Tim Johnson & Ben Buchanan (60)2006: Alan DeRatt (8) Jordan Dorsett (2.25) Alan DeRatt (71)2007: Graham Baughn (7) Matt Dalby (4.40) Alan DeRatt (69) 2008: Alan DeRatt (8) Alan DeRatt (1.74) Michael Bogaert (69)2009: Ryan Dull (3) Jeremy Hall (4.44) Tayhlor Wohlwend (51)2010: Ryan Dull (6) Ryan Dull (4.40) Justin Schumer (49)2011: Grier Harrington (3) Ryan Dull (4.62) Ryan Dull (66)2012: Three Tied (5) Ryan Dull (3.44) Ryan Dull (84)Bold indicates school record

Big South OverallYEAR W L T PCT W L T PCT COACH Record1986 6 11 0 .353 17 32 0 .347 Ken Bagwell1987 3 5 0 .375 12 20 1 .379 Ken Bagwell (29-52-1)1988 1 15 0 .063 9 32 0 .220 Steve Pope1989 10 8 0 .556 18 27 0 .400 Steve Pope1990 8 9 0 .471 25 25 1 .500 Steve Pope (52-84-1)1991 7 8 0 .467 19 29 0 .396 Jim Bretz1992 8 10 0 .444 20 28 0 .417 Jim Bretz1993 6 14 0 .300 19 27 0 .413 Jim Bretz1994 8 19 0 .296 15 30 0 .333 Jim Bretz (73-114)1995 3 20 0 .130 12 37 0 .245 Bill Hillier1996 5 15 0 .250 18 34 0 .346 Bill Hillier1997 9 11 0 .450 20 33 0 .377 Bill Hillier1998 10 8 0 .556 27 32 0 .458 Bill Hillier1999 4 11 0 .267 21 39 0 .350 Bill Hillier (98-175)2000 7 14 0 .333 26 32 0 .448 Mike Roberts (26-32)2001 8 12 0 .400 15 39 0 .278 Matt Myers2002 7 14 0 .333 21 30 0 .412 Matt Myers2003 12 9 0 .571 27 28 0 .491 Matt Myers2004 13 11 0 .542 26 31 0 .456 Matt Myers (89-128)2005 3 21 0 .125 11 42 0 .208 Willie Stewart2006 10 14 0 .417 28 35 0 .444 Willie Stewart2007 9 12 0 .429 22 38 0 .367 Willie Stewart 2008 6 15 0 .286 24 35 0 .407 Willie Stewart 2009 5 21 0 .192 9 42 0 .176 Willie Stewart (94-182)2010 10 18 0 .357 17 35 0 .327 Tom Smith2011 7 20 0 .259 15 37 0 .288 Tom Smith 2012 12 12 0 .500 25 30 0 .455 Tom Smith (67-102)TOTALS 190 337 0 .361 495 800 2 .382

COACHING RECORDS

Ken BagwellKen Bagwell Steve PopeSteve Pope Jim BretzJim Bretz Bill HillierBill Hillier Mike RobertsMike Roberts

Matt MyersMatt Myers

Willie StewartWillie Stewart

Page 67: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

65/// F E A R T H E D O G ///

Big South All-Conference1988 Brian Shehan-1B1989 Brian Shehan-1B Kevin Hawkins-SS1990 Jamon Deal-RHP Kevin Hawkins-SS John Turner-RF1991 Marc Rosenbalm-RHP1992 Wayne Faircloth-C1993 Trevor Moore-RF1994 Eric Filipek-DH1995 Eric Filipek-DH1996 Chad Faircloth-RF1997 Billy Hillier-DH1998 Ty Wigginton-SS Eddie Woods-OF Billy Hillier-DH1999 Ryan Moffett-OF Josh White-1B2000 Willie Stewart-2B2001 Curtis Moncus-3B2003 1st Team- Grant Rembert-C Coach of the Year- Matt Myers 2004 1st Team- David R. Williams-2B 2nd Team- Steve Sherman – DH2007 1st Team- Rob Vernon-OF2008 1st Team- Alan DeRatt- P 1st Team- Kevin Weidenbacher-SS 2nd Team- Kevin Mattison-OF2010 2nd Team - Ryan Dull - P2012 2nd Team - Ryan Dull - P

Big South All-Tournament1991- Todd Bess-3B Marc Rosenbalm-RHP1998- Troy Stortz-OF1999- Ryan Moffett-OF2001- Curtis Moncus-3B2003- Robert Rudder-2B Daniel Pruitt-3B2006- Rob Vernon-OF, MVP Elliott Arrington-OF Matt Henson-SS Alan DeRatt-RHP

Big South LeadersRuns Batted In1989-Brian Shehan (59)

Doubles1989-Brian Shehan (14)1998-Ty Wigginton (26)

Triples1989-Brian Lancaster (6)1999-Ryan Moffett (7)2006- Kevin Mattison (8)2007- Kevin Mattison (8)

Hits1989-Brian Shehan (67)

Home Runs 1989-Brian Shehan (19)

Stolen Bases1992-Brian Kelly (33)

Runs Scored1989-Brian Shehan (50)Kevin Hawkins (50)1990-Kevin Hawkins (50)1998-Ty Wigginton (67)

Wins1991-Marc Rosenbalm (11)

Earned Run Average1990-Marc Rosenbalm (1.50)2008-Alan DeRatt (1.47)

Saves1990-Phillip Mullinax (4)

Big South Rookie of the YearRyan Moffett-OF (1999)David A. Williams-RHP (2004)

Big South Pitcher of the YearAlan DeRatt (2008)

COLLEGIATE BASEBALL NEWS FRESHMAN ALL-AMERICANAaron Rembert-RHP (2000)Grant Rembert-C (2002)Israel Victor-LF (2002)David A. Williams (2004)

COLLEGIATE BASEBALL NEWS NATIONAL PLAYER OF THE WEEKTy Wigginton-SS (1998)Jason Walker-RHP (2000)

MISCELLANEOUS RECORDS

Steven Cook

Steve Sherman

Alan DeRatt

Page 68: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

66 /// F E A R T H E D O G ///

2001: Nick BrannonCincinnati Reds

1989Scott Teague Chicago Cubs

1990Brian Shehan Montreal Expos

1991Marc Rosenbalm Seattle Mariners

1992: (21st)Wayne Faircloth Chicago White Sox

1992: (38th)Jamon Deal Seattle Mariners

1998: (19th)Shon Norris Boston Red Sox

1998: (17th)Ty Wigginton New York Mets

1998: (28th)Marc Ludvigsen New York Mets

1997Chad Faircloth San Francisco Giants

1990Ronnie HoneycuttSeattle Mariners

1997Nate Gardner Cincinnati Reds

2000: (47th)Tim NettlesNew York Yankees

2003Daniel PruittOakland A’s

2003Jake McConigaKansas City Royals

2004: (25th)Steven CookMontreal Expos

2004: (26th)Steve ShermanSt. Louis Cardinals

UNC Asheville Players Drafted (19)

2008: (17th)Alan DeRattColorado Rockies

2008 (28th)Kevin MattisonFlorida Marlins

UNC ASHEVILLE PLAYERS ACTIVE IN MINOR LEAGUES (3)

Kevin Mattison2012 ClubNew Orleans Zephyrs (AAA)

Justin Schumer2012 ClubAugusta Greenjackets (A)

2012: (32nd)Ryan DullOakland Athletics

Justin Schumer2013 ClubBeloit Snappers (A)

Page 69: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

67/// F E A R T H E D O G ///

TY WIGGINTONINFIELDER

UNC ASHEVILLE, 1998Ty Wigginton played for UNC Asheville from 1996 through the 1998 season. His records at UNC Asheville include most doubles in a season with 26, most total bases in a season with 149 and most runs scored in a season with 67. In addition, he became the second player in school history to hit three home runs in a game with three against East Tennessee State and set a record for total bases in that game with 14. Ty also became the fi rst UNC Asheville baseball player to be named National Player of the Week when he was honored after hitting eight home runs and driving in 20 runs during a six-game span. He was named as a fi rst team all-confer-ence performer at shortstop that season.

Wigginton was drafted by the New York Mets in the 17th round in 1998 and worked hard in the Mets’ minor league system before getting a call in May of 2002 to report to the big leagues. On May 16, 2002, UNC Asheville had its fi rst player in the major leagues when Ty played for the Mets in San Diego.

Ty has enjoyed an interesting major league career that has seen him play for the New York Mets, Pittsburgh Pirates, Tampa Bay Devil Rays, Houston Astros, Baltimore Orioles, Colorado Rockies and this year the Philadelphia Phillies. A big highlight of his career came in the 2010 season when he selected by Yankee manager Joe Girardi to be on the American League All-Star team.

Ty was inducted into the UNC Asheville and Big South Hall of Fame in 2011.

Wigginton on the cover of The Sporting News when he was with the Pittsburgh Pirates

Wigginton as a member of his current team, the St. Louis Cardnials.

Page 70: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

68 /// F E A R T H E D O G ///

2006 NCAA BASEBALL TOURNAMENT

Page 71: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

69/// F E A R T H E D O G ///

Not every time a David takes on a Goliath is David going to come out on top. When UNCA’s baseball Bulldogs won their fi rst-ever invitation to the NCAA baseball tournament, the foe they drew was Clemson, the second-ranked team in the country. UNCA knew they were taking the role of David facing a formidable Goliath -- in Goliath’s back yard, no less. Still, the Bulldogs did themselves proud by keeping it close in a 3-0 loss before bowing out of the double elimination tournament with a 5-4 loss to Mississippi State.

The heroics started before the team made it to the Clemson Regional. The Bulldogs fought through the fi eld to play in the Big South Conference baseball tournament fi nal against Liberty. Down 10-0 after the third inning, the Bulldogs staged a remarkable rally, scoring 16 runs over the fi nal fi ve innings for a 16-11 victory and an automatic bid to the NCAA tournament.

Holding a team like Clemson to three runs or fewer -- a feat opponents

managed only seven times against the Tigers -- was a victory in itself. The 5-4 loss to Mississippi State was closely contested, as the Bulldogs had the bases loaded in the ninth inning but were unable to tie or take the lead.

In addition to an outstanding showing against bigger, more-established programs, UNCA has good news for next season. After posting a record of 11-42 in the 2005 campaign, the Bulldogs went 28-35 in 2006, and loses only one senior (Charles Pippitt) who played a major role in their success. Next season could be even bigger and brighter for the baseball Bulldogs.

Congratulations are in order for the UNCA athletics program, which seems to be on an upswing. Improved facilities, an active athletic director and a taste of success bode well for the future.

Said UNCA coach Willie Stewart, a former UNCA player and 2000 graduate, “It hurts to lose, and we’re never happy when we don’t win. But I’m proud of how we competed against two great baseball teams.

“We’ve faced a lot of adversity this year, but we never quit. We never quit here, either. I could not be more proud of these guys.”

Neither could we.

David Lost, but Goliath Knows He was in a Fight. Reprinted from Asheville Citizen-Times- June 3, 2006

2006 CLEMSON REGIONAL

Page 72: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

70 /// F E A R T H E D O G ///

AAndrew Alexander (2003-07)James Alley (1990-91)Mark Allen (1992-93)Derek Anderson (2001)Elliott Arrington (2005-08)

BDanny Baatz (2008-11)Judson Ballard (1999-03)Graham Baughn (2006-08)Todd Bess (1990-93)Mike Bailey (1988-90)Chad Ballard (1990-93)Doug Baird (1991)Eddie Bauer (1994-96)Jack Bebber (1992)Brad Beck (2002-03)Travis Black (1999-00)Miguel Blatt (1997)Michael Bogaert (2006-09)John Bowman (1994-97)Nick Brannon (1997-01)Chris Brookey (2008)Michael Brooks (1990-91)Gus Brown (1992-94)Mark Brown (1985-86)Eric Brotzman (2004-05)Hunter Bryant (2012-)Cody Buch (2009-12)Ben Buchanan (2005-08)Steve Burnich (2003-07)

CTony Campana (2005)Bill Carley (2002-03)Catlin Carter (2008-11)Tyson Christ (1993)C.A. Clayton (2010-11)Todd Coggins (2002-04)Brad Comer (1999)Brian Connolly (2011-)Steven Cook (2001-04)Matt Corrado (2000)Josh Coyle (2003-05)Elliot Criss (2011-)Tyler Crocker (1985-87)Ryan Cummins (2002)

DMatt Dalby (2007-10)Klint Davis (2011-12)Evan Dawson (2005)Lance Day (1985-86)Jamon Deal (1989-91)Kenny Del Sarto (2002)Seth Denton (2001-03)Alan DeRatt (2005-08) Stephen Deyo (1997-00)Keith DiYeso (1992-93)Jordan Dorsett (2006-07)Gus Dotsikas (1985-86)Brandon Drespling (2004)Cameron Duckworth (2007)Chris Duhamel (2001-02)Ryan Dull (2009-12)Nathan Durham (2005-06)

EDenver Edick (2001-02)Greg Emmett (1985-88)Billy Enright (2008-10)Rob Esgro (1994-97)

FChad Faircloth (1996-97)Wayne Faircloth (1990-92)David Fater (1992-93)Jason Faunt (1995-96)Eric Filipek (1993-96)Jeff Fox (1988-91)Chris Freeman (2008)Jeremy Fry (1996)

GTerry Gahagan (1986-89)Grant Gajdosz (2011-12)Shawn Gallaher (1992-95)Granville Gehris (2003-04)James Gemler (1999)Curtis Glover (2003-07)David Gordon (1994-96)Ian Graham (2010-)Chad Gregson (2005)

HJeremy Hall (2008-09)Kenny Hall (1991-94)David Hampton (1985-86)Jeff Haney (1991)Kevin Haney (1990, 92-93)Jeremy Harrill (1990)Grier Harrington (2008-11)Steve Hardister (1985-86)Kevin Hawkins (1986-90)Ryan Haushalter (2004)Derek Helton (1989-90)Matt Henson (2006-07)Benjamin Hill (1996)Jon Hill (1997)Billy Hillier (1995-98)Bill Hinson (1996)Ronnie Honeycutt (1989-90)Derrick Hopkins (2009-10)Tommy Houmard (2011-)Stephen Hull (1998-01)Justin Hunt (2012-)

ITodd Interdonato (1999-00)

JNick Jaksa (2001-04)Tyler Jankowski (2008)Nelson Jenkins (1991-94)Patrick Jenkins (1994-96)Tim Johnson (2005-06)Todd Johnson (1985-86)Brent Jones (2000)Evan Joura (2012-)Todd Joyner (2012-)

KBrad Kastor (1990-93)Kevin Keen (1993-95)Brian Kelly (1992-93)Ben Kerr (2004-05)Tom Kipphut (1993-94)Andrew Kirkland (2011-)Gary Kohler (2002-04)Patrick Koontz (2011-12)Reed Kreiser (2008-10)Jonathan Krott (1996)

LDan Lammers (2008-11)Brian Lancaster (1989-90)Josh Lett (2007)Heath Lock (2008)

Edmond Locklear (2006-07)Philip Lowdermilk (1990-91)Marc Ludvigsen (1997-98)Jordan Lurie (2009-12)Taylor Luthren (1996-97)

MJeremy Manning (2001)Tim Manning (1996-98)Johnny Martinez (2005-08)Rene Martinez (2011-)Rob Masse (1992-93)Kevin Mattison (2005-08)Jake McConiga (2002-03)Chad McConnell (1995-98)Mike McDaniel (1990-92)Carson McLean (2008-11)Robert McIntosh (2010-)Corey Mercer (1999-00)Pete Meterko (1999-00)Eli Miller (2011-)Troy Miller (2000)Ryan Moffett (1999)Curtis Moncus (2000-02)Mike Moore (1988-00)Trevor Moore (1992-93)Sonny Moss (1997-98)Brett Muhlhan (1999-01)Phillip Mullinax (1989-90)

NErik Nabi (2005-06)Bill Nay (1996)Matt Neils (2001)Scott Nelson (1996)Tim Nettles (1999-00)Chris Nigro (2004-07)David Norman (2000-01)Shon Norris (1996-98)

O

PBen Padgett (2001-03)Scott Pastushok (1996-97)Billy Peiffer (1985-87)Joe Pellington (2005-06)Joel Perkins (1989)Greg Peters (1990-91)David Phipps (1985-87)Scott Phillips (1992-94)Jamie Pietraszko (1998)Charles Pippitt (2003-06)Jeff Poole (1991-94)

RFred Rask (1996-97)Marshall Reese (2001)Aaron Rembert (2000-04)Grant Rembert (2002-03)David Ricker (2009-11)Matt Roberts (2002-04)Brett Robinson (2005-08)Fernando Robleno (2000)Dean Roland (2011-)Jason Ronai (1998-01)Marc Rosenbalm (1987, 1990-91)Robert Rudder (2001-03)

QChris Quarles (1999)Rodney Quinn (2004)

SDrew Sandri (2003)

2006 NCAA BASEBALL TOURNAMENT

Page 73: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

71/// F E A R T H E D O G ///

UNC Asheville’s Athletics Hall of Fame was established in 2003 and has had 10 classes inducted. A total of 34 athletes and administrators have been enshrined. Of those 34 inductees, three are former baseball players: Brian Shehan, Marc Rosenbaum, Ty Wiggington.

UNC ASHEVILLE HALL OF FAME

Brian Shehan (1987-90)Inducted in 2004

Brian Shehan produced one of the greatest baseball careers ever at UNC Asheville. He was an all-conference player at fi rst base in the 1988 and 1989 seasons. In 1989, Brian set a single-season record for home runs (19), RBI (59), slugging percentage (.786), doubles (14) and total bases (140). He was ranked nationally in 1989 for home runs, RBI, slugging percentage and total bases. Brian fi nished his career as the school’s all-time leader in home runs (42), RBI (163), doubles (52) total bases (391) and batting average (.352). He currently holds seven different UNC Asheville hitting records. Brian was a four-year starter for the Bulldogs and was the second player in school history to be drafted by a major league team when the Montreal Expos drafted him in 1990.

John Sagalio (1996-97)Nick Schavone (2012-)Justin Schumer (2007-10)Brian Shehan (1987-90)Steve Sherman (2003-04)Mike Shildt (1987-90)Mark Schuurman (2001-02)Chris Smith (1988)David Smith (2001)John Smith (1986-87)Kyle Smith (2006-07)Jay Snyder (1994-95)Dustin Sode (1999-03)Drew Spear (2010-11)Adam Spracklin (2012-)Joel Sprouse (1989-90)Brad Stark (1997-99)Greg Starbuck (1985-86)Ethan Steible (2011-)Ryan Stewart (2004-06)Willie Stewart (1996-00)Troy Stortz (1997-98)Scott Stotlar (2002-03)Trent Suggs (1990-93)Matt Swaim (1991-94)

TDillon Tabar (2008-)Bo Thomas (1985-87)Steve Thomas (1998)Jesse Thompson (2001)Ron Trabosh (1995-97)John Turner (1989-91)Sam Turner (2011-)Kevin Tymko (1990-92)

VMike Vaughn (2008-11)Rob Vernon (2006-07)Chuck Vestal (1985-87)Israel Victor (2002)

WChris Walker (1992-94)Jason Walker (1999-02)Tony Wall (2004-06)Dillion Waters (2008-09)John Watlington (2006)Brad Watson (1994-95)Rich Weaver (1988-90)Kevin Weidenbacher (2008-09)Dan Weller (2007-10)

Bryan White (1993-96)Chris White (1995-06)Jason White (1996-99)Josh White (1996-99)J.K. Whited (2004-07)Ty Wigginton (1996-98)David A. Williams (2004-07)David R. Williams (2004)Dustin Wiley (1999-01)Justin Wilkins (2004-06)Mike Wilson (1996-97)Taylor Wohlwend (2008-10)Derek Woods (1985-86)Eddie Woods (1996-99)Danny Wright (1987-88)

YGeorge Young (1991-94)

ZJim Zacharewicz (1997-98)Beau Zinman (2008-11)

Returning Players in Bold

Marc Rosenbalm (1988-91)Inducted in 2010

Marc Rosenbalm has remained UNC Asheville’s all-time leader in complete games (13), shutouts (4) and earned run average (3.21) for nearly two decades. He set the school’s season records for wins (11), shutouts (3), innings pitched (117.2) and complete games (11) as a senior in 1991 while being named fi rst-team All-Big South and All-Tournament. He also led the Big South with a 1.50 ERA in 1990.

Ty Wiggington (1995-98)Inducted in 2011

Ty Wiggington played for UNC Asheville from 1996 through the 1998 season. His records at UNC Asheville include most doubles in a season with 26, most total bases in a season with 149 and most runs scored in a season with 67. In addition, he became the second player in school history to hit three home runs in a game with three against East Tennessee State and set a record for total bases in that game with 14. Ty also

became the fi rst UNC Asheville baseball player to be named National Player of the Week when he was honored after hitting eight home runs and driving in 20 runs during a six-game span. He was named as a fi rst team all-conference performer at shortstop that season.

Wigginton was drafted by the New York Mets in the 17th round in 1998 and worked hard in the Mets’ minor league system before getting a call in May of 2002 to report to the big leagues. On May 16, 2002, UNC Asheville had its fi rst player in the major leagues when Ty played for the Mets in San Diego.

Page 74: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

72 /// F E A R T H E D O G ///

Championship Game Appearances

2001, 2006Tournament Championships

2006

The 2006 Bulldogs celebrate the Big South Tournament Title

Big South Tournament ResultsDate Opponent W/L Score 1990 Augusta L 7-1 Coastal Carolina L 6-21991 Winthrop W 5-0 Augusta W 6-3 Davidson W 5-2 Coastal Carolina L 13-3 Coastal Carolina L 8-11992 Coastal Carolina L 5-0 Davidson L 6-31998 Coastal Carolina L 10-4 Winthrop W 5-4 Coastal Carolina L 5-21999 Coastal Carolina L 3-2 Charleston Southern W 8-3 Liberty L 6-52000 Charleston Southern L 5-4 Radford W 2-1 Coastal Carolina W 3-0 Charleston Southern L 3-12001 Elon L 3-2 Charleston Southern W 4-3 Liberty L 12-32002 Elon L 10-5 Charleston Southern L 7-22003 Elon L 9-4 Winthrop W 9-1 Liberty L 5-42004 Winthrop L 2-1 Charleston Southern W 9-2 Winthrop L 8-12006 Birmingham-Southern W 2-0 Coastal Carolina L 6-1 High Point W 12-2 Liberty W 4-1 Liberty W 16-112007 Charleston Southern W 3-0 Coastal Carolina L 6-3 High Point W 9-7 Liberty L 12-82008 High Point W 3-2 Coastal Carolina L 20-4 Liberty L 10-12010 VMI L 7-42012 Liberty L 9-2 High Point L 7-1

Big South Tournament Record by Opponent Win Loss .PctAugusta 1 1 .500Birmingham-Southern 1 0 1.000Charleston Southern 4 3 .571Coastal Carolina 1 10 .091Davidson 1 1 .500Elon 0 3 .000High Point 3 1 .750Liberty 2 6 .250Radford 1 0 1.000VMI 0 1 .000Winthrop 3 2 .600Totals 17 28 .378

The Bulldogs fell to VMI in the fi rst round of the 2010 Big South Conference Tournament 7-4.

Page 75: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

73/// F E A R T H E D O G ///

CONWAY, S.C. - Tournament Most Valuable Player Rob Vernon hit a grand slam in the eighth inning as UNC Asheville overcame a 10 run defi cit to win the Big South Conference Tournament 16-11 over Liberty on Saturday night.

It is the Bulldogs (28-33) fi rst ever Big South Championship in baseball and sends Asheville to its fi rst ever NCAA Regional appearance. The baseball team becomes only the second UNC Asheville team to make a NCAA Tournament in any sport joining the 2003 men’s basketball team.

“I give the guys a tremendous amount of credit,” said Stewart. We stuck together and never quit. This is a tremendous accomplishment, what we did this weekend. I could not be happier for these guys.”

The Flames (39-21) sent 13 men to the plate in the bottom of the second, scoring nine runs on eight hits to take the 9-0 lead. Chad Miller posted two RBI in the inning.

Liberty added one run in the bottom of the third to push the lead to 10-0. With one out, Chad Miller moved to fi rst on a walk and moved to second as Michael Just singled through the right side. Miller was caught stealing. Aaron Grijalva scored Just as he reached on an error.

UNC Asheville moved four across in the top of the fi fth to cut the lead to 10-4. With one out, John Whited singled and moved to second on a single by Kyle Smith. Steve Burnich followed with a double to left fi eld, plating Whited and moving Smith to third. Kevin Mattison was hit by a pitch to load the bases. Matt Henson grounded out to the shortstop to score Smith, moving Mattison to second and Burnich to third. Elliot Arrington followed with a single to left to plate Burnich and Mattison.

The Bulldogs chipped away at LU’s lead in the top of sixth, adding one run to move the score to 10-5. Charles Pippitt led off the inning with a walk,

and two batters later Burnich singled to right center to move Pippitt to third. Mattison singled to center fi eld to plate Pippitt. It marked the 17th consecutive game in which Mattison has gotten a hit, one shy of the UNC Asheville record held by head coach Willie Stewart and Tony Campana.

Asheville added another run in the top half of the seventh. Arrington led off with a walk and was moved to second on an Edmund Locklear walk. Vernon reached on a fi eldier’s choice, moving Arrington to third. Pippitt hit a sacrifi ce fl y to center fi eld to plate Arrington.

Asheville took its fi rst lead of the game in the top of the eighth. With one away, Burnich was hit by a pitch and moved over on a single by Mattison. Henson singled to load the bases. Burnich scored on a groundout by Arrington, moving Mattison to third and Henson to second. Locklear followed with a walk to load the bases. Vernon followed with a grand slam to clear the bases, his seventh home run of the year and the second grand slam for the Bulldogs this season.

The Bulldogs sent 11 people to plate to score fi ve runs on fi ve hits to push their lead to 16-10 win in the top of the ninth. Arrington highlighted the inning with a three RBI double to left center.

Liberty scored one in the bottom of the ninth to cut the lead to 16-11 but that would be as close as they would get.

UNC Ashevilles’s Alan DeRatt picked up his second win of the tournament and improves to 8-4, while the Flames’ Phillip Thompson took the loss, falling to 6-7 on the season.

With the win, UNC Asheville picks up the Big South’s automatic bid and records its school record 28th victory of the season.

2006 BIG SOUTH CHAMPIONSDown but Never Out Reprinted from uncabulldogs.com- May 27, 2006

Page 76: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

74 /// F E A R T H E D O G ///

Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”

The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.

During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.

In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.

Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.

In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.

In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.

Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.

The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.

THE BIG SOUTH CONFERENCE

Page 77: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

75/// F E A R T H E D O G ///

BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100

Charlotte, NC 28226Phone: (704) 341-7990

Fax: (704) 341-7991www.BigSouthSports.com

Founded 1983

PresidentPenelope W. Kyle, Radford University

Vice PresidentDr. Frank Bonner, Gardner-Webb University

SecretaryDr. Anne Ponder, UNC Asheville

CommissionerKyle B. Kallander

Associate CommissionerJames Companion

Associate CommissionerDawn Turner

Assistant Commissioner - Public RelationsMark Simpson

Assistant Commissioner - MarketingChad Cook

Director of Multimedia DevelopmentMark Bryant

Offi ce ManagerTerri Ballard

Assistant Director of MarketingMatt VanSandt

Assistant Director of Public RelationsNic Bowman

Assistant Director of ComplianceSherika McLean

Marketing AssistantMelissa Estepp

Public Relations AssistantBriana Mayes

Administration/Multimedia AssistantEarl Laing

Coordinator of Football Offi cialsDoug Rhoads

Coordinator of Men’s Basketball Offi cialsJoe Forte

Coordinator of Women’s Basketball Offi cialsCharlene Curtis

Coordinator of Baseball UmpiresTony Thompson

Coordinator of Softball UmpiresBetsy Kidd

Coordinator of Men’s Soccer Offi cialsPaul James

Coordinator of Volleyball Offi cialsDaniel Leake

Member Institutions (12): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Longwood University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University

Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (4) – Liberty University, Longwood University, Radford University, Virginia Military Institute

Associate Members: Stony Brook University (football), Davidson College (women’s lacrosse)

Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Women’s Lacrosse, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball

Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; Marge Connelly, Longwood; Dr. Claude Lilly, Presbyterian; Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop

BIG SOUTH QUICK FACTS

Page 78: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

76 /// F E A R T H E D O G ///

Page 79: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

77/// F E A R T H E D O G ///

ABOUT THE UNIVERSITY As the University of North Carolina at Asheville celebrates eighty years of excellence in higher education, the campus community welcomes new challenges and greater successes as one of the nation’s leading liberal arts colleges. From its beginnings as Buncombe County Junior College, where 86 students enrolled in 1927 to further their educations beyond high school, the University has valued liberal arts ideals and community engagement. Its special commitment to student learning and undergraduate education was reaffi rmed when it joined the University of North Carolina system in 1969 as the University of North Carolina at Asheville. The University maintains its liberal arts imperative, as the designated undergraduate liberal arts University of the 17-campus University of North Carolina system.

Vision

UNC Asheville students, within a diverse and inclusive community, experience liberal arts education at its best.

Mission

UNC Asheville is distinctive in the UNC system as its designated liberal arts university. Our practice of the liberal arts emphasizes the centrality of learning and discovery through exemplary teaching, innovative scholarship, creative expression, co-curricular activities, undergraduate research, engaged service, and practical experience. Primarily undergraduate, UNC Asheville offers a liberal arts education characterized by high quality faculty-student interaction. We offer this challenging educational experience to all promising students who are committed to liberal learning and personal growth.

Our liberal arts educational approach emphasizes life skills including critical thinking, clear and thoughtful expression, and honest open inquiry. Students undertake concentrated study in one area while simultaneously developing an understanding of the connections among disciplines. We encourage students to clarify, develop and live their own values while respecting the views and beliefs of others. In addition, we cultivate an understanding of the dimensions of human diversity while recognizing the common humanity of all. We believe a quality liberal arts education enables our graduates to be lifelong learners and to lead successful, fl ourishing lives as leaders and contributors to their communities.

At UNC Asheville, we respond to the conditions and concerns of the contemporary world both as individuals and as a university. We incorporate economic, social and environmental sustainability into our institutional practices and curriculum. With a range of associated centers, partnerships, and initiatives, we fulfi ll our public responsibility to address the needs of our community through a continuum of learning. We develop a commitment to continuing service characterized by an informed, responsible, and creative engagement with the Asheville area, the southern Appalachian region, the state of North Carolina, and a diverse and increasingly connected world.

Alma Mater

In 2000 the university community set about the task of writing a new Alma Mater—the offi cial anthem of UNC Asheville, sung at all ceremonial events—to replace the one from the 1960s. In Latin, alma mater means “nourishing mother,” and it also refers to the school one attended.

Hail Our Alma Mater, Hail UNCA.

Learning be your watchword,Greatness be your way.

High upon the mountains,In the Land of Sky,

Stands our Alma Mater,Lift your voices high.

Noble Alma Mater,Hear our words of praise.

May we love and honor you,Until the end of days.

Page 80: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

78 /// F E A R T H E D O G ///

WWWWWiWWiWiWiWWWWiWiWiWiW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCCNCCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC A AA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn sssssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuuppppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaaaasyssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarra tststststststststststststststssssssss, , , , , , , ,,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscscsccieieeieieieieei ncnceeeaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....

HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s

AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 2020202020202020

MoMoMoststst P Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchhhhhhchc oooololoololooolooololololooolololooo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititititittererererereere atatataturururureeee,e,ee,e, EEEEEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnnonnnnnnnnnnno mmmemememeeeeeememeememeeeem ntntntntntnntntntnntnntnnnnnnntnntnn alalalalalallalalalalaallllalallallalalaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuutututututututtututututututtuuutuuuudididdidididididdidddididdididdididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,, HeHeHeHeHeealthth &&&& &&&& W W WWWWWWWWWWWWWWWele lnnesessssPrPrromomommotottoto ioioioionn,n, aaandndndd A A A AAAAAAAAAAAAAAAAAAAAAAArtrtrttttrtrtrtrtrtrttrtrtrrrtrtrtrtrtrttrrtrtt

FuFuFuF llbllbblbblblbbbbbbblllllblbllbbl riririgghgghghghghhhhghghhgggghhgghgghhgg t t AAAAAwAwwwwwAwAAwAAAA arararardsdsdssssssssssssdssss: ::: ::: :::: 37373737373737773773773737377773737373737373737373377 s s tttutututut ddddeeeeeeeeeeeeeed ntntntntntntntntnnnn s s hhavev reeeeeececececceceieiiiiieieieiieivvvveveved ddddddd ddd ddd ththththhhhhhhhhe e prprprprprprprrprpprrrprprrp eseseseseseseseseesesesseseseeesttitititttttttttt gigigigiououououous s s s awaaawawawawawawawwawawawawawawawawawawawwawararaararrrrrarrarararaararraarara ddd

UnUnUnUnUnUUnnnnnUnnnUnddddedededddddededdergrgrgrgrggrgrgggrggrgrgrgrggrggggraraaaaaaaaaaaaddduduuududduatatatatatatataaate eeeeee e ReReReRReReReRR seseseseseeararararchchchhc :: ::::::: MoMooooreree tt thahahan hhhahahahaahahhhhalfffflfflffff oo oof f fffffff ststsstststtstsstuuududdudududdu eeeeneeneneneeneee tststsststss ccc c c ccc c cccccccccccc cccccomomomo plpplplpp eteetetetettetettetettette eeeeeeeee eeeee eeeeeeee orooororrorrrorrororororrrrrroooo igigggginininininininininininiinii aaaaaaaalalaaalalaaa r rrrrrrrrrrrrrrrreeeseeseesessssseseesseeesseeeaeeaeaeaeaeaeaeaaae rcrrcrrrcrcrcrcrcrcrcr hhhhhhhhh h hh hhhhhhhhhhhhhh iniinininininnnininininniininiinnniiinnninniinnninnnn t ttt ttttt tttttttttttttttttttttthhhhhhhehehehhhehhhehheh iriririrrr fi fi fi fififififi e ee e e eeeldldlddld o oooof f f fffffff stststststttudududududududduddyyyyyyyyyythththrorougugh hh thththhhthhthhhthhheeeeeeeee e UnUnUnUnUnUnUnUnUnUUnUUnnivivivivivivivviviviiverererererererereerersisisisisss tytytyyyyyyyyyyyy’s’s’s’s nnnnnnnnn nnaaaatataatioioionananalllllly y y rrrrrerererr cooooococcoooogngngnnnngnngngngggggg izizziziiizizzizizi edededdedededededddeddedddd U U UUUUU UU UUUUU UUUUUUUUUUUUUndndndndndndndnndndndnddnndndnddndndnddndndndddddderereeereererererereeeeerereeereeeerereeerereee grgrgrgrrgrgrgggggggg dadadadadadduuauuuauauauauauuuauaaaauaaaateteteteteteeeteteteeeteeeetetetttttttttteee R R Reeeseseseseseseseseseseesesseeseeseeseseeseesseeseeseseseesseeeeeeaeaeaaeeeaeaeeeeeeeeaeeeae rrrcrcrcrcrcrcrcrccrccrcrcrrrrccrcrccchhhh hh hhhhhhhhhhhhh hhhhhh hhhhhhhhhhhhh PrPrPrPrrrrrrPrPrPPPPrrrP ogooogogogogogogogogogogooogoooggogoogoogogggoogogogogooggoo rararaaararararrararaaarrararrararaaraarraraaarararaaaar mm.mmm.m.mm.m.mmmmmmmmmm.mmmmmm.mmmmmmmmm UUUU NCNCCCC AAAA A AAAAshshshshhhhhevevevvvililillilillleleleleleleleeffofoooooooof unundeeeeeeeeed d ttththhthhhheeee e NaNaNaNaNaNNNaNaNaNaaaaaNaaaatitititititit onononononnonoono lalllalalllla CC CCCCCCCCCCCCCCCononononnonononooo fefefefeferrerer ncnce e e onoo UUUUUUUUndndndndnndndndndnnnn errrrererrrrggrgrgggg aadadaadadadddadaa uauauuuauauaaaauauuaauaaaauaaauaauatttttteteteteetttetttttt R RRR RRRRR RRRRReseseeeesesesesesessssesesseseseseeseeeeee eaeaeaeaeaeeaeaeaeaeaeaeaeaeaeaeaeaeaeearcrcrccccrcrcrrcrcr hhhhhhhhhhhhh h h hhhhh mmomore tthahan n 25222222225255552522522222522525255555222 yy yyyeaeeeaeaeaeeaeaeeaeeaeeeeeaeeeeeeaearsrrrsrsrsrsrssrsrssrsrsrssrrrrsrsrssrrrsrssrssssss aaaaaaaa aaaaaaaaaaaaaa gogggggggogogogogoggogogggogogogoggogoggggggggggg .

StStStStSStStStStS udddududududddduuduudududyy yyyyyy yy yyyyyy yyy AbAbAAA roorooooooooooaaaaaadddda a aaaaaaaaaaaaaaaaaaaaandndndndddndddddddndndndndndndndnndnnndnnddndn S SS SSSSSS SSSSSSSSSSSttutuututututututututttt dddydydyddyddydddydyyddydyy A AA A AAAAwawwaww y:y: 1 17 77 pepepeeeeeercrrr eeeeeenenneenee t t tt oofofffooooooo s sssssssssstutututuuuuuuuudddddddddededdddedddddddddddddddd ntnnnnnnntntnnnnnnnnnnnnnntn sssss ssssssss tatatatataaaaatataataaaaaaaaaaakekekekkekekekekekekekekekekeke a aaa aaaa aaadddddddvdvdvvvvvdddvvdvvvvvanananannanannnnnnanananananannanaa tatatatatatatatatataaaaaaaaaagegegegegegegegegegegegegegegegegeegegegeee o oooo oo o o o o oo oooooff f f f ff f fff f ff leleeleleeelelellelelellleeeleeeleeleeeleleeararararararararaararaaa ninininininininnininnininnnnniniiin ngngngnnngngngngngngnnnngngnngngngnnngnnnngnnnngnnnnnnnnggnnggggngg ooooooo oooooooooooopppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp ororooooooooooooooo tututututtttutuutuuutttutttttutututuutuutuuuuutuututuunininininininn titititttt esessssss i i innnnnnnototoototottototoototo heheheheheeheheeheeh r r rrrrr ststststststtststtstatatatatatttatatatttteseseseeseseeseseeeee aaaanndndddddddddndddddddddddd ccccc cccccccccccccccccccoououoooooo ntntnnntntnttntntntntnttrrriririrrrrirrriirirriir esesess w whihihilele e enrnrnrololollllllllelelelellleeeleel ddd ddddddddddddd atatataatatattat UUUU UUUUU UU UUNCNCNNCNCNCNCCCCNCNCNCNNCNCNCNCC A A AAAAAA AAAAAAAA AAAAAAAAAAA Ashshshshhshshhhhshhshshshhhshshhhhhshhsshs evevevevevevevevevvevevevvvevevvveveveeveve ililililillllliillililiiililleleleleleleleleeleleleelee... .

StStS ududenenenenenenttt ttttt AAAtAtAAtAtAthlhlhlhlhlhlhlh eteeeteettte e eee GGGrGrrGGGrrG adadadadadadaaduauuauauauauauaaaaaatitititititiititittitit ononononoono RRRRR R RR Ratatattttttattattatatattttattteeeeee::ee:eeeee:ee:ee UUUUU U UNCNNCNNCNNCNCNCNCNC AAAAA AA Ashshsshshshshevevevevevevvililililili lellellelele s sssss stututudeddentnnnntnnntnnnnnnnnnnnnn -a-aaththtththhthththhhthhthhthhlleleleleeeelelelelleeleletetetetetetetetetetetetettteteeeeteteetetetetessssssssssssssssss s sss hahahahahahahhahahahahahahhahaahahahahhahahhhhahahaahhh vevevevevevevvevvevveveveveveveevev o oo ooooonenennn o of f ththe e hihighghg esest t grgrrgrgrgrgrgrrgrrradadadadadaadaaaada uauauuatitittiononononrararrarrraatetetetetet ss s sss iiniiininininnin tt t t ttthhhehehehehe NNNNN NN NCACACACACACACACAA.A.A.A.A.A.A.AAA O O OOOOurururururururu ssssss sstutututututudedededededentntntntntntnn aa-a-a-athththttthleleleteteetes s sss ononononon a a a aaththleleetitiitititicc c scscscscscscscchohohoohohoohohooooooholalalalllallalalalalaarrsrsrsrsrsrsrshihhihihhhhihihhhihih pspsps wwhoho p plalay yy alalalaa ll fofofooofourururrurururrururrurrurur yyyyy yyy yyyeaeaeearsrs aaattt UNUNCCCAsAsAsAsAshehehhevivivilllllle e hahahahavevevve a aaa 9 9 9 99 9 9 pepepepepeep rcrcrcrcrcrcenenenene tt ttt grgrgradadadadaaduauauauauatiitititioonon rrratatate.e..

FaFaFaFaFaFaFaFaFFFFFFFaFacuccucucuucuc ltltltltlltl y:y:y:y:yyyyyyy 222222 2 210101001000010101010 fffff ffulululluluullll-l-l-l--l-l-ll titititititit memememememememeeeeee ff fffffffffacacacacacacaaaacululllulullululultytytytytytytytyyyyyy mm m m m mmmmmmmemememememememmememeeee bebbebebebbebbebeersrsrsrrsrsrssrsr , , , ,, 84848484484848484848484%%%%%%%% % % wiwiwiwithththtththhht ttt tttttereeerererererrrmimimimimimmimimiminananaal l l dedededededeedegrgrggrgrgggrgrggg eeeeeeeeeeeeees s

COCOPLAC: UNUNC C AsAshehevivilllle isiis t thhehe hh heaeadqdquauauartrtereers s s fofor the e CCoununcicil l of PPububblilicc c Liberal l Artsts C Coolleges, aa2727-mmemembeber r orgagaaninizazazattition of state-supppporteed libebeberalll arts collegegeges that rrrececogogninizeze tt theee immpmportancncncee e ofoff liberal l arartsts a andnd s sccicieneenceccess ededucucattiion fof r succesee s ss innn aa comom lplexex g gloloobabab l sosocicietetety.

CCCCaCaCaCaCaCCCCCaCCCCaCaCampmpmpmpmpmpmpmpmpmpmpmpmpppppus LifeRReReReReReReReReResisisisisisiiisiidededededededeedeeencncncccccncccnccncncncnnce e eeeeeeeeee Haalllls:s: AAboboutut oonene-t-thihirdrd o of f ststududenentsts l livive e onon c camampupus,s, w whiiiileleleeeeeeeeeleleleeleelelee a a a a aaa a aa aaaa aaaaaaannonononnnononononnooonoononnoonnnononnnonnn ththththththththththththththththththtthththhthhhththhherererererererererererererererererererereeerrerrrr t t t tt tt t t t tt t ttt t ttttttt ttt tthihihhihihihihihihihihihihihihihihihhhhhhhihhihiih rdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrdrdrdrdrdrdrdrddr ll l ll l ll ll l lll l ll l lliviviviviiiivivivivivivivivivivive withthinin aa one-milerarararaaadididididddiddd usususususus o o o ooffff ff ff cacacacacacaaaaaaccaaacccc mpmpmmmmmmmmmm usus.

AtAtAtAAAAAAthlhlhlhlhlhlletetetee icicicics:s:s:ss:s:: 1 115 5 5 5 NCNNNCNCNCNCNCNCNCCCCCCCCCCCCCNCAAAAAAAAAA D Divviision 1 1 tetetetetetetetetetetetetetetttttteteteteamamamamamamammamamamamamamamaaaaaaaaaaaa s s s

StStStStStStSttStStStStududududdududududududeneneneneeneneneneenenene ttttttttttt t GrGrGrGGrGrGGrGrGrGrGrouououououououououououpspspspspsppps:: :: MoMoMoMoMooMoMoMoMoMoooM rrererrererereeererereererrerererrerrererererr t t t t t tttthahahhahahahahahahaaahahahahahaahaaan n n nnnnnnnn 60606060606060600000 c ccccccccccccccccccccclulululuululululululuulululuuuuulululullubsbsbsbsbsssbsbssssbssbsbsbsbsbsbsbssbsbsbsb a a aa a a a aa aa a aaaaaaaanddndndndndndndndndndnddddddndndddnd ooo oooooo oo o oo oooooo ooooooorgrgrgrgrgrgrgrgrgrgrgrrgrgrgrrgrgrgrgggananizzata ioionss, raaaaaaaangngngngngngngngngngnggngngnngngnngnggngngng ninininininininininininninininininiiininiiniinnggg g ggg ggg g g gggggggg ggg g ggggggggggg g frfrfrfrfrfrfrfrrfrfrfrfrfrfrrfrfrffrfrrfrffrfrrrrromomomoomomomomomomomomomomomoomomommommomoooomoommomomomomo hh hhh h hh hhononononononoroorororororo s s s s ssococococococieieieieietititititiesesesess ttttttttttto o o oo oo iniinininnninintrtrtttrtrtrrtrrrrrttrrrtrrrrrrrrrramamamamamamamamaaaamamaaamaaaaa urururururuuururururruruurururururururrrruralalalalalaaallalalalalalalalalalaaaaspspspspspspspsporororororroortstststst

Innnnnntttteteeercrculululuuullultutututuutututturararaaaararal CeCeCeCeCeCCeCeCeCeCentntnttntttttttttterererererererererererererererere & & &&&&&&&&&&&&&&&&& O OO OOOOO O OOOOOOOOffiffiffiffififfiffiffiffiffiffifffifffiffi cccccc cc e e eee ofooofofofofoooo M MMMMMMululululuullultititittitititicucuucucucucuucultltltltlttlttttururururururururururalalalalalaalalal S SS S SS S SSS S SStutututututututututtuudededededededededededeeeedentntntntntntntntntntnnntntntt P PPPPPPPPPP P Prororororoororoororoororogrgrgrgrgrgrggrgrgrggrgrggrrgrrrg amamamamamamamamaamams:ss Thee Inttttererererererererccucucucuuuucucuultltltltll uuururrurrrrrurrralalalalalalalalalalaal C C CC C C C enenenenteteteteteteteteteterr r r rrrrrrr hhohohohohohohohohohoh uuusususususususususususususussussuusuuseseesesesesesesesesesesesesseesseseseessssssesssseessssesesssscocococooococoococococooccococc ffmfmfmfmfmfmfmfmfffmfmfmfmfm ororrrororororororororororortttttatatatataattaablblbbblblbblblbb e eee spspspspsppaaaaaacccca esesesesesesesessesessesesses ff f f fff f f f f f ffffff ororororororororororororororororor mm mmmmmmmmmmmmm m mmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetitititititititititititit ngngngngngngngggggngggngngngngn s,s,s,s,s,s,s,s,s,ss,s,ss,s s s s s ssssooco ial evevevenenenene tstststt a aa aaaanndndndndnddnd p p p p ppp ppp pppror grgrrgrgrrrramamamamamsss sss ininininvovovovovooooovoovovvov lvlvlvll iniiinnininingggggg g susususususususususususususuuuuchchchchchchchchchchchcchchcc d ddd d dd d dd ddivivivvivvvvvi ererererereeerrsssssesessssssee groupppppsss sss asasasasasasasasasasas A AA AA A AA AAAA Alllllllliaiaaaaai nnnncncncnccccccncncncncncnncncncnncnncnccccccnnnce,e,e,e,e,ee,e,e,e,e,e,e,e,e,ee,,e,ee,eee,eee,eeeeeeee,,ee,,, BBBBlllBBBBBlB aacacacacacaacaaaa k k k k StSStttttSttttttudududududuududeneneneneennenennentstststststssssss A A AA A AAAAAAAsssssssssssssssococococococococococococococococociaiaiaiaiaiaaiaiaiaiaiaiaiaiaiaiatitittititittititititititititittitiononononononononononononononon, ,, ,,,, ,, , , , InInInInInInInInInIInInnnInntetetetetetetetetetetttetteteternrnrnrnrnnrnnrrrrnrr aatataaaaaaaaaaa ioionanaaaaal l l ll SSStStStStStStSStStSS ududududududduddduudeneneenennenennenne ttt t tt t tttt AAAsAsAsAsAsAsAAAAsAsA sososossosososssssociiciciciciiciiiiatatatatataatattatatattatiioioioiooioioooioiooiioionn,n,nnn,, A A AAAAAAsisisisssisisisis anannanananananananannnnaa SSS SS S Stut deddddedeeeeeeeeeeeenntntnttnttttttntntntttnn ssss s ininnnnnnn A AAAAAAshss eveveveevevevevevevevevevilille, , HHeHeHeHeHHeHHHHeHeHHHHH rmrmrrmanananananan@s@@@s@s@s@s@s@s@s@s@s@s@@s@s@s@@s@s@s@s@s@s@s@s@s@s@s@s@s@s@s@@s@s@@@s@@@s@ss@ss@@@s@@OOrOrOOOrOrOOrOOrOOOrgugugugugugulllllll ooooooosososos@@@@@ssss@@@@@ eeeeeen n n n nn LaLaLaLaLaLas s s ssssssssssss s AmAmAmAmAmAmAmAmAAmAmAmAmAmAAmAmAmererererererererererererereereerrericicicicicccicicicicicicicicicicasasasasasasasasasasasasasas (( ( (( (( ( ((( ( ( ( ( ((HOHOHOHOHOHOHOHOHOHOHOHOOHOHOHOHOHOH LALALLLALAALALALAL ))))))) anannanananananananand d ddddd d d dd d d HiHiHiHHiHiHiiHiHiHiHiHHiHiHH llllllllllllllllllllllllll elelellleeeleee . .

TTTTTThThThThThThThThThTThTTTTTTThThThThe eee eeeee SShShShShShShShShShShSShShShererererererererererrririiiriririririirilllllllllllll C CCC CCCCCCenenenenenenenene teteteteeeteteeteteeer:r:r:r:r:r:r:r:r:rr:rr WiWiWiWiWiWWWiWiWiWiWiWiWiWiWiWillllmlmlmlmlmmlmlmlmlmlma a aaaaaaa aaaa a MM.M.MMM.MMMMM.MMMMM S SSSSSSSSSSShehheheeeehheheheeehheheheherrrrrrrrrrrrrrrrrrrrrrrrrrililiiliilililiilili lllll CCCeCeC ntntntntereree i iis ththhththt eeeeeeee e unuuuunununununuuuununnniviviviviviiiviiivviviverrerererererrererer isisisiisisisisiisisisisisisisisisisityttytytytytytytytyytytyttytytyttytytytytyttytyy’s’s’s’s’’s’s’s’s’s’s’s’s’s’sssssss n nn n n nn nnnn nnn nnnnnnneweweweweweweweweweweweewewwweweeewwwesesesesesesesseseseseseeeseesessessttt tt tttt ttt aaaanaaannannd d d lalaargrgrgrgesesessssssssessssst tt t t tttt fffafafafaaaaaafaaaf cccccciiciccccccccccccciliiiitytytyty, , , oofffffffffffffffffffefefffffeeeeeffeffffefefferiirrr ngnngngngngnngngngngnggngngngngngngngngnggnggnggnggggga a rarangngngge e e ofoff a a acacacadededeeemimiimimimimic c c c c c ananananannnndd d d d d dd ouououoououtrtrtrtrtrtreaeaeaeaeaeaeachchcchchchchchhhh p p prrorogrgramams s fofocucusesed d ononononnn hhh hh h h hh heaeaeeeaaaeaeaaaaltltltltltttthyhyhyhyhyhyhyhhyhhhyhyyy lllll l l ll liviviviiviviviivvivvinininininiiinngg g gg g ggg ananananananananananananand ddddd dddd d dd weweweweweweeeweewwweww lllllllllllllllllllneneneneneneneneneneneneneessssssssssssssssssssssssssssssss pppp p p ppppp pp pppp p prororrrororororoororrrororororroroooomomomomommmmmmm titititionnnnnnnnnnnnnnnnnnnnnoo .. . ... ThThhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeeeecececececeececccccc nntntntn ererere i i iiis s s hohohomemmmemee tt ttooooo o thththhhththeeeeee e acaacacaacaca adadadadaddada ememememmemiciciciciciccic DDDDDDDepeepppararara tmttmeeeneent t fof HHHHHHH HHeaeaeaeaaltltttthh hhhh ananana d d WeWeWeWWWWWWeWWWWWeWWWW llllllllllllllllll nenenn sss, withhhhhhhhhth cclalalassssroroomomommms,ss, dddd dddededededeeedediciccciccciiicatatattttttedededddededededed ssssss s ss spapapapapapapapapapapapacececececececececececcecececceccececcececeeeeceffofoff r r unundedergrgr rar duate researchh, a hiiighghghghghg -tech tttet acachingngngnngng/ddeemmmonoonstststtrararar titiononnn kkitittttchchchchchchhchhchhhchchc eneeeenennnnnenennnnnn, , ,, , , , , ,, ,,,, ananand ddd rereeeseseseseseeeeararararararararaaaarraraaaarararraararaa chchchchhhhhhhhcch aaaaa aa aaaaandndndndndnndn lleaearnnininnngggggglalalalallal bsb .Theee S Sherrrrrriliiiiii l CeCeCeeeeeenter includededededeeeeeeeeeeeeeeessss sssssss ss sss ananna ee expxpxpxxx ananansisisiveve fififi fifi t ttnenenessssss c ccenenenennneeennntttetetetetetetetteteeerrrrr,rrrrrrr,rrr,rrrr aaa a a a b b bbioioioioiooiooioiooooioioffefefeffefefefefffffefefeeeededededededededdededeededdde bababababababababbababababbabaaaackckcckckckckkcckckkckcckkckkckckcckckcck ll l l ll l ababbababababaabababbbb a a a a a aa nnndndd mmmmmmmmmmmmmmedededdedddededdddddddddedddditiiitttitittiitttitttatatatatata ioioiooion nn rrrrrrrororrrrrrorrrrror omoomomomommomomomoomommomoooooomooooooo , , , anaananaa d tththththththhtththht eee eeeee WWWWWeWeWeWWWWWW lllllll neneneeeeessssssssssssss CCCCCCCCCCCCCCCCCCCCCCCafafafafaaafé.éééééé

KiKiKKiKK mmmmmmmmmmmmmmelelelelelelelel A A AA A AAA A AAAArererereerrrenananananana: : : : : ThThThThThThe e e ee neneneneneew w w w w KKiKKKK mmmmmmmmmmmmmmmmmmmmmeleleeleleleleleelee A A AAA A AAAAAAArerereenanana, , wwwhich isssi p pararara tttt t ofofofofofofofofofofooff t t t ttttt tthehehhehehhheh SSS hheherrrrrrr iiililll CeCeCeCeCeeCeeCentntntntnttntntntntnterererereeererr, ,, , , caccccacacacacaccccann n nnn n seseseseseesess atataatatatatataaaatat uu uuu u u upp p p ppp tottotooooooooo 3 3 33,8,8,8,8,8888,8,88888, 00000000000000000000000peopoppppppopopppleleeeleelellellelle f f f ff f ffffforororororororoor cccccc conononononncececececertrtrtrtrtr s,s,ss,s, ccc cccomomomomomommmememmmmencncncncncncnccncnccemeeememememememeemememenenenenennenennennentstststs, , , cocooc nnvvocatttioioiooonsnnn , , , leleleectctctctctttttctttctururururururururu eeseseses,, ,, , ,, iinininiiii teteetercrcrcr oloolleeelelegigiggiiig ataatatatatatatataaaattaa e e e eeee e ee e mememememmememeememenn’n’n’n’nnnnnn s ss s sss ananananananannndd dd d ddd wowowowowwowwww mememmememeeen’n’n’n’nnn’nn s s ss ss bababbabbabababababababbbaabaassss-----s-sss-ssketbbbbbbbbbbalalalalaalalallaa l lll l l l ll gagagagagagagagagagggagamememmememeemmmes,s,s,s,sss h h hh h heaeaeaeaeaealtltltltltlth h h h h h fafafafafaf iriririririrs,s,sss,s a aa andndddddddd c c c c c c cc cc cccccomomomoomomomomomomomomo mmmmumumumummmmm nininityyytty eeeeventtts..s.AsAAshehehevvvvviviiiillllllllle e eee ee e e e cocooocoooocococooommmmmmmmmmmmmm unu ity.

Page 81: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

79/// F E A R T H E D O G ///

KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAAAsAsAsAAAsAAsAAssssheheheheheheheheehehehheeeeeheheheeeeeevivivvvivivivivivivivivvivivviv lllllllllllllllllle ee eee e eeee ofofofofofofofooooffffo fefefefefefefefeffeeeeeeeeeeeeeeeefersrsrrrrrsrsrssrsrssrrrrsrssrssrssrsr a a a a aaaaaaaaaaaaaa ““““““““““ ““ttotototototttotottooooot p-p-p-p-p-p-p-p-pppp nononononononnonoononononooonotctctctttctctttttccttcctt hhh h hhhhhhhh hh acacacacaccacacacacacaacaaaa adadadadaddadadadaddadadaddadddda ememememememememeememememeemeememememmmmicicicicicicccicicccccicici e e e ee ee xpxpxpxpxpxpxpxpxpxxxppxxpxxpxppxppeerereeeereerereereeeerrre ieieieieieeeeiei ncncnnccccccncncnccnn eee,e,e,e,eeeeeee,,,, ”” ””” ””””” anananananananananananananana d,ddd,d,d,dddddd,ddddd,d,d,d,d,d,d,dddddd b bbb b b bbbb bbbasaasasasasasaaaa edededededededededededeeeeddeeedee o oooooo oo ooon nnnnnn n nnn nnnnn sstststststststststsststsssssttudududududududududdududuuuuuuuddenenenenenenenneneeneneeennnnennennnnnntttt t t ttttt tttttt t ttt ssususususussssss rvrvrr eyeyyyeyyyyyyyyyyyyyy r rrrrrrrrrrrrreseseeseseeseeeee popopopopopoppppppp nsnsnssn esesesesesesssesssssss, , , , , ,,,,,,AsAsAsAsAAsAsAsAsAAsAsAsAsAsAAsAsAssssAshehehehheheheheeeehehheehehehehevivivivivivivivvivivivivvvivvvvillllllllllllllllllllleeeee eee eeeeeee e isisisisiisisisississss rr r r rrrrrrr rananannanananannanaaananaanaanaaaankekekekekekekekekekekekekeekekekekeekeeedddddddd dddd dddd d d d 111111111111111111111111111111thtthththththththtththththththhththttttttttt i ii ii iiii nnnnnnnnnnnnn nnn n ththththththththththththhththhthththttt eeeeeee ee nanaaaatitititttiititittitiitititt onn o on n ththee “c“colollelegege c citty y gegetss hhigighh mamarkrks” lisst. - TThehe PPrir ncncetetonon R Re-e-viviviviv ewewewewewwewwwwwwwwwwwwwwww’s’ss’ssssss’sssssss ““““““ “ “ ThThThThThThThTTheeee ee e e e BeBeBBeBeBeeeeBeBeBeBBeeeBBBeB ststststststttsststststststtstststttstssts 3 33 3 3 3 333 333333337777777777777777777777777777777777777777 C C C CC C C C CC CC CCColololololooolollooololoooololollelelelegegegegegggggggggggg ss s - 2022020201313131333 E EE E dididititititittiononononn”” (A(A(A(AA(((((((((((( ugugugguguggggggggggggusususussu ttt tt tt 20202020202201212121222)))))))))))))

UNUNUNUNUNUNNNUNUNUNUUNUNU C CC CCCCCCC AsAsAsAsAsAsAAsAsAsAsAsAsAsAAssshehehehhheehehheeeheheeheviviviviviviivivivvvvvv lllllllllllllllleee e e eeee rarararararararrrarrrarar knknknknknknknkkknknknkknknkkknnkkkkedededededededddeee 2 2 222222 2 222221st in the nnnaataa ion n as aaa “BeBB sts Buy C C Colololololleeeegegegegeg ,” based on n quququalalitty y ofofo teaeaching, carareeeerr prprprprprprrrprprrpppppp osososososospepepepepepeeeeepp ctctcttttctcccccccccccccc ss,s,s,s,s,ssss,ss, g g ggg ggggg grararrararaaaaaararaarrar duddududududududududududududududduuuuataatatattattaatataaaaaaa iiiioioioiooiiioioi n n n nn nnn rrrraaaararaaaaatett s,s and sstututudedededed ntn debebe t leveel..Off theeehe e e igigiggghththhththhh u niiveerssititieies s inin N NNoororthth C CCararolo inina a a aa a aa ththhththththththththththtththatataatttataatattatatattt mmamamamamamamamamamaammamaamm dededeedeededeedededdd ttttttttttttt ttthehhhehheeeeeheheheehehehhheeheehehhee ll llllll llllisissssssssississsissssisssst,t,t,t,t,t,t,ttt,tt,t,tt,t,tt,ttt oo o o o ooooooonlnnnlnlnlnlnnlnlnlnlnlnlnlllllln yyyy yyy y y yyyyy y yyy y yy yyy UNUNUNUNUNUNNUNNUUNUNUNUNNUNNCCCCCCCC-C-CCCCC-ChChChapapappelll H Hilll,l, aat 13313133tht , , raraaaaanknknknknkeded higigheher r thhthhananaa U UUNCNCNNN AAshheveve ilillele. . RaRaRanknkininngsgsgs p prerereeeepapapapapapapapapapaaap rerererererreerererererrrred d d dddd d ddd dd dddd bybybybybybybybybybybybbyybybybybyy thththththththhthhttt eeee e eee CeCeCeCeCeCeCeCeCeCeCeeeeeCeeeeeeentnntntntntntnnnnnnnnnnn erererrrrrerrrrr fff fffffff fffff oroorooorororrrrororroroorororoooo CCCCCCCCC CCCCCCCCCCCCoooolololololooloooo leeeeeleleeleegegegeggegeegege AAAAAAAAAffffffffffffffffffffffffororororororororororororrorrrdadadadadadadadadadadadaddadadadaabibibibibibibiiibiiilililililillllllllll tytytytyttytytytytytytytytytyttyy a a a a a a a aaaaaandndndddndndndndndnddnndndndn PPP PP PPPPP PPPPPPPPPPrororororororororororoorooooorodudududududududdududududududududduuuuctctctctctctctccctcttcttttcc iviviviviviviviviivivivivivvvi itittttttty.y.y.y.y.y.y.y.y.y.yyyy.yyyyy. - --- - - F FF Forororororoororororororroorroro bebebebebebebebebebebebebebebbbeb s ss s ssss s s ss MaMaMaMaMaMaMaMaaMaMMaMaMaaMaMaMaaM gagaagagagagagagagagagagagagaggagaggaaazizizizziineneneneneneneneenenenee ( ( ( ((( ( (( (((AuAuAAuAuAuAuAAuAuAuuuuAAuuAA guguguguguguguguuguguguuguguustststsstststssss 2 2 2 2 222 22222010101000100000000 2)2)2222222222222

“U“U“U““U“U“U“U“U“U“U“U“U““U“U““U“UU“U“U“U“U“UUUUNNNCNNCCNCNNNCNNNNCNCNNCCCNNCNCNNN A AA AAAAAAA A AAAAAshshshshshshsshsshshshsshshs evevevevevvvvvvveveeevvvvvviiilililililililililiiiillllii leleleleleeeeeeeleleeee aa a aaaaaaaaaaa aaaaandndndndndndndndndndndndndnndndndndnnndn ttttt tttttttthehhheheheheeeeehhehhheehee c cccccccititititittitity yyyyyyy ofofofofofffofoofoffoff A AAA AAAAAAAAAA Ashshshhshshhhhhhhshshhheveveveeeeveevevevevee ililililillililllillelelelelelelleeele aaaaa a arererererreererere sssss s steteeteteeeeteeteteeeepepepepeepepepepepepeppeppe ededddededededeededdedd iiiii i innnnn n nn whwhititewewwatata ererer c ccululultututurerer m mororore ee ththanan a anynyyywhwhwhwhwhwhwhwhwhwhwhwwhwhwhwhwhw eerererererereereee e e e eeeeeeeeeee elelelelelelleleleleleele sesesese ininininininnnnninnninninnnn tt t t ttttttheheheheheheheheheheheheheheehhheeeeheh www ww w worororororororo ldlldldlddddddlldldldlldldlddddddldddlddd.................. . AsAAsAsAsAsAsAsAAsAAAsAAAsAAss didididdidididididdididdddididdiddiddiii e eeeeeee fffrfrffrfrfffffrfrfrffffrffffff ooooooomomomomomoooo t theeheirir l llonononoong g g g lilil ststttt oof f fi rsrst t dedeeeescscs enentsts a andddndnd r racace ee iiiwiwiwiw nsnsnsss, , UNUNUNUNUNUUNNCCCCCC C AAsAsAsAAAsAAsAAshehehehhhehehehevivivvvvvvvv lll e e alalalalalallalalalalaalalla umummummumummumummu s ss s ssssss ss sss anananananananannndddddd d dddprprppprprprppp ofoffesesee sosorsrs a aaaaaaaaaaaaaaaaaalslslslslsslslsoooo o ooooooooo gigiiigivevvevvveveevvvv b baaaaaccacacaccccccaaack kk k toto ttttheheh p padadddldldldlininii g ggg cocommmmmmmm ununititty.yyy.”-”---”- “““ ““HHHoH nnonon r r RoRollll: : ThThhe e BeBeeB stst O Oututu dododooror SSchchooooooooooolslslslslslslsllsslsl i ii ii i i ii i i iiiiinnnnnnnn n n n n nnnn ththththththththththhhththhe ee ee e e eeeeeeeeeBlBlueueueueueeue RRididgege,”,”””””””””””””” B B B B Blllluullllllll e e RiRidgdgggggee eeeeeeeeeeee e OuOuOuOuOOOOOOuOOuOOOOOO tdtdtdttdttdttdooooooooooorsrsr ( ( (((((AuAuA gugugugggggggggggg stst 2 2 222010100112)2)

UNUNUUUU C C AsA hehevvvvivviviviviiivvvivvvivvvvvv lllllllllllllleeeeee eeeeeeeeeeeee isisisisisissisisiisisisssissiissssssss “““““““““““““ ononononnonoooononooonnnnnnnnonoonoo eeeeeee ee e ofofofofofofofofofofofooffoofofoofoooo tttttttttttt t ttthehehehehehhehehehehhehehhehheeheehhe bbbb b bbbbbbbb eseeseseseseseesesessseseseesssessssttt t t t ttt t tt t edededededeeedeeee ucucucucatatioiooonanan ll babargrgaiainsns i inn ththe e cocoununtrtry.y.” ” FoForr nininene c cononononoononononononoonooononnnnnno seseessesesesecucucucucucuccuutiiitiiiititititititiiit veveveveveveveee y yyy y yyeaeaeaaaeearsrssssrsrsrsrs,, ,UNUNC C AsAshehevivillllllllllllllllllllllleeeee’e’e’’e’eee’eeee’eeeeeeee s s sssss ss ss EnEnEnEnEEnnEnnvivivivivivviviviv roroorororooonmnmmnmnmnnmn enenenennentatataatatallll StStSStStttStStudududuuduuuduuuu ieieieieeees s s s ss ss s PPrPrPrPrPrPPPrrP ogogogogogogoggrarararararararaaam mm mmmmmmmm hhhahhhahhhhahahhhhhahahaas s s ssssss bebebeebebebebebebebeeebebebeebebebeeeenenenneeneneneneeenene nnnnnnnnnnn nnnn nnnnnnnamamammamamamamamaamamammmmmamamamammeddedededededeedededeeededededded ttttttttt tt tttt ttooo ooo oo o ooo o oo ththththththththththththththththhthheeeee eeee eeeeeeeeeeeee lililililliistststststststststttttttttt ooo oo o o oo of ff ff prprppppp e-e-prprofofofoffoffffffofffffffffffffo eeseseseseseseseesseeeeeee sisisisisisisiononononoononnno alalaalaalaall ppp p ppprorororrororrororo--grgramams s wiwithth u unuuuunususususssusususususususuususuuualalallaaalalaalallalalalalaala ssssss ssstrrtrtrtrtrtrtrttrtrtrtrtrtrtrtrtrrrrreneenenennnenenenennnnnenenenne gtgtgtgtgggtgtgtggttgtgthhhhhhhhhhhhhhhhh h ininninininiiinininininninnnnnn p ppp p pppppp p p p prerererererererereeereeeeeepapapapapapapapapapapapapapapapapap ririririririririririririrrririrrringngngngngngngnggngngngngnnggngngngnnnggn sssssssssss s ssss sstutututututtututtuutututuutututuututudedededeededeeedededededeeeeedeentntntntntnnttntntnttntntnnntnn sssssssssss s ss fofofofofoffofofoofofff r r rrr rr cacacacacaaccaccaarererererererereererererereerrs.s.sss. - -- - T TTTT TTThehehehehhehehh F F FFFFFFFFFFisisisisisisisssskekekekekkekkkekeke G GGGGuiuuiuuu dedddedeededeee t t tttt ttt to o oooo CCoCoCCCCCoCoCoCCoolllllllllllllllll egegegegegegeggegeegegeggesesesesssesesessesseses, 20202020202020020202001313333 EdEditioi n n (J(Jululy y 20012122)))

UNNC C AsAshevillee is listed amamong AmA erica’s “green” ccollllegeges aandnd uuniniversrsittiees.s - TThehe PPririncncettonon RRevevieiew’w’ss ““G“Guide to 3222 Grreeenn Colllegegese for 2012” (April 2020112))

UUNC Asheevivillllee is among jjusu t 75 iinsn titutions nationwiw dee nnoteded aas s a a “B“Beest VaV lue”e” p pubublic coollegge. - TThee PPrinceton Reevieww’s’s “20011 BBest Value CoC lleges” (Februuarry y 22012)

UUNC Asheevville e isis o onene o of f ththe e nanatitionon’s’s 5 0 bebest values inn ppppppp bubububbblililic cccc coollllegggggess, , iwithth t thehe fi fif fththhhh l lowowowowowesestt tototatall cost of f faattendinnnnnnnngg gg g g gggg pepepepepepepepp rrr rrr yeyeyeyeyyeyy arararararara , , ,,,,, annananananddddd d thththththeee eeee eieieighghghgg ththth ll lowowowesesest t t t avavavavererereragagagagaggggee e e e dededededd btbttbttbt a aa a amomomomooomomomomonnngngnngngnggg g gg ggrrarar duduatatatatateses. . -- Kiplppppp inininnii gegeer’’s ss s PePP rsrsrssr onalalalal F Financee MMagazinene ( ( (((((((JaJaJJaJaanunuuuunun arararararra yyyy y y yyy 2022020202022202020121222212122212))))))

UNUNUNUNUNUUNUNNC C C CCCCCCCC AsAsAsAsAsAsAsAsAsAsAshehehehehehheeheh viviviviviv lllllllllllee e e ee rarararaaaarararraanknknknknknkkkknkkkssssss ss eeeiiiieeieighghhghghhhhhhghghgg tththththththhhthth i i in nnn ththttthtththeeeee e ee nanananananananann titititititititittt ononoooonnooono a aaaa aaa aamomomomomomomoomm ngngngngng PPPPubububbblililil ccc c c LiLiLiLLLiLiLiLLL beebeebeeeeebbbb raalll l AAArrrrtstststststststs C CCCCCCCCCC ooooololoololo lleeeeeleleegegegegegeeegeg s,s,s,s,s,s,s,s, aa nnndnnnndndnd i i issss ss ss tththhhhhhhe eeeeeee oononono lyyyyy N N NN NNorrth CaCaCaCaCaCaCaCaCaCaCaarororrororororororororor lililiililiililinananannanaaaanana ii iiiiinsnsnsnsnssnsnsn tititttitiitttitittit tutututuuuuuutt titititittititionononnnnnononnnnnoonon lllll lll ll isisisiiisiisi tetetettteetttt ddd d ddd d ddd aaamamamamamaaamononononnnonnnnongg g gggg NaNaNaNNNNaNNNaNaN ttitititttiiiononononooo alalalla L L L LLibibibibbbibibbererererererererereraalalalaaaa AAAA AArtrtrtrttsss ssss CoCoCoCoCoCoCoCCoColllll egegegegeseeseseseeses whooooooooooseseseseesesesse ssssssstutututuuuututut denntttttttsss s s ggrrrrrgrrrrgg aaaaadddaddddduauauauauauauau tteteete wwwwwwittttti h hhh h ththththththttht e eeeeeeleleeeleleeeeeasasaaaaasaaasasasasastt ttt t t t ttt t tttt amamamamamamammmaaamamaamououououououountntnttntntnn ooooooof fff ff dedededededededdd btbtbbtbtbtbbtbtt. .. - - - U.U.U.UUUUUU S.S.S.S.SSSS. N NN NNNNewewewwws ss & &&&&&&&& & WoWWoWoWoWoWorlrlrlrrlrr d d dddddddd ReReReReReReReReReR popopopopopooorrrtrtrtrtrtttrtrr ’ssss’s’’s’’s’s’ “““AmAAmAmAmAmmmmAmmeeeeere ica’s Best Colleges” ((SeSeptpteemmmmmbebebebebebeb rrrr 2000000011111111111))))))))

UNUNUNUNUNNNNNNNNC C C C C AsAsAsAsAsAsAsAsAssAsAsAsssAsA hehehhehehehheheheheehehheeeevivivivivvvivvivvivivivillllllllllllllllllle ee eee iiiiiiisisisisis o oo o onenenneneenenneeeee ooooo oo ooooffffff fff ff f AAAAAmAmAmAmAmAmAmAmAmAmAmerererererrerreriiiiiiciccic ’’’’’’’a’’a’aaa sss ss “1“1“1“1““1“1“1“1“1110000 000 0000 0000 BBBBeBeBeBeBeBeBeBeBeBeBe tststststststtstststss CCC C CCCCCCCCCCCCCC lllolololoololololoolololo lllleleleeeeleelelelleegegegegeggegegegegegegeegegges ss s s fofoof r r hthhhthe e e MoMMoMooMMoMooMoonnneneeeeenen y.y.y.yyyyy.yyyyy”””” ” ---- - BaBaBaBaBaaaBaBaBaBaBBBaBaBaaBanknknknknkknknnnknknknnknknnkrarararararararr teteeeeteteteteeteee.cccccc.cc.ccc.c.c.comomomommmmommmmomm, a aaaaa lelelll adadadadadaddadadddddinininnnininggg gggg g g g gg g g gggg gg ooononononononoonnlilililililineeneneneenene sosososoosoososourururuururuuururururururrrrururrurrcecececcececececcecceccececececececececeececececcecee o ooo oo o o o oo o offffff f f fff ff f fifififi fi fifi fifi fi fifififi fi fi fifififififinananananananananananannannanananannnanaaaancncncncnncncncncncncncnnncnnn iaiaiaiaaiaiaaiaiaaaaaaial ll ll ll llllllll ininninnnfofofooofooooooooooormrrmrmrmrmrmmmmrmrrmmmrmmmmmrr atatatattatataataaaatatattattataaa iooioioooiooooioioioooioiooooi nnnn nn nnn nnnnnnn (J(J((J(J(J((J(J(J(((J(J(J(J(Junununnnnunnuunununnnunnununneeee e eee e eeeee e eee 20202020202020202202020202002220222201111111111111111111111))))))))))))))))

AdAdAdAdAdAdAdAdAdAdAdAdmimimimimimimimmmmimmimimmimmiisssssssssssssssssssssssssss ioioioioioioioioioiiioioioiooioioooonsnsnsnsnnnsnnssnnsnnnssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshssssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 1111009000909090090909009009090999990-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 1211122212222221111221212121221221121250500505050500050500505000505050550050505555555050000 ( (((((( ( ((((( ((( (((FFFFaFaaFFaFFFaFaFaFaaFaFaFaaFaFaaaaallllllllllllllllllllllllllllllllllllllllll 2222222222 2 2 22222 2 222222 010100101101010101010100110100010101010100101011010110110 1)1)1)111)1)))1)111))1))))111)1))1)1

AnAAAAAAAnAAnAAAnAnAnAnAnAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $5$5$5$55$ ,3,33,3,333333,333333333333393933939393939939939939999939999 (((((( ( ((((((( (((((202020202020202020202020202222222 11111111111111111111111--1111-1-1-1-1-1-1-1-- 2)2)2)2)22))))22)2)2))

AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 9999999999,9999999999,9,00020202022002002020020200020202020200020022000002222202202000020255555555555 5555 5 555555555 (((2(2(2(2(2(2(2(2(2001010111111-1-1-1-11-11-11 122212122222222222))))))))))))) ))) )

AvAAAAAvererererererraaggggagagagagaaaagagagggee e eeee e AAnAnAnAnnununununnnnnn alalalalallllllllll HHHHHHHHH ououuusisisisiingngngng a aaaaaa anndnddddddndddddddnddndndnddd MMM MMMMMMMMMMMMMMM MM MMMMM Meaeaaaeaeaeaaeaaaeaeaeaaaeaeaeallllllll l llll PlPlPlPlPlPlPPPPPP ananan FFFFFFFFFFFFeeeeeeeeeeeeeeeeeeeees:s:s:s: $$$$ $$$$$$$$$$ $$ $$$$7,7,7,7,30330303 222 2 2 2 (2(2(222(22(222(2222(22222(( 0000001011010000 1-11111 1212121221222) )

FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvviviivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fi finannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..

Page 82: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

80 /// F E A R T H E D O G ///

Dr. Anne Ponder became the sixth Chancellor of the University of North Carolina at Asheville in October 2005. She began her tenure by leading a campuswide collaboration to create a dynamic and viable fi ve- to seven-year strategic plan and revised mission statement.

With this focus, UNC Asheville has made major strides as a national leader in the liberal arts and has become a one of the top choices for students seeking a rigorous and multi-faceted educational experience.

During her tenure, the university was chosen as the fi rst national headquarters for the Council of Public Liberal Arts Col-leges and several majors in Religious Studies and Anthropology have been added to the curriculum. Dr. Ponder has encouraged innovative collaboration that resulted in a UNC-Chapel Hill satellite pharmacy education program. Building new partnerships with local governments, scientifi c agencies and non-profi t organizations have resulted in agreements with Mission Hospital Sys-tems, the City of Asheville, the Renaissance Computing Institute and others for enhanced learning and research opportunities for students and faculty. This emphasis on collaboration, one of Chancellor Ponder’s hallmark traits, also led to the cultivation, with other campus and community leaders, of some of the largest multi-million donations in the university’s history.

Chancellor Ponder oversaw the largest building projects in UNC Asheville’s history, including New Hall classroom building; Sam Millar Facilities Management Complex; Zeis Science and Multimedia Building; and the Wilma M. Sherrill Center, which houses the North Carolina Center for Health & Wellness and the Kimmel Arena. In each of these projects, environmental sustainability has been a key feature, as dictated by the university’s strategic plan. These green efforts – combined with countless others across campus – have earned the university a host of awards, including repeated recognition as one of the lowest energy consuming agencies in the state.

A strong advocate for community service, Dr. Ponder is a member of the Mission Hospitals Audit Committee, the Asheville Community and Economic Development Alliance, the Children’s Welfare League and the WNC Community Foundation’s Women for Women. She also is a board member for the non-profi t Kendal Corporation.

Before becoming Chancellor at UNC Asheville, Dr. Ponder served for 10 years as president of Colby-Sawyer College, a private liberal arts col-lege in New Hampshire. Prior to that appointment, she held teaching and administrative posts at Elon College (now Elon University), Guilford Col-lege and Kenyon College.

Chancellor Ponder, who holds a doctorate in English from UNC-Cha-pel Hill, is a nationally known expert on institutional effectiveness, stra-tegic planning, and fundraising and resource development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education and wrote the chapter on strategic planning in the American Council on Education’s book “Leading America’s Branch Campuses.”

A native of Asheville, Chancellor Ponder is the daughter of the late Eleanor and Herschel Ponder, both of whom trace their Asheville family roots to the 1780s. She is married to award-winning writer and publisher Christopher Brookhouse.

DR. ANNE PONDERCHANCELLOR - UNC ASHEVILLE

Page 83: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

81/// F E A R T H E D O G ///

Janet R. Cone is in her ninth year as Director of Athletics at UNC Asheville. She also serves the school as Senior Administrator for University Enterprises. This past year was highlighted by the men’s basketball team’s winning the Big South Conference championship for the second year in a row. The Bulldogs set a school record for conference and overall wins. Asheville advanced to the NCAA Tournament where it nearly pulled off one of the greatest upsets in NCAA history when the 16th-seeded Bulldogs lost a close game to top-seeded Syracuse. In addition, the school successfully hosted the Big South Conference men’s basketball tournament with a national television audience and sellout crowd watching the championship game in the school’s brand-new Kimmel Arena. Cone oversaw the successful opening of the Wilma Sherrill Center which houses the Kimmel Arena. She worked to bring the top-ranked UNC Chapel Hill men’s basketball team to open Kimmel against the Bulldogs in a game that was nationally televised. That game was also sold out. The Sherrill Center had more than 100,000 visitors the past year as its hosted various events

from concerts to graduation.

Other successes included the men’s tennis team’s fi nishing in second place in the Big South Conference, its highest league fi nish ever, the volleyball team’s advancing to the semifi nals of the Big South Tournament for the eighth time in the last nine years, and the women’s tennis, men’s tennis and women’s track and fi eld teams being honored for their work in the classroom.

Cone guided the athletic department through a successful certifi cation process by the NCAA. In addition, she brought back women’s swimming as a varsity sport for the fi rst time in more than 35 years.

In the 2010-11 year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.

Three years ago, Chancellor Anne Ponder appointed Cone to the position of Senior Administrator for University Enterprises. In this position, Cone oversees the Sherrill Center, manages specifi c community relationships and serves as a member of UNC Asheville’s major gifts team. She is a member of the Chancellor’s Senior Staff.

In 2009, Cone helped to create the Asheville Buncombe Regional Sports Commission to bring athletic events to the Asheville area. Her leadership helped secure the return of the Southern Conference men’s and women’s basketball tournament to Asheville in March 2012.

Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club which recognizes student-athletes who make a 3.0 or better grade point average each semester. More than 900 student-athletes have made the club during Cone’s nine years, and in 2009-10, a record number of student-athletes earned that distinction.

During that same time period, more than 800 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes earned this impressive academic distinction.

Cone has overseen construction projects that have dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center/Kimmel Arena was completed in the spring of 2011. Funded partly through a $35 million state appropriation, Cone helped raise more than $ 7 million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation, attract major speakers and performances, and have a new home for the men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that were completed in the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past three seasons, and this past spring hosted the Big South Conference men’s and women’s tennis championships for the fi rst time in school history.

JANET R. CONEDIRECTOR OF ATHLETICS • SENIOR ADMINISTRATOR FOR UNIVERSITY ENTERPRISES

Page 84: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

82 /// F E A R T H E D O G ///

Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi t from each and every day.”

In 2006-07, three different UNC Asheville teams won Big South Conference championships and advanced to the NCAA Tournament. In May 2006, the baseball team completed an amazing run with its fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against topseed UNC Chapel Hill in the College Cup. In March 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.

The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics website, and the implementation of internet broadcasts and video-streaming for six different sports.

Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September 2008, she began a four-year term on the NCAA Division I Leadership Council.

Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.

In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.

Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.

Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach beginning in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.

Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.

Cone was born and raised in Summerville, S.C. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame in 2007. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.

A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.

Page 85: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

83/// F E A R T H E D O G ///

TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS SENIOR WOMEN’S ADMINISTRATOR

Terri Brne is in her seventh year of service to the UNC Asheville Athletics Department. She serves as Associate Director of Athletics for Internal Affairs and as Director of Compliance and Sport Oversight. She joined the UNC Asheville Athletic Department in the fall of 2006. In the summer of 2011, Terri became the school’s Senior Woman Administrator. Brne is responsible for the interpretation of rules by the NCAA and Big South Conference and is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. Brne serves as the Game Administrator for men’s and women’s basketball. Terri also oversees men’s and women’s soccer plus baseball and assists with men’s and women’s basketball. In addition, she works with the Big South Conference whenever UNC Asheville hosts a league tournament. This past year saw Brne help the athletic department pass its NCAA certifi cation and host both the men’s basketball and men’s and women’s tennis Big South tournaments. The Illinois native was an assistant basketball coach at both South Dakota and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance for all sports. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her masters’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.

MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS FOR EXTERNAL AFFAIRS

Mike Gore is in his 27th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.

UNC ASHEVILLE SUPPORT STAFF

Page 86: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

84 /// F E A R T H E D O G ///

Judith BohanBusiness Manager

James WestfallAssistant

Athletic Trainer, ATC

Harmon TurnerTicket Manager

Tim WhiteHead

Athletic Trainer, ATC

Lydee BenoitAssistant Volleyball

Coach

Mary CaseyAssistant Women’s

Soccer Coach

Dr. Herman HoltFaculty AthleticsRepresentative

Rebecca Nelms-KeilDirector of Student

Athlete Affairs

Erin Punter-SpenceDirector of Marketing

and Promotions

Matt PellegrinDirector of Athletics

Media Communications

ASHEVILLE SUPPORT STAFF

Eric LinnellAssistant

Athletic Trainer, ATC

Brett CareyAssistant Men’s

Basketball Coach

Aaron SandersDirector of Bulldog Athletic Association

Joe Burnette Assistant Men’sSoccer Coach

Tom HandAssistant

Tennis Coach

Janell CraytonAssistant Women’s Basketball Coach

Russ GardinerAssistant Women’sBasketball Coach

Nick McDevittAssistant Men’s

Basketball Coach

Joel WilliamsAssistant Track & Field

Coach

Adam PuettAssistant Cross Country Coach

Honey BrownAssistant Women’sBasketball Coach

Donna PeekAdministrative

Assistant

Brady BurreshDirector of Facilities

Jim WallaceAssistant

Athletic Trainer, ATC

Omar AhmadHead Strength &

Conditioning Coach

Page 87: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

85/// F E A R T H E D O G ///

Brenda Mock KirkpatrickWomen’s Basketball

1st year as head coach

Michele DemkoWomen’s Soccer

3rd year as head coach

Matt KernMen’s Soccer

3rd year as head coach

Tom SmithBaseball

4th year as head coach

Jesse NormanCross Country/Track

6th year as head coach

Elizabeth LykinsWomen’s Swimming

1st year as head coach

Lise GregoryTennis

6th year as head coach

Eddie BiedenbachMen’s Basketball

17th Year as head coach

Frederico SantosVolleyball

2nd year as head coach

UNC ASHEVILLE HEAD COACHES

Page 88: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

86 /// F E A R T H E D O G ///

Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.

In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.

The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.

In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.

In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.

UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.

1990-2003

2004-Present

ROCKY

Page 89: 2013 UNC Asheville Baseball Media Guide

/// UNC ASHEVILLE BULLDOGS ///

87/// F E A R T H E D O G ///

Important NCAA Terms

A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):

(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)

Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.

Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.

Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.

Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.

Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.

Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.

Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.

Frequently Asked Questions

What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.

What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.

Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.

What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.

This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.

THE NCAA

Page 90: 2013 UNC Asheville Baseball Media Guide

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

88 /// F E A R T H E D O G ///

For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:

Champions in Athletics, Leaders in Life.

For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics

Justice Center, CPO #2600One University Heights

Asheville, NC 28804Phone: (828) 251-6459

Fax: (828) 251-6386www.uncabulldogs.com

“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”

--Rich Davis ’93, Jan Davis Tire Store

“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”

--Pat Britz ’90; former men’s soccer player

BULLDOG ATHLETICS ASSOCIATION

Page 91: 2013 UNC Asheville Baseball Media Guide

DEAN ROLANDDEAN ROLANDROBERT McINTOSHROBERT McINTOSH

ELI MILLERELI MILLERTOMMY HOUMARDTOMMY HOUMARD

Page 92: 2013 UNC Asheville Baseball Media Guide

2013 SCHEDULE2013 SCHEDULEDate Opponent Location TimeDate Opponent Location TimeFeb. 15 Kentucky (Woff ord)^ Spartanburg, S.C. NoonFeb. 15 Kentucky (Woff ord)^ Spartanburg, S.C. NoonFeb. 16 Georgetown (USC Upstate)^ Spartanburg, S.C. NoonFeb. 16 Georgetown (USC Upstate)^ Spartanburg, S.C. NoonFeb. 17 Woff ord^ Spartanburg, S.C. 4 p.m.Feb. 17 Woff ord^ Spartanburg, S.C. 4 p.m.Feb. 19 UNC Greensboro Greensboro, N.C. 4 p.m.Feb. 19 UNC Greensboro Greensboro, N.C. 4 p.m.Feb. 22 Canisius Greenwood Field 3 p.m.Feb. 22 Canisius Greenwood Field 3 p.m.Feb. 23 Canisius (DH) Greenwood Field NoonFeb. 23 Canisius (DH) Greenwood Field NoonFeb. 24 Canisius Greenwood Field 1 p.m.Feb. 24 Canisius Greenwood Field 1 p.m.Feb. 26 The Citadel Charleston, S.C. 3 p.m.Feb. 26 The Citadel Charleston, S.C. 3 p.m.March 1 VCU+ Charleston, S.C. NoonMarch 1 VCU+ Charleston, S.C. NoonMarch 2 Pittsburgh+ Charleston, S.C. NoonMarch 2 Pittsburgh+ Charleston, S.C. NoonMarch 3 The Citadel+ Charleston, S.C. 2:30 p.m.March 3 The Citadel+ Charleston, S.C. 2:30 p.m.March 5 Georgia State Atlanta, Ga. 3 p.m.March 5 Georgia State Atlanta, Ga. 3 p.m.March 6 Georgia State Atlanta, Ga. 3 p.m.March 6 Georgia State Atlanta, Ga. 3 p.m.March 8 Temple Greenwood Field 3 p.m.March 8 Temple Greenwood Field 3 p.m.March 9 Temple Greenwood Field 2 p.m.March 9 Temple Greenwood Field 2 p.m.March 10 Temple Greenwood Field 1 p.m.March 10 Temple Greenwood Field 1 p.m.March 13 ETSU Greenwood Field 3 p.m.March 13 ETSU Greenwood Field 3 p.m.March 15 Longwood* Farmville, Va. 6 p.m.March 15 Longwood* Farmville, Va. 6 p.m.March 16 Longwood* Farmville, Va. 4 p.m.March 16 Longwood* Farmville, Va. 4 p.m.March 17 Longwood* Farmville, Va. 1 p.m.March 17 Longwood* Farmville, Va. 1 p.m.March 20 USC Upstate Spartanburg, S.C. 6 p.m.March 20 USC Upstate Spartanburg, S.C. 6 p.m.March 22 Campbell* Greenwood Field 3 p.m.March 22 Campbell* Greenwood Field 3 p.m.March 23 Campbell* Greenwood Field 2 p.m.March 23 Campbell* Greenwood Field 2 p.m.March 24 Campbell* Greenwood Field 1 p.m.March 24 Campbell* Greenwood Field 1 p.m.March 26 Appalachian State Boone, N.C. 3 p.m.March 26 Appalachian State Boone, N.C. 3 p.m.March 29 Charleston Southern Charleston, S.C. 2 p.m.March 29 Charleston Southern Charleston, S.C. 2 p.m.March 30 Charleston Southern (DH) Charleston, S.C. 11:30 a.m.March 30 Charleston Southern (DH) Charleston, S.C. 11:30 a.m.April 2 Western Carolina Cullowhee, N.C. 5 p.m.April 2 Western Carolina Cullowhee, N.C. 5 p.m.April 3 Western Carolina McCormick Field 6 p.m.April 3 Western Carolina McCormick Field 6 p.m.

Date Opponent Location TimeDate Opponent Location TimeApril 5 Charlotte Charlotte, N.C. 6 p.m.April 5 Charlotte Charlotte, N.C. 6 p.m.April 6 Charlotte Charlotte, N.C. 2 p.m.April 6 Charlotte Charlotte, N.C. 2 p.m.April 7 Charlotte Charlotte, N.C. NoonApril 7 Charlotte Charlotte, N.C. NoonApril 9 Appalachian State McCormick Field 6 p.m.April 9 Appalachian State McCormick Field 6 p.m.April 10 Woff ord Spartanburg, S.C. 7 p.m.April 10 Woff ord Spartanburg, S.C. 7 p.m.April 12 Presbyterian College* Greenwood Field 3 p.m.April 12 Presbyterian College* Greenwood Field 3 p.m.April 13 Presbyterian College* Greenwood Field 2 p.m.April 13 Presbyterian College* Greenwood Field 2 p.m.April 14 Presbyterian College* Greenwood Field 1 p.m.April 14 Presbyterian College* Greenwood Field 1 p.m.April 16 USC Upstate Greenwood Field 4 p.m.April 16 USC Upstate Greenwood Field 4 p.m.April 19 High Point* Greenwood Field 3 p.m.April 19 High Point* Greenwood Field 3 p.m.April 20 High Point* Greenwood Field 2 p.m.April 20 High Point* Greenwood Field 2 p.m.April 21 High Point* Greenwood Field 1 p.m.April 21 High Point* Greenwood Field 1 p.m.April 24 Woff ord Greenwood Field 4 p.m.April 24 Woff ord Greenwood Field 4 p.m.April 26 Gardner-Webb* Boiling Springs, N.C. 6 p.m.April 26 Gardner-Webb* Boiling Springs, N.C. 6 p.m.April 27 Gardner-Webb* Boiling Springs, N.C. 2 p.m.April 27 Gardner-Webb* Boiling Springs, N.C. 2 p.m.April 28 Gardner-Webb* Boiling Springs, N.C. 2 p.m.April 28 Gardner-Webb* Boiling Springs, N.C. 2 p.m.May 8 ETSU Johnson City, Tenn. 7 p.m.May 8 ETSU Johnson City, Tenn. 7 p.m.May 10 Coastal Carolina* Conway, S.C. TBAMay 10 Coastal Carolina* Conway, S.C. TBAMay 11 Coastal Carolina* Conway, S.C. TBAMay 11 Coastal Carolina* Conway, S.C. TBAMay 12 Coastal Carolina* Conway, S.C. TBAMay 12 Coastal Carolina* Conway, S.C. TBAMay 16 Winthrop* Greenwood Field 3 p.m.May 16 Winthrop* Greenwood Field 3 p.m.May 17 Winthrop* Greenwood Field 3 p.m.May 17 Winthrop* Greenwood Field 3 p.m.May 18 Winthrop* Greenwood Field 2 p.m.May 18 Winthrop* Greenwood Field 2 p.m.May 23-27 Big South Tournament Lynchburg, Va. TBAMay 23-27 Big South Tournament Lynchburg, Va. TBA

^ - Woff ord/USC Upstate Invitational^ - Woff ord/USC Upstate Invitational+ - Bulldog Challenge at The Citadel+ - Bulldog Challenge at The Citadel* - Big South Conference games* - Big South Conference games


Top Related