1
1
2
Membrane topology and identification of critical amino acid residues in the Wzx O-antigen 3
translocase from Escherichia coli O157:H4 4
5
6
Cristina L. Marolda,1 Bo Li,
1 Michael Lung,
1 Mei Yang
1, Anna Hanuszkiewicz
1, Amanda Roa 7
Rosales1, and Miguel A. Valvano
1,2* 8
9
Center for Human Immunology, Siebens-Drake Research Institute, Departments of Microbiology 10
and Immunology1, and Medicine
2, The University of Western Ontario, London, Ontario, Canada, 11
N6A 5C1 12
13
14
* Corresponding author. Mailing address: Miguel A. Valvano; Department of Microbiology and 15
Immunology, Dental Sciences Building 3014, University of Western Ontario, London, ON, N6A 16
5C1, Canada; Tel: (519) 661-3427; Fax: (519) 661-3499; Email: [email protected] 17
18
RUNNING TITLE: Functional residues and topology of Wzx 19
20
SECTION: Enzymes and Proteins 21
22
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.00141-10 JB Accepts, published online ahead of print on 24 September 2010
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
2
Abstract 22
Wzx belongs to a family of membrane proteins involved in the translocation of isoprenoid lipid-23
linked glycans, which is loosely related to members of the major facilitator superfamily. Despite 24
Wzx homologs performing a conserved function, it has been difficult to pinpoint specific motifs 25
of functional significance in their amino acid sequences. Here, we elucidate the topology of the 26
Escherichia coli O157 Wzx (WzxEcO157) by a combination of bioinformatics, substituted cysteine 27
scanning mutagenesis, as well as targeted deletion-fusions to green fluorescent protein and 28
alkaline phosphatase. We conclude that WzxEcO157 consists of 12 transmembrane (TM) helices, 29
six periplasmic, and five cytosolic loops, with N- and C- termini facing the cytoplasm. Four TM 30
helices (TMs II, IV, X, and XI) contain polar residues (aspartic acid or lysine), and they may 31
form part of a relatively hydrophilic core. Thirty-five amino acid replacements to alanine or 32
serine were targeted to five native cysteines, and most of the aspartic acid, arginine, and lysine 33
residues. From these, only replacements of aspartic acid-85, aspartic acid-326, arginine-298, and 34
lysine-419 resulted in a protein unable to support O antigen production. Aspartic acid-85 and 35
lysine-419 are located in TM helices II and XI, while arginine-298 and aspartic acid-326 are in 36
periplasmic and cytosolic loop four, respectively. Further analysis revealed the charge at these 37
positions is required for Wzx function since conservative substitutions maintaining the same 38
charge polarity resulted in a functional protein, while those reversing or eliminating polarity 39
abolished function. We propose that the functional requirement of charged residues at both sides 40
of the membrane and in two TM helices could be important to allow the passage of the Und-PP-41
linked saccharide substrate across the membrane. 42
43
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
3
INTRODUCTION 43
The lipopolysaccharide (LPS), a major component of the outer membrane of Gram-negative 44
bacteria, plays critical roles in bacterial cell physiology (36) and in disease (53). The structure of 45
LPS is complex and consists at a minimum of lipid A and core oligosaccharide (OS) (42). Many 46
Gram-negative bacteria also have an O-specific antigen polysaccharide (or O antigen) attached to 47
one of the terminal residues of the core OS (42). The O antigen is the most variable portion of 48
the LPS molecule and arises from the polymerization of discrete oligosaccharide units (42, 54). 49
The biosynthesis of LPS requires many enzymes and assembly proteins, and generally 50
involves two separate pathways. One pathway results in the synthesis of the lipid A-core OS 51
(42), which is translocated across the inner membrane by the lipid A flippase MsbA, an ABC 52
transporter (14, 15, 60). The other pathway involves the synthesis and assembly of the O antigen 53
polysaccharide, which also begins at the cytosolic side of the inner membrane resulting in the 54
formation of a lipid-linked molecule that is further translocated across the inner membrane. The 55
formation of a complete LPS molecule containing O antigen is catalyzed by the O antigen ligase 56
WaaL (41). LPS molecules are further translocated to the outer leaflet of the outer membrane by 57
the Lpt transport system involving a number of inner membrane, periplasmic, and outer 58
membrane proteins (44, 45, 48, 49). 59
There are at least three known mechanisms for the assembly and translocation of lipid-linked 60
O antigens (42, 54). One of them involves a synthase protein that is homologous to processive 61
glycosyltransferases involved in the synthesis of cellulose and chitin (24, 42). The other 62
mechanism requires ATP hydrolysis for the translocation step, which is mediated by a two-63
component ABC transporter. This mechanism was initially described for homopolymeric O 64
antigens (42), but also occurs with heteropolymeric O antigens (38). The third mechanism, 65
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
4
known as the Wzy-dependent pathway (42, 54), requires three proteins: Wzx (O antigen 66
translocase), Wzy (O antigen polymerase) and Wzz (regulator of O antigen chain length 67
distribution). This mechanism, used primarily for the synthesis of heteropolymeric O antigens, 68
differs from the other two in that each O unit is separately synthesized and individually 69
translocated across the inner membrane, while the polymerization takes place at the periplasmic 70
side of the membrane (42, 54). The O antigen precursors are always synthesized as 71
oligosaccharides covalently attached by a phosphoanhydride linkage to an isoprenoid lipid 72
known as undecaprenyl phosphate (Und-P). The formation of the phosphoanhydride linkage is 73
the first committed step towards the synthesis of O antigens and is catalyzed by two classes of 74
membrane enzymes whose prototypes are WecA and WbaP (3, 26, 39, 46, 54). Remarkably, the 75
involvement of an isoprenoid phosphate lipid for these reactions is a common theme in nature, 76
and also appears in the synthesis of glycan precursors for cell wall peptidoglycan, and protein 77
glycosylation in bacteria and eukaryotic cells (9, 10). Furthermore, the Wzy-dependent pathway 78
is functionally analogous to the initial steps of dolichol-PP-linked glycans at the endoplasmic 79
reticulum, which are involved in protein N-glycosylation (21, 54). Indeed, a membrane protein 80
with roughly similar features as Wzx has been identified in eukaryotic cells as the dolichol-PP-81
linked glycan flippase and named Rft1 (22). 82
Our laboratory focuses on the characterization of the Wzy-dependent pathway, and we have 83
previously shown that a single Und-PP-sugar is the minimal substrate for translocation (19, 33). 84
Consistent with this notion, Wzx proteins appear to recognize the Und-PP-bound sugar of the O 85
antigen unit, irrespective of the composition and structure of the remainder O unit (19, 33). 86
Based on these observations, Wzx proteins can be loosely separated among those that can 87
function with Und-PP-linked N-acetylhexosamines vs. those that can function with Und-PP-88
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
5
linked N-hexoses (33). However, comparisons among Wzx primary amino acid sequences do not 89
provide any hints on putative functional residues conserved across the members of this family. It 90
is generally accepted that the translocation process mediated by members of Wzx and Rft1 91
families does not involve ATP hydrolysis (21, 54), which agrees with the absence of features in 92
the protein that are characteristic of ATP binding or hydrolysis domains. Another complication 93
to investigate functionally the members of these families is the lack of solid topological models 94
that accurately predict transmembrane helices and solvent-exposed loops. Currently, 95
experimentally based topological models have only been established for the Salmonella enterica 96
serovar Typhimurium Group B Wzx protein (12), and the Wzx-like protein PssL from Rhizobium 97
leguminosarum (35), which is involved in exopolysaccharide capsule production. However, 98
these studies did not identify any regions or specific amino acids from the protein that could play 99
a functional role in the translocation process. In this work, we have experimentally characterized 100
the topology of the Wzx protein from E. coli O157 (WzxEcO157) and subjected this protein to 101
extensive mutagenesis by alanine and serine replacements targeting native cysteines and most of 102
the aspartic acid, arginine, and lysine residues. Complementation experiments measuring the 103
ability of each mutant protein to restore O antigen synthesis in a wzx deleted E. coli K-12 mutant 104
resulted in the identification of four charged residues that are required for function, two of which 105
occur in transmembrane helices. Additional replacement mutagenesis revealed that charge but 106
not the nature of the residue is important for Wzx function. 107
108
MATERIALS AND METHODS 109
Bacterial strains, plasmids and reagents. Strains and plasmids in this study are described 110
in Table 1, and oligonucleotide primers are listed in Table 2. Bacteria were cultured in Luria 111
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
6
broth (LB) supplemented with antibiotics at the following final concentrations: 100 µg/ml 112
ampicillin, 30 µg/ml chloramphenicol, 40 µg/ml kanamycin, and 80 µg/ml spectinomycin. 113
Chemicals and antibiotics were purchased from Sigma Aldrich and Roche Diagnostics. 114
Oligonucleotide primers were purchased from Invitrogen. Plasmids were introduced into 115
electrocompetent cells by electroporation (16). GFP fusions, PhoA fusions, plasmids, and single 116
replacement constructs were confirmed by sequencing analysis (York University Core Molecular 117
Biology Facility). 118
Construction of an E. coli araCIBAD mutant. The deletion of the araCIBAD 119
chromosomal genes in W3110 was performed as described by Datsenko and Wanner (13). We 120
generated primers composed of 40 to 45 nucleotides corresponding to regions adjacent to the 121
genes targeted for deletion of the ara genes. The primers also contained 20 additional 122
nucleotides that annealed to the template DNA from plasmid pKD4, which carries a kanamycin-123
resistance gene flanked by FRT (FLP recognition target) sites. A PCR reaction was carried out 124
using primers 3341 and 3342 (Table 2) and the DNA product was introduced by electroporation 125
into E. coli W3110(pKD46) competent cells grown in LB containing 0.5% (w/v) arabinose. 126
Ampicillin-sensitive (indicating loss of pKD46), kanamycin-resistant (presence of inserted 127
cassette) colonies were screened by PCR using primers annealing to regions outside of the 128
mutated genes (primers 3333 and 3335, Table 2). The antibiotic gene was excised by introducing 129
the plasmid pCP20 encoding the FLP recombinase. Plasmids pKD46 and pCP20 are both thermo 130
sensitive for replication and they were cured at 42 °C. 131
Construction of fusions to green fluorescent protein (GFP). Plasmid pCM256, encoding 132
WzxEcO157 fused to GFP was constructed by PCR amplification of a 1.3-kb fragment encoding 133
wzxEcO157 from plasmid pJV7 with primers 252 and 3370. The PCR product was digested with 134
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
7
EcoRI and StuI, while pBADGFP was digested with EcoRI and SmaI. The digested DNA 135
products were ligated (Rapid Ligation Kit, Roche Diagnostics) and the ligation mix introduced 136
by electroporation into DH5α competent cells. To construct the plasmids encoding the WzxGFP 137
deleted derivatives PCR products were amplified using pCM256 as DNA template and primers 138
containing StuI restriction sites (underlined). A combination of primer GFP and primers K244, 139
T288, Q301, T308, D320, K331, and G397 (Table 2) were used. The PCR products were 140
digested with StuI and self ligated. Plasmid pBL1 was constructed by PCR amplification of a 141
1.3-kb fragment encoding wzxEcO157 from plasmid pJV7, using primers 252 primer 2317. The 142
PCR product and the vector plasmid pBADHIS were digested with NheI and XhoI, ligated and 143
transformed into DH5α as described above. pBL1 was used as a template to replace all native 144
cysteine residues in WzxEcO157 (13, 102, 130, 434 and 449) with alanine giving rise to pBL2, 145
pBL3, pBL4, pML202 and pML203 (Table 1). The replacement of other residues in either pBL1 146
or pML203 was also performed by site directed-mutagenesis. 147
Construction of fusions to alkaline phosphatase (PhoA). The phoA gene was amplified 148
from E. coli JM109 genomic DNA using primers 4771 and 4770 (Table 2). The primers were 149
designed such that only the portion of the gene encoding the mature PhoA protein was amplified. 150
The PCR product and plasmid pBADNTF were both digested with PstI and HindIII, and after 151
ligation, the mixture was introduced into E. coli DH5α cells, resulting in the isolation of pAH18 152
(Table 1). A fragment of the wzxEcO157 gene in pJV7 encoding amino acids 1 to K367 was 153
amplified using primers 4769 and 4772. The PCR product and pAH18 were both digested with 154
NheI and PstI, and ligation was performed for 15 min at room temperature (Rapid Ligation Kit). 155
The ligation mixture was introduced by transformation into E. coli CC118 cells and the 156
transformants plated on LB/ampicillin agar with 60 µg/ml BCIP (5-chromo-4-chloro-3-indolyl 157
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
8
phosphate, XP). Plasmids from blue colonies were isolated and sequenced with primers 252 and 158
4817 (Table 2) to verify the correct insertion of wzxEcO157-1-K367 into pAH18. The 4772 primer 159
incorporated a PstI site to facilitate the cloning, which resulted in the addition of two amino acids 160
between the K367 and the PhoA protein. One of these plasmids, encoding WzxEcO157-K367-161
PhoA(PstI) was designated as pAH18-K367PhoA(PstI). This plasmid was used to produce further 162
PhoA-fusion constructs by inverse PCR amplifications using Pwo DNA polymerase (Roche 163
Diagnostics), the same forward primer 4768, and the various reverse primers 4764, 4766, 4767, 164
and 4816 (Table 2). In this case, the primers were designed to remove the PstI site and the extra 165
two amino acids used initially for constructing WzxEcO157-K367-PhoA(PstI). PCR products were 166
phosphorylated for 30 min with polynucleotide kinase (PNK, Roche Diagnostics) and self-167
ligated for 15 min at room temperature (Rapid Ligation Kit). The ligation mixtures were 168
introduced into E. coli CC118 cells and transformants screened for blue-colony phenotypes in 169
XP/ampicillin plates. DNA sequencing with primers 252 and 4817 confirmed the presence of in-170
frame fusions. 171
Alkaline phosphatase assay. To quantify alkaline phosphatase activity 1:100 diluted 172
overnight cultures were grown for 4 h at 37°C in LB with ampicillin and 0.02% (v/v) arabinose, 173
harvested, lysed, and assayed as described (29) with the addition of 1 mM iodoacetamide in all 174
buffers. E. coli CC118 cell lysates were used as negative control. 175
Microscopy. An overnight culture of CLM74 cells containing the plasmids encoding the 176
GFP-fusion proteins (Table 1), were diluted in LB to an OD600 of 0.15, and protein expression 177
was induced with 0.1% (w/v) arabinose when OD600 reached values between 0.6-0.7. After 3-h 178
induction, the culture was placed on ice for 60 min to facilitate GFP folding. Similar experiments 179
were also done without arabinose in the growth medium. Bacteria were visualized with no 180
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
9
fixation using an Axioscope 2 (Carl Zeiss) microscope with an X100/1.3 numerical aperture 181
Plan-Neofluor objective and a 50 W Mercury arc lamp with a GFP band pass emission filter set 182
(Chroma Technology) with a 470 ± 20 nm excitation range and a 525 ± 25 nm emission range. 183
Images were digitally processed using the Northern Eclipse version 7.0 imaging analysis 184
software (Empix Imaging, Mississauga, Ontario, Canada). 185
Labeling of cells and vesicles with sulfhydryl-reactive reagents. Overnight cultures of 186
DH5α cells containing the appropriate plasmids (Table 2) supplemented with 100 µg/ml 187
ampicillin, were diluted in LB medium (250 ml) to an OD600 of 0.2, when the OD600 reached 188
values between 0.6-0.7 protein expression was induced with 0.1% arabinose. After 3-h induction 189
bacteria were harvested at 3300 xg for 15 min, washed twice with 0.1 M sodium phosphate 190
buffer (pH 7.2) and resuspended in 8 ml of the same buffer. At this point the bacterial suspension 191
was divided into two 4 ml aliquots to proceed to the biotinylation steps (8). One aliquot was pre-192
treated with 0.5 mM [2-(Trimethylammonium)ethyl] methanethiosulfonate bromide (MTSET; 193
Toronto Research Chemicals Inc., Toronto, Ontario, Canada) for 10 min at room temperature. 194
Both aliquots were then treated with 0.5 mM Nα-(3-maleimidylpropionyl)biocytin (biotin 195
maleimide, BM; Invitrogen) for 60 min at room temperature, with constant rocking. The reaction 196
was terminated by addition of 350 µl of 2% (v/v) 2-mercaptoethanol in 0.1 M sodium phosphate 197
buffer (pH 7.2). Treated cultures were then washed twice with 20 ml phosphate buffer and 198
resuspended in a final volume of 3 ml of the same buffer containing protease inhibitors 199
(Complete Cocktail inhibitor, Roche Diagnostics). Cells were lysed in two passes at 15,000 psi 200
using a French press, lysates were centrifuged at 39,000 xg for 15 min and the supernatant 201
sedimented at 280,000 xg for 30 min. The pellet, containing total membranes, was resuspended 202
in 80 µl of 20 mM Tris-HCL buffer (pH 8) plus protease inhibitor and the membranes were 203
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
10
solubilized for 4 h with 0.5% Triton X-100 in 20 mM Tris-HCL buffer pH 8 and 8M urea (pH 8). 204
To label membrane vesicles, total membranes were resuspended in 2 ml of 0.1M sodium 205
phosphate buffer, pH 7.2, treated with 0.4 M dithiothreitol (DTT; Sigma Chemical Company) for 206
10 min and centrifuged at 280,000 xg for 30 min. The membrane pellets were resuspended in 207
500 µl of 0.1 M sodium phosphate buffer pH 7.2 and divided in two aliquots of 25 µl each. The 208
volume was brought up to 1 ml with the same buffer and one aliquot was pre-treated for 30 209
minutes at room temperature with 125 mM MTSET. Both aliquots were incubated with 0.5 mM 210
BM for 60 min as described for whole cells. The reaction was terminated by addition of 83 µl of 211
2% (v/v) 2-mercaptoethanol in 0.1 M sodium phosphate buffer (pH 7.2) and the membranes were 212
sedimented again. Membrane proteins were solubilized in 0.5% Triton X-100 as described 213
above. 214
Isolation of His-tagged protein. Solubilized samples were spun at 39,000 x g for 45 min 215
to remove insoluble material. The supernatant was mixed with 100 µl of Ni-bound Chelating 216
Sepharose Fast Flow resin (GE Healthcare), equilibrated with wash buffer (20 mM Tris-HCl, 217
300 mM NaCl, 100 mM imidazole, 8 M urea, pH 8) and the mix was incubated for 2 h at room 218
temperature with gentle mixing. The resin was spun down at 1000 xg for 2 min, the supernatant 219
aspirated and the protein-loaded column was washed three times with1 ml of wash buffer. 220
WzxEcO157 was eluted by incubating the resin with 70 µl of elution buffer (20 mM Tris-HCl, 300 221
mM NaCl, 300 mM imidazole, 8 M urea, 0.5% Triton X-100, pH 8) for 15 min. Elution fractions 222
were incubated for 30 min at 45°C, separated on a 14% sodium dodecyl sulfate (SDS)-223
polyacrylamide gel electrophoresis (PAGE), and transferred to nitrocellulose membranes that 224
were reacted with anti-FLAG monoclonal antibodies (Sigma). Biotinylated proteins were 225
detected by incubation with IRDye800-Streptavidin (Rockland, Pennsylvania). 226
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
11
LPS analysis. LPS was prepared as previously described (31) from cells grown on LB plates 227
with 0.1% (w/v) arabinose and the samples were separated on 14 % (w/v) Tricine SDS-PAGE. 228
Gels were stained with silver nitrate as described previously (31, 34). Densitometry of silver 229
stained gels was performed using the program ImageJ (1). Three regions of the gel were 230
considered for the quantitative analysis: the bands in the polymeric O antigen region, the band of 231
lipid A-core OS plus one O antigen unit, and the lipid A-core OS band. The relative amount of O 232
antigen expression was determined by adding the pixels corresponding to the polymeric O 233
antigen region of the gel (previously subtracted from background pixels) + the pixels 234
corresponding to the lipid A-core OS plus one O antigen unit, divided by the pixels of the lipid 235
A-core OS band. The results were expressed as percent values relative to the positive control 236
(100 %). 237
Protein analysis. Total membranes were prepared from cells grown using the same 238
conditions indicated above for preparation of LPS samples. Bacterial cells were suspended in 20 239
mM Na2PO4 pH 7.2 plus protease inhibitors (Complete Tablets, Roche Diagnostics) and they 240
were lysed by sonic disruption for two 15-s pulses (Branson). Total membrane fractions were 241
obtained by centrifugation of the lysates for 40 min at 40,000 g and the pellet resuspended in the 242
same buffer. Protein concentration was measured by the Bradford assay (Bio Rad Protein 243
Assay). 20-40 µg of total membrane proteins were incubated for 30 min at 45°C, separated on a 244
14% SDS-PAGE, and transferred to nitrocellulose membranes that were reacted with one of the 245
following: anti-FLAG polyclonal rabbit antibodies (Rockland, Pennsylvania), anti-FLAG 246
monoclonal antibodies (Sigma) and anti-GFP monoclonal antibodies (Roche Diagnostics). The 247
reacting bands were detected by fluorescence with an Odyssey infrared imaging system (Li-cor 248
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
12
Biosciences) using IRDye800CW affinity purified anti-rabbit IgG antibodies (Rockland, 249
Pennsylvania) and Alexa Flour® 680 anti-mouse IgG antibodies (Invitrogen). 250
251
252
RESULTS 253
Topological analysis of WzxEcO157 by the substituted cysteine accessibility method. We 254
attempted to establish a working topological model for WzxEcO157 using commonly employed 255
algorithms that predict the number and location of transmembrane helices and the orientation of 256
the intervening loops (17, 37). The programs HMMTOP (52), MEMSAT (23), TMHMM (50), 257
and Octopus (55) predicted twelve TM helices with six periplasmic and five cytoplasmic loops, 258
while TOPPRED (11) predicted only 10 TM helices, five periplasmic and four cytoplasmic loops 259
(Fig. 1). All the programs predicted that the N-terminus and C-terminus of the protein were 260
located in the cytoplasm. However, even with the programs predicting the same number of TM 261
helices each of the models obtained differed in the length and orientation of periplasmic and 262
cytoplasmic loops, particularly in the region between amino acids 260 and 425 (Fig. 1, square). 263
Given the difficulties in producing a reliable topological model for WzxEcO157 by computer 264
predictions, we resorted to the substituted cysteine accessibility method (SCAM; 8). The native 265
WzxEcO157 protein contains five cysteines at positions 13, 102, 130, 434 and 449, which were all 266
replaced by alanine in a sequential manner, resulting in WzxEcO157 forms with one or more 267
cysteine replacements. These proteins were engineered to contain an N-terminally fused FLAG 268
epitope for detection by western blot and a C-terminal 7xHis to facilitate their isolation by Ni2+
-269
affinity chromatography after labeling with biotin maleimide (see below). To determine whether 270
these proteins support O antigen expression we prepared LPS samples from CLM17(pMF19) 271
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
13
bacteria containing the appropriate plasmid constructs. We have demonstrated earlier that the 272
WzxEcO157 protein can restore O16 antigen synthesis in the ∆wzxEcO16 mutant with the same 273
efficiency as WzxEcO16 (33). The pMF19 plasmid contains the wbbL gene encoding a 274
rhamnosyltransferase that allows for the completion of O16 LPS synthesis in the E. coli K-12 275
W3110 strain and its derivatives (19, 28, 33). The WzxEcO157 mutant proteins lacking one or 276
more native cysteines (Fig. 2A, lanes 3-7) supported O antigen production with the same banding 277
pattern characteristics as the one mediated by the parental WzxEcO157-FLAG-7xHis protein (Fig. 2A, 278
lane 2). Cells expressing mutant proteins containing quadruple or quintuple cysteine 279
replacements also exhibited a small reduction in the amount of polymeric O antigen (Fig. 2A, 280
lanes 6-7). This reduction could be due instability of the mutated protein in the membrane. 281
However, all the proteins were found at roughly the same level in the membrane fractions (Fig. 282
2B, lanes 2-7) and our method to prepare membrane fractions affords a mixture of outer and 283
inner membrane proteins with negligible contamination of cytoplasmic proteins (4-6, 26, 32, 33, 284
56). Therefore, the experimental results demonstrate that replacing all the native cysteines in 285
WzxEcO157-FLAG-7xHis does not significantly affect protein expression, membrane localization, and 286
O antigen production. 287
We used the WzxEcO157-Cysless protein to introduce novel cysteine replacements at various 288
positions for topological analysis (Table 2 and Fig. 3). All replacements resulted in proteins that 289
were detectable by western blot with anti-FLAG antibodies, confirming that the cysteine 290
replacement are well tolerated and do not affect protein stability or targeting to the plasma 291
membrane (data not shown). The accessibility of the novel cysteines to the sulfhydryl reactive 292
reagent biotin maleimide was determined by incubating whole cells with the label, followed by 293
treatment with excess β-mercaptoethanol before bacterial cell lysis. This treatment prevents the 294
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
14
labeling of any cysteine that could become exposed to biotin maleimide during cell fractionation. 295
Biotin maleimide is membrane permeable and reacts with thiol groups that are next to water 296
molecules since the reaction with an ionized thiol group requires a water molecule as a proton 297
acceptor (8). Therefore, cysteines buried in the core of the hydrophobic transmembrane segments 298
are usually not labeled (8). Cysteine-substituted K144, K367, R298, H209, and D277 were 299
accessible to biotin maleimide (Fig. 4A, lanes 3, 7, 9, 11, and 13), suggesting these residues are 300
exposed to the labeling reagent (Fig. 2 and Table 2). In contrast, the parental WzxEcO157-Cysless and 301
the cysteine-substituted forms at P313, F293, and P306 positions were not labeled (Fig. 4A, lanes 302
1, 5, 15 and 17), indicating that these residues are not exposed to biotin and suggesting they are 303
in close proximity to the inner membrane or buried within the membrane bilayer. Similarly, 304
cysteine substitutions at positions K244, D320, R324 and K331 were not labeled in whole cells 305
(Table 2 and data not shown). 306
To determine whether the labeled amino acids were located at the periplasmic face of the 307
inner membrane we used MTSET, a charged thiol-specific probe that reacts with sulfhydryl 308
groups under similar conditions as biotin maleimide, but is impermeable to the cytoplasmic 309
membrane due to its positive charge (8). Incubation of whole bacterial cells with MTSET prior to 310
treatment with biotin maleimide prevents labeling of periplasmic cysteines (26). Accordingly, 311
pretreatment with MTSET prevented the labeling with biotin maleimide of cysteine-substituted 312
K144, K367, R298, His209, and D277 residues (Fig. 4A lanes 4, 8, 10, 12 and 14), suggesting 313
that these residues are exposed to the periplasmic face of the inner membrane. These results 314
agree with the control experiment using WecAS362C (not protected by MTSET) and WecAG181S 315
(protected by MTSET), which contain cysteine replacements in cytosolic and periplasmic 316
residues, respectively (26)(data not shown). 317
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
15
Despite that biotin maleimide is supposed to be membrane permeable we could not confirm 318
by labeling in whole cells the location of cysteine-substituted residues at positions K244, D320, 319
R324, and K331, which were all expected to be in the cytosolic loops 3 and 4 (Fig. 3). To resolve 320
the location of these residues we performed the labeling experiment on isolated membrane 321
vesicles. This strategy permitted us to biotinylate all periplasmic and cytoplasmic exposed 322
residues. Cysteine-substituted proteins at D320, K331, K367 and R324 positions were labeled 323
with biotin but labeling was prevented by MTSET (Fig. 4B, lanes 3-10), indicating that these 324
residues are surface exposed. From these, the cysteine-substituted K367 residue was the only one 325
that could be labeled in whole cells and also in membrane vesicle preparations, and in both cases 326
labeling was prevented by pretreatment with MTSET (Fig. 4A and B, lanes 7-8). Therefore, this 327
residue is unequivocally located in the predicted periplasmic loop 5 (Fig. 3). Because cysteine 328
replacements at D320, K331, and R324 could not be labeled with biotin maleimide upon 329
treatment of whole cells (Table 2 and data not shown), but were detectable in membrane vesicles 330
(Fig. 4B, lanes 3-6, 9-10), we concluded that these residues are exposed to the cytoplasmic face 331
of the inner membrane. Vesicles prepared from cells expressing the Cys substitution at Phe264 332
did not react with biotin maleimide (Fig. 4B, lanes 1 and 2) nor did vesicles containing Wzx 333
proteins with replacements at P254, G286, F293, P306, and P313 (data not shown). From these, 334
cysteines at positions P254, P306, and P313 were also not labeled in whole cells (Table 2), 335
suggesting that they are buried in the membrane. G286 and F293 span an 18-amino acid (from 336
F279 to T296) region containing hydrophobic residues flanked by D277 and R298, which were 337
both mapped to the periplasmic space (Fig. 3) as they strongly react with biotin maleimide and 338
labeling is prevented by MTSET in whole cells (Fig. 4A, lanes 9-10, 13-14). Therefore, it is 339
unlikely that this region can form a transmembrane helix but it could still have a secondary 340
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
16
structure such that would prevent access to biotin maleimide for labeling, as we have previously 341
shown for an analogous short hydrophobic region within the large cytoplasmic loop 5 of WecA 342
(26). Together, the SCAM results allowed us to construct an experimentally supported 343
topological model of WzxEcO157 (Fig. 3). 344
Additional topological analysis by targeted fusions to green fluorescent protein and 345
alkaline phosphatase. To get additional evidence for the topological assignments from the 346
SCAM, we constructed a WzxEcO157 derivative C-terminally fused to GFP (encoded by pCM256, 347
Table 1), a reporter that can only fluoresce if present in the cytosol (18). As before, the 348
WzxEcO157 protein expressed from pCM256 also contains an N-terminal FLAG epitope. The 349
WzxEcO157-GFP fusion protein afforded an ~80-kDa polypeptide band in western blots of total 350
membrane preparations reacted with anti-GFP and anti-FLAG antiserum, indicating that Wzx is 351
correctly fused to the GFP protein and that is also in the membrane fraction (Fig. 5A, lanes 4 and 352
6; black arrowheads). In contrast, the membrane fraction from E. coli cells expressing the 353
parental WzxEcO157-FLAG-7xHis shows a ~ 53-kDa band that is only detectable with anti-FLAG 354
antibodies (Fig. 5A, lane 5, white asterisk), in agreement with the predicted mass of this protein. 355
As a control, we detected a 27-kDa band corresponding to soluble GFP in the cell lysate from 356
DH5/pBADGFP (Fig. 5A, lane 1, asterisk). Additional bands of large molecular mass reacting 357
with either anti-GFP or anti-FLAG antibodies are also detected (Fig. 5A, lanes 1, 4-6). These 358
were likely oligomeric forms of Wzx (lanes 4-6) and GFP (lane 1) due to the incomplete 359
denaturing conditions used to prepare the samples. Complete denaturation including treatment of 360
the samples by heating at 100 °C in SDS prevents the detection of membrane proteins in SDS-361
PAGE, as we have previously observed with various membrane proteins containing multiple 362
transmembrane helices (26, 41, 51, 56), including several other Wzx proteins (33). 363
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
17
Using the wzxEcO157-gfp gene encoded in pCM256 as a starting point, various deletions were 364
constructed that resulted in C-terminally truncated forms of WzxEcO157 remaining C-terminally 365
fused to GFP. The deletion-fusion endpoints chosen corresponded to amino acids K244, T288, 366
Q301, T308, D320, K331, and G397 of the native WzxEcO157 protein (Table 1). These endpoints 367
were chosen to help resolve the topology of the most difficult part of WzxEcO157, where most of 368
the prediction programs differed (Fig. 1, square). The expected fusion was produced by all 369
plasmid constructs, as suggested by the detection with anti-GFP antibodies of polypeptide bands 370
of decreasing molecular mass, ranging from 80 kDa for the parental WzxEcO157-GFP (Fig. 5B, lane 371
1) to 55.3 kDa for WzxEcO157-K244GFP (Fig. 5B, lane 8). 372
The plasmids encoding parental and deleted versions of WzxEcO157-GFP fusions were 373
introduced into the E. coli cells CLM74 by electroporation. CLM74 has a deletion of the 374
araCIBAD chromosomal genes (Table 1), which reduces toxic effects of arabinose and its 375
metabolites on E. coli K-12 strains (43). We have observed that arabinose toxicity affects cell 376
growth and leads to altered cell morphologies upon membrane protein expression driven by 377
cloned genes under the control of arabinose-inducible promoters (data not shown). Bacterial cells 378
expressing parental WzxEcO157-GFP displayed fluorescence around the cell periphery detectable 379
after 0.85-s exposure to UV light (Fig.1D), confirming the prediction that Wzx is in the 380
membrane with the C-terminus facing the cytosol (Fig. 3). Cells expressing WzxEcO157-K244-381
GFP, WzxEcO157-K331-GFP, and WzxEcO157-G397-GFP (Fig. 5C) also displayed fluorescence 382
around the periphery but with less intensity (samples exposed for 3 s to be able to detect a 383
fluorescent signal), suggesting that residues K244, K331, and G397 are exposed to the cytosol. 384
The cytosolic location of K244, D320, and K331 agreed with the SCAM data (Figs. 3 and 4). 385
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
18
Also, these results support the assignment of R324 at the cytoplasmic side of the membrane 386
given its proximity to D320 and K331 (Fig. 3). 387
In CLM74 cells expressing WzxEcO157-D320-GFP, WzxEcO157-Q301-GFP, and WzxEcO157-388
T308-GFP the fluorescence was very faint, requiring 4-s exposures, and also present within the 389
cell bodies, while cells expressing and WzxEcO157-T288-GFP did not fluoresce even after longer 390
exposure (Fig. 5D and data not shown). We interpreted these results as an indication that 391
residues D320, Q301, T308, and T288 are not exposed to the cytosol. To verify this, we 392
performed similar deletion fusion experiments using the alkaline phosphatase PhoA as a reporter 393
for periplasmic localization. This protein can only fold properly, and therefore becomes 394
enzymatically active, if exported to the periplasmic space (30). Although we originally intended 395
to obtain protein fusions at identical endpoints as those for GFP fusions, this was only achievable 396
in some cases, while in others only small in-frame deletions were recovered that resulted in 397
fusions to nearby residues. Also, despite numerous attempts we could not obtain a WzxEcO157-398
PhoA C-terminal fusion, concluding this fusion is probably toxic to E. coli cells (data not 399
shown). E. coli CC118 cells (Table 1) containing plasmids encoding WzxEcO157-PhoA fusions 400
with deletion-fusion endpoints at amino acids W139, T288, V360, and K367 gave a strong blue-401
colony phenotype in XP plates (data not shown). In agreement to these results, cell-free lysates 402
of CC118 bacteria expressing PhoA fusions at W139, T288, V360, and K367 gave 10,754 ± 390, 403
1372 ± 75, 3288 ± 237, and 3134 ± 170 units of alkaline phosphatase activity, respectively, 404
suggesting these residues are exposed to the periplasmic space. This agrees with data obtained 405
from the SCAM method for residues at the fusion endpoint (K367) or nearby residues to those 406
experimentally determined as exposed to the periplasm (W139 near K144, and V360 near K367 407
(Fig. 3), and also with the absence of GFP-mediated fluorescence in the case of T288-GFP 408
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
19
fusion. In contrast, expression of the WzxEcO157-F242-PhoA fusion only afforded white colonies 409
and cell-free lysates had no enzymatic activity. F242 is near K244, which based on GFP fusion 410
data and SCAM can unequivocally be placed in cytoplasmic loop 3 (Fig. 3). Thus, the 411
combination of fusion experiments with GFP and PhoA reporters, and the SCAM methods 412
confirmed the topological assignment of WzxEcO157 (Fig. 3) as a membrane protein with 12 TM 413
helices, 6 periplasmic and 5 cytoplasmic loops, and the C-terminus in the cytosol (Fig. 3). 414
Identification of functional residues in WzxEcO157. We investigated whether any of the 415
cysteine-substituted WzxEcO157 mutants was unable to support O antigen surface expression in 416
vivo using CLM17(pMF19). Bacteria containing WzxEcO157 proteins with cysteine replacements 417
at K244, K331, K367, and K402 showed moderate reduction in surface O antigen production, 418
ranging from 60 to 90% as compared to cells expressing the parental cysteine-less WzxEcO157 419
(Table 3 and data not shown). Substitutions P313C, D320C and K176C resulted in proteins 420
greatly compromised in their ability to support O antigen production, as demonstrated by a 421
reduction in surface O antigen ranging from 30 to 50% relative to levels in the parental strain 422
(Table 3). In the case of the WzxEcO157 mutant R298C there was no O antigen production (Table 423
3). The differences in O antigen production observed in these mutant proteins were not due to 424
lack of protein expression as confirmed by western blot with anti-FLAG antibodies (data not 425
shown). That the mutant proteins were detected in total membrane fractions suggests that they 426
are sufficiently similar to the parental derivative to least be inserted in the membrane, although 427
we cannot rule out localized changes in secondary structure. Because the cysteineless form of 428
WzxEcO157 mediated a somewhat reduced production of O antigen when compared to the parental 429
protein with its native cysteines (Fig. 2A, compare lanes 2 and 7), and the replacement of a 430
native amino acid by a cysteine at certain positions could lead to local structural changes due to 431
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
20
differences in hydrophobicity and the oxidation state of the SH- side chain, we reconstructed the 432
cysteine substitutions that caused a functional defect in WzxEcO15 as alanine or serine 433
replacements in the parental protein. Alanine and serine are usually much better tolerated since 434
because of their small mass they generally cause only minor conformational changes in the 435
protein structure (7). Also, serine favors the formation of loops (25), and therefore would not be 436
expected to alter the extracellular loops of WzxEcO157. Using this approach, we confirmed that 437
only WzxEcO157-D326A and WzxEcO157-R298A were functionally impaired in mediating O antigen 438
production showing 60% and no O antigen, respectively (Fig. 6A, lanes 9 and 15), while the rest 439
of the replacements did not compromise WzxEcO157 functionality. 440
Charged residues are rarely found in the interior of transmembrane helices (57). Therefore, 441
we also investigated the functional contribution of the charged residues D85, K159, D385, and 442
K419 in transmembrane helices 2, 4, 10 and 11, respectively. We also investigated the functional 443
role of Q223 and Q267 in transmembrane helices 6 and 7, since residues at analogous positions 444
are important for the function of the LacY permease (2), a prototypic member of the major 445
facilitator superfamily. As shown in Fig. 6B, lanes 3 and 8, only D85 and K419 are required for 446
WzxEcO157 function since the mutant proteins WzxEcO157-D85A and WzxEcO157-K419S were unable to 447
mediate O-antigen production. The lack of function was not due to loss of protein expression 448
since all mutant proteins were produced at similar levels by western blot (data not shown). From 449
these experiments, we concluded that residues D85, R298, D326, and K419 are required for the 450
normal function of WzxEcO157. 451
To gain more information on the role of these residues we constructed additional replacement 452
mutants geared to cause charge modifications. Thus, D85 and D326 were also replaced with 453
glutamic acid and arginine, R298 was replaced with aspartic acid and lysine, and K419 was 454
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
21
replaced with arginine and aspartic acid. The plasmids expressing the replaced proteins were 455
examined for their ability to support O antigen production in CLM17(pMF21) bacteria. Only 456
substitutions preserving the net charge at each residue were functional (Fig. 7), while 457
substitutions causing a charge reversal were not functional as with the control replacements to 458
alanine or cysteine. From these experiments, we conclude that the net charge of these residues is 459
key for WzxEcO157 activity. 460
461
DISCUSSION 462
A combination of deletion-fusions to the GFP and PhoA proteins as topology probes and 463
biotin-maleimide labeling of cysteine replacement mutants allowed us to construct an 464
experimentally validated topological model for WzxEcO157 that contains 12 TM helices, 6 465
periplasmic and 5 cytoplasmic loops. A cysteineless version of WzxEcO157 that remained 466
functional and localized to the membrane indicated that the native cysteines are dispensable for 467
Wzx function. Some interesting observations can be drawn from the topology of WzxEcO157. 468
First, four TM helices (TMs II, IV, X, and XI) contain polar residues (aspartic acid or lysine), 469
which are atypical residues for a TM location. Second, some of the periplasmic loops contain 470
stretches of hydrophobic residues flanked by polar residues (D277-R298 in periplasmic loop 471
four, and E358-K367 in periplasmic loop five). De novo modeling of the D277-R298 segment 472
predicts that the intervening amino acids form two β-strands in parallel orientation (data not 473
shown). This arrangement could be important for interactions with the Und-PP-O unit substrate. 474
R298, which is required for a functional WzxEcO157, could be involved in interactions with the 475
phosphates of the Und-PP. Similarly, we have recently shown that positively charged 476
periplasmic residues in the O antigen ligase WaaL are prime candidates to interact with the 477
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
22
phosphate residues of Und-PP-linked saccharides (41). Whether this is also true for WzxEcO157 478
will require additional experiments to test specific interactions of this protein with Und-PP-479
linked O antigen precursors. 480
With the programs we used, the periplasmic loops containing hydrophobic residues 481
correspond to the part of the protein that are most difficult to predict topologically in a consistent 482
manner. Similar features appear in the topological models of Wzx proteins from S. enterica 483
(WzxSe) (12) and R. leguminosarum (PssL) (35). In both proteins there are also four 484
transmembrane domains, each containing lysine or arginine residues, and two periplasmic loops 485
with short stretches of hydrophobic amino acids. The only major difference between these 486
proteins and WzxEcO157 is that R. leguminosarum PssL has a larger cytosolic loop between TM 487
helices 6 and 7, which is absent in the E. coli O157 and S. enterica homologs. Paulsen et al (40) 488
have classified proteins involved in lipid-linked saccharide transport into one family with two 489
subclasses based on the presence of the large predicted cytosolic loop. However, it remains 490
unclear if this has any functional significance and unfortunately, it has not been possible to 491
obtain mutants of pssL in R. leguminosarum (35). 492
As an attempt to identify functional amino acids we utilized alanine and/or serine 493
replacement mutagenesis taking advantage of the topological model. We were particularly 494
interested in targeting the charged residues in TM helices and also residues in periplasmic and 495
cytosolic loops. Each mutant protein was examined for expression and localization to the inner 496
membrane. We have found with other membrane proteins, like WecA and WaaL that mutations 497
affecting protein insertion in the membrane result in no detectable protein. By these criteria, we 498
assumed that all the replacement mutants behave identically to the parental WzxEcO15, although 499
small local changes cannot be identified. Only D85, R298, D326, and K419 yielded non-500
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
23
functional proteins when replaced by alanine. Furthermore, conservative replacements at these 501
positions demonstrated that the charge, but not the nature of the targeted amino acid, is critical to 502
retain the ability of WzxEcO157 to support O antigen production. These results suggest that 503
residues at these positions could be involved in making contacts with substrates directly or via 504
water molecules. 505
From our current data, we propose that Wzx proteins have similar features to transporters of 506
the major facilitator superfamily. This is based on the following: (i) the presence of at least four 507
TM helices with charged amino acids, suggesting the possibility of tertiary structure such that a 508
core of TM helices interact with each other and locate further way from the lipid bilayer, in a 509
similar arrangement as that found for LacY (47); and (ii) the functional requirement of charged 510
residues at both sides of the membrane and in two TM helices, which could be important to 511
create an electrostatic cavity (2, 47) and perhaps even electrostatic interactions with the 512
phosphate groups of Und-PP-linked sugars, which may allow localized perturbation of the lipid 513
bilayer to facilitate the movement of the Und-PP-linked saccharide substrate across the 514
membrane. These possibilities are supported by previous results of in vitro studies of interactions 515
between hydrophobic peptides with lipid vesicles containing isoprenoid phosphates, and 516
molecular modeling of isoprenoid phosphates in artificial membranes (58, 59). Further 517
experiments involving additional mutagenesis, neighborhood analysis of TM helices, and Und-518
PP-saccharide substrate binding assays are required to unequivocally identify functional regions 519
of WzxEcO157 based on an experimentally established topological model and begin elucidating the 520
mechanism of translocation. 521
522
523
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
24
ACKNOWLEDGMENTS 524
The authors thank the colleagues referenced or mentioned in Table 1 for strains and plasmids. This 525
work was supported by grants from the Canadian Institutes of Health Research and the Mizutani 526
Foundation for Glycoscience. Summer Research Awards from the Natural Sciences and 527
Engineering Research Council of Canada supported B.L. and M.L.. M.A.V. holds a Canada 528
Research Chair in Infectious Diseases and Microbial Pathogenesis. 529
530
REFERENCES 531
532
1. Abramoff, M. D., P. J. Magelhaes, and S. J. Ram. 2004. Image processing with 533
ImageJ. Biophotonics Int. 11:36-42. 534
2. Abramson, J., I. Smirnova, V. Kasho, G. Verner, H. R. Kaback, and S. Iwata. 2003. 535
Structure and mechanism of the lactose permease of Escherichia coli. Science 301:610-536
615. 537
3. Alexander, D. C., and M. A. Valvano. 1994. Role of the rfe gene in the biosynthesis of 538
the Escherichia coli O7-specific lipopolysaccharide and other O-specific polysaccharides 539
containing N-acetylglucosamine. J. Bacteriol. 176:7079-7084. 540
4. Amer, A. O., and M. A. Valvano. 2001. Conserved amino acid residues found in a 541
predicted cytosolic domain of WecA (UDP-N-acetyl glucosamine:undecaprenol-542
phosphate N-acetylglucosamine-1-phosphate transferase) are implicated in the 543
recognition of UDP-N-acetylglucosamine. Microbiology 147:3015-3025. 544
5. Amer, A. O., and M. A. Valvano. 2002. Conserved aspartic acids are essential for the 545
enzymic activity of the WecA protein initiating the biosynthesis of O-specific 546
lipopolysaccharide and enterobacterial common antigen in Escherichia coli. 547
Microbiology 148:571-582. 548
6. Amer, A. O., and M. A. Valvano. 2000. The N-terminal region of the Escherichia coli 549
WecA (Rfe) protein containing three predicted transmembrane helices is required for 550
function but not for membrane insertion. J. Bacteriol. 182:498-503. 551
7. Baase, W. A., A. E. Eriksson, X. J. Zhang, D. W. Heinz, U. Sauer, M. Blaber, E. P. 552
Baldwin, J. A. Wozniak, and B. W. Matthews. 1992. Dissection of protein structure 553
and folding by directed mutagenesis. Faraday Discuss:173-181. 554
8. Bogdanov, M., W. Zhang, J. Xie, and W. Dowhan. 2005. Transmembrane protein 555
topology mapping by the substituted cysteine accessibility method (SCAMTM
): 556
application to lipid-specific membrane protein topogenesis. Methods 36:148-171. 557
9. Bugg, T. D., and P. E. Brandish. 1994. From peptidoglycan to glycoproteins: common 558
features of lipid-linked oligosaccharide biosynthesis. FEMS Microbiol. Lett. 119:255-559
262. 560
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
25
10. Burda, P., and M. Aebi. 1999. The dolichol pathway of N-linked glycosylation. 561
Biochim Biophys Acta 1426:239-257. 562
11. Claros, M. G., and G. von Heijne. 1994. TopPred II: an improved software for 563
membrane protein structure predictions. Comput. Appl. Biosci. 10:685-686. 564
12. Cunneen, M. M., and P. R. Reeves. 2008. Membrane topology of the Salmonella 565
enterica serovar Typhimurium Group B O-antigen translocase Wzx. FEMS Microbiol. 566
Lett. 287:76-84. 567
13. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes 568
in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. 569
14. Doerrler, W. T., and C. R. H. Raetz. 2002. ATPase activity of the MsbA lipid flippase 570
of Escherichia coli. J. Biol. Chem. 277:36697-36705. 571
15. Doerrler, W. T., M. C. Reedy, and C. R. H. Raetz. 2001. An Escherichia coli mutant 572
defective in lipid export. J. Biol. Chem. 276:11461-11464. 573
16. Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. High efficiency transformation 574
of E. coli by high voltage electroporation. Nucleic Acids Res. 16:6127-6145. 575
17. Drew, D., D. Sjöstrand, J. Nilsson, T. Urbig, C.-n. Chin, J.-W. de Gier, and G. von 576
Heijne. 2002. Rapid topology mapping of Escherichia coli inner-membrane proteins by 577
prediction and PhoA/GFP fusion analysis. Proc. Natl. Acad. Sci. USA 99:2690-2695. 578
18. Feilmeier, B. J., G. Iseminger, D. Schroeder, H. Webber, and G. J. Phillips. 2000. 579
Green fluorescent protein functions as a reporter for protein localization in Escherichia 580
coli. J. Bacteriol. 182:4068-4076. 581
19. Feldman, M. F., C. L. Marolda, M. A. Monteiro, M. B. Perry, A. J. Parodi, and M. 582
A. Valvano. 1999. The activity of a putative polyisoprenol-linked sugar 583
translocase(Wzx) involved in Escherichia coli O antigen assembly is independent of the 584
chemical structure of the O repeat. J. Biol. Chem. 274:35129-35138. 585
20. Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, 586
modulation, and high-level expression by vectors containing the arabinose pBAD 587
promoter. J. Bacteriol. 177:4121-30. 588
21. Helenius, J., and M. Aebi. 2002. Transmembrane movement of dolichol linked 589
carbohydrates during N-glycoprotein biosynthesis in the endoplasmic reticulum. Semin. 590
Cell. Dev. Biol. 13:171-178. 591
22. Helenius, J., D. T. Ng, C. L. Marolda, P. Walter, M. A. Valvano, and M. Aebi. 2002. 592
Translocation of lipid-linked oligosaccharides across the ER membrane requires Rft1 593
protein. Nature 415:447-450. 594
23. Jones, D. T., W. R. Taylor, and J. M. Thornton. 1994. A model recognition approach 595
to the prediction of all-helical membrane protein structure and topology. Biochemistry 596
33:3038-3049. 597
24. Keenleyside, W. J., and C. Whitfield. 1996. A novel pathway for O-polysaccharide 598
biosynthesis in Salmonella enterica serovar Borreze. J. Biol. Chem. 271:28581-28592. 599
25. Lahti, J. L., A. P. Silverman, and J. R. Cochran. 2009. Interrogating and predicting 600
tolerated sequence diversity in protein folds: application to E. elaterium trypsin inhibitor-601
II cystine-knot miniprotein. PLoS Comput Biol 5:e1000499. 602
26. Lehrer, J., K. A. Vigeant, L. D. Tatar, and M. A. Valvano. 2007. Functional 603
characterization and membrane topology of Escherichia coli WecA, a sugar-phosphate 604
transferase initiating the biosynthesis of enterobacterial common antigen and O antigen 605
lipopolysaccharide. J. Bacteriol. 189:2618-2628. 606
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
26
27. Lin, W.-J., and M.-J. Hwang. 1998. VHMPT: a graphical viewer and editor for helical 607
membrane protein topologies. Bioinformatics 14:866-868. 608
28. Liu, D., and P. R. Reeves. 1994. Escherichia coli K12 regains its O antigen. 609
Microbiology 140:49-57. 610
29. Manoil, C. 1991. Analysis of membrane protein topology using alkaline phosphatase and 611
beta-galactosidase gene fusions. Methods Cell. Biol. 34:61-75. 612
30. Manoil, C., and J. Beckwith. 1986. A genetic approach to analyzing membrane protein 613
topology. Science 233:1403-1408. 614
31. Marolda, C. L., P. Lahiry, E. Vinés, S. Saldías, and M. A. Valvano. 2006. 615
Micromethods for the characterization of lipid A-core and O-antigen lipopolysaccharide 616
Methods Mol Biol. 347:237-252. 617
32. Marolda, C. L., L. D. Tatar, C. Alaimo, M. Aebi, and M. A. Valvano. 2006. Interplay 618
of the wzx translocase and the corresponding polymerase and chain length regulator 619
proteins in the translocation and periplasmic assembly of lipopolysaccharide O antigen. J. 620
Bacteriol. 188:5124-5135. 621
33. Marolda, C. L., J. Vicarioli, and M. A. Valvano. 2004. Wzx proteins involved in O 622
antigen biosynthesis function in association with the first sugar of the O-specific 623
lipopolysaccharide subunit. Microbiology 150:4095-4105. 624
34. Marolda, C. L., J. Welsh, L. Dafoe, and M. A. Valvano. 1990. Genetic analysis of the 625
O7-polysaccharide biosynthesis region from the Escherichia coli O7:K1 strain VW187. J. 626
Bacteriol. 172:3590-3599. 627
35. Mazur, A., M. Marczak, J. E. Król, and A. Skorupska. 2005. Topological and 628
transcriptional analysis of pssL gene product: a putative Wzx-like exopolysaccharide 629
translocase in Rhizobium leguminosarum bv. trifolii TA1. Arch. Microbiol. 184:1-10. 630
36. Nikaido, H. 2003. Molecular basis of bacterial outer membrane permeability revisited. 631
Microbiol. Mol. Biol. Rev. 67:593-656. 632
37. Nilsson, J., B. Persson, and G. von Heijne. 2000. Consensus predictions of membrane 633
protein topology. FEBS Lett. 486:267-269. 634
38. Ortega, X., T. A. Hunt, S. Loutet, A. D. Vinion-Dubiel, A. Datta, B. Choudhury, J. 635
B. Goldberg, R. Carlson, and M. A. Valvano. 2005. Reconstitution of O-specific 636
lipopolysaccharide expression in the Burkholderia cenocepacia strain J2315 that is 637
associated with transmissible infections in patients with cystic fibrosis. J. Bacteriol. 638
187:1324-1333. 639
39. Patel, K. B., S. E. Furlong, and M. A. Valvano. 2010. Functional analysis of the C-640
terminal domain of the WbaP protein that mediates initiation of O antigen synthesis in 641
Salmonella enterica. Glycobiology. 642
40. Paulsen, I. T., A. M. Beness, and M. H. Saier. 1997. Computer-based analyses of the 643
protein constituents of transport systems catalysing export of complex carbohydrates in 644
bacteria. Microbiology 143 ( Pt 8):2685-2699. 645
41. Pérez, J. M., M. A. McGarry, C. L. Marolda, and M. A. Valvano. 2008. Functional 646
analysis of the large periplasmic loop of the Escherichia coli K-12 WaaL O-antigen 647
ligase. Mol Microbiol 70:1424-1440. 648
42. Raetz, C. R. H., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu. Rev. 649
Biochem. 71:635-700. 650
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
27
43. Reiner, A. M. 1977. Xylitol and D-arabitol toxicities due to derepressed fructose, 651
galactitol, and sorbitol phosphotransferases of Escherichia coli. J. Bacteriol. 132:166-652
173. 653
44. Ruiz, N., D. Kahne, and T. J. Silhavy. 2006. Advances in understanding bacterial outer-654
membrane biogenesis. Nat. Rev. Microbiol. 4:57-66. 655
45. Ruiz, N., D. Kahne, and T. J. Silhavy. 2009. Transport of lipopolysaccharide across the 656
cell envelope: the long road of discovery. Nat. Rev. Micro. 7:677-683. 657
46. Saldías, M. S., K. Patel, C. L. Marolda, M. Bittner, I. Contreras, and M. A. Valvano. 658
2008. Distinct functional domains of the Salmonella enterica WbaP transferase that is 659
involved in the initiation reaction for synthesis of the O antigen subunit. Microbiology 660
154:440-453. 661
47. Sorgen, P. L., Y. Hu, L. Guan, H. R. Kaback, and M. E. Girvin. 2002. An approach to 662
membrane protein structure without crystals. Proc. Natl. Acad. Sci. U.S.A. 99:14037-663
14040. 664
48. Sperandeo, P., G. Dehò, and A. Polissi. 2009. The lipopolysaccharide transport system 665
of Gram-negative bacteria. Biochim. Biophys. Acta 1791:594-602. 666
49. Sperandeo, P. a., F. K. Lau, A. Carpentieri, C. De Castro, A. Molinaro, G. Dehò, T. 667
J. Silhavy, and A. Polissi. 2008. Functional analysis of the protein machinery required 668
for transport of lipopolysaccharide to the outer membrane of Escherichia coli. J. 669
Bacteriol. 190:4460-4469. 670
50. Stenberg, F., P. Chovanec, S. L. Maslen, C. V. Robinson, L. Ilag, G. von Heijne, and 671
D. O. Daley. 2005. Protein complexes of the Escherichia coli cell envelope. J. Biol. 672
Chem. 280:34409-34419. 673
51. Tatar, L. D., C. L. Marolda, A. N. Polischuk, D. van Leeuwen, and M. A. Valvano. 674
2007. An Escherichia coli undecaprenyl-pyrophosphate phosphatase implicated in 675
undecaprenyl-phosphate recycling. Microbiology 153:2518-2529. 676
52. Tusnády, G. E., and I. Simon. 2001. The HMMTOP transmembrane topology 677
prediction server. Bioinformatics 17:849-850. 678
53. Ulevitch, R. J., J. C. Mathison, and J. da Silva Correia. 2004. Innate immune 679
responses during infection. Vaccine 22 Suppl 1:S25-30. 680
54. Valvano, M. A. 2003. Export of O-specific lipopolysaccharide. Front. Biosci. 8:s452-681
471. 682
55. Viklund, H., and A. Elofsson. 2008. OCTOPUS: improving topology prediction by two-683
track ANN-based preference scores and an extended topological grammar. 684
Bioinformatics 24:1662-1668. 685
56. Vinés, E., C. L. Marolda, A. Balachandran, and M. A. Valvano. 2005. Defective O 686
antigen polymerization in tolA and pal mutants of Escherichia coli in response to 687
extracytoplasmic stress. J. Bacteriol. 187:3359-3368. 688
57. Von Heijne, G. 2006. Membrane-protein topology. Nat Rev Mol Cell Biol 7:909-918. 689
58. Zhou, G. P., and F. A. Troy. 2005. NMR study of the preferred membrane orientation 690
of polyisoprenols (dolichol) and the impact of their complex with polyisoprenyl 691
recognition sequence peptides on membrane structure. Glycobiology 15:347-359. 692
59. Zhou, G. P., and F. A. Troy, 2nd. 2005. NMR studies on how the binding complex of 693
polyisoprenol recognition sequence peptides and polyisoprenols can modulate membrane 694
structure. Curr. Protein Pept. Sci. 6:399-411. 695
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
28
60. Zhou, Z., K. A. White, A. Polissi, C. Georgopoulos, and C. R. Raetz. 1998. Function 696
of Escherichia coli MsbA, an essential ABC family transporter, in lipid A and 697
phospholipid biosynthesis. J. Biol. Chem. 273:12466-12475. 698
699
700
701
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
29
TABLE 1. Strains and plasmids used in this study 701
Strains Relevant propertiesa Source or 702
and plasmids Reference 703
Strains 704
DH5α F- φ80lacZ M15 endA recA hsdR(rK
-mK
-) nupG 705
thi glnV deoR gyrA relA? ∆(lacZYA-argF)U169 Laboratory stock 706
CC118 ∆(ara leu) ∆lac phoA galE galK thi rpsL rpsB argE recA Laboratory stock 707
CLM17 W3110, ∆wzxO16 (33) 708
CLM74 W3110, ∆araCIBAD This study 709
JM109 endA recA gyrA thi, hsd(rK–mK
+) relA supE Δ(lac-proAB) Laboratory stock 710
W3110 rph-1 IN(rrnD-rrnE)1, wbbL::IS5 Laboratory stock 711
712
Plasmids 713
pAH18 pBADNTF expressing the mature FLAG-PhoA This study 714
pAH18-W138PhoA wzx∆(138-463) in pAH18, ApR This study 715
pAH18-F242PhoA wzx∆(242-463) in pAH18, ApR This study 716
pAH18-T288PhoA wzx∆(288-463) in pAH18, ApR This study 717
pAH18-V360PhoA wzx∆(360-463) in pAH18, ApR This study 718
pAH18-K367PhoA wzx∆(367-463) in pAH18, ApR This study 719
pAH18-K367PhoA(PstI) wzx∆(367-463) cloned into pAH18, ApR This study 720
pBAD24 expression vector inducible with arabinose, ApR
(20) 721
pBADNTF pBAD24 for N-terminus FLAG fusions, 722
inducible by arabinose, ApR (33) 723
pBADGFP pBAD24 for C-terminus GFP fusions, 724
inducible by arabinose, ApR (41) 725
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
30
pBADHIS pBAD24 for C-terminus 5x His fusions, 726
inducible by arabinose, ApR (26) 727
pBL1 wzxEcO157-N-terminus FLAG cloned into 728
pBADHIS, 5xHis, ApR This study 729
pBL2 pBL1 expressing wzxEcO157-C102A 5xHis ApR This study 730
pBL3 pBL1 expressing wzxEcO157-C102A,C434A 5xHis ApR This study 731
pBL4 pBL1 expressing wzxEcO157-C102A,C130A,C434A 5xHis, ApR This study 732
pCP20 FLP+, λ cI857
+, Rep
ts, Ap
R, Cm
R λ pR (13) 733
pCM256 wzxEcO157 from pJV7 cloned into pBADGFP, (Wzx-GFP) ApR This study 734
pCM256-K244GFP wzx∆(244-463) in pCM256, ApR This study 735
pCM256-T288GFP wzx∆(288-463) in pCM256, ApR This study 736
pCM256-Q301GFP wzx∆(301-463) in pCM256, ApR This study 737
pCM256-T308GFP wzx∆(308-463) in pCM256, ApR This study 738
pCM256-D320GFP wzx∆(320-463) in pCM256, ApR This study 739
pCM256-K331GFP wzx∆(331-463) in pCM256, ApR This study 740
pCM256-G397GFP wzx∆(397-463) in pCM256, ApR This study 741
pJV7 wzxEcO157 cloned into pBADNTF, ApR (33) 742
pKD4 Template plasmid for mutagenesis, ApR Km
R (13) 743
pKD46 γ, β, and exo from λ phage, araC-ParaB, ApR (13) 744
pMF19 wbbLEcO16 cloned into pEXT21, SpR (19) 745
pML202 pBL1 expressing wzxEcO157-C13A,C102A,C130A,C434A7xHis, ApR This study 746
pML203 pBL1 expressing wzxEcO157 C13A,C102A,C130A,C434A,C449A7xHis, ApR This study 747
748
a Ap, ampicillin; Sp, spectinomycin; Km, kanamycin; 749
750
751
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
31
TABLE 2. Primers used in this study 751
752 753 Gene cloning/ Purpose/ Primer Sequence Restriction 754 mutation vector Enzyme Site 755 756 757 ∆araCIBAD Deletion, 3341 5’-TTATCCAGCAGCGTTTGCTGCATATCCGGTAACTGCGGCGTG 758 5’ fragment TGTAGGCTGGA 759 Deletion, 3342 5’-CGTTACCAATTATGACAACTTGACGGCTACATCATTCACTCA 760 3’ fragment TATGAATATCCTCCTTAG 761 Deletion 3333 5’-AATGAATACACGGTGGATTG 762 verification 763 Deletion 3335 5’-GTTTCGTTTGATTGGCTGTG 764 verification 765 766 wzxEcO157-GFP cloning of 252 5'-GATTAGCGGATCCTACCTGA 767 (pCM256) C-terminal GFP 768 fusion 769 cloning of 3370 5’-GACTAGGCCTTCCTCTTATATTTAACTGTCTATC StuI 770 C-terminal GFP 771 fusion 772 773 GFP fusions Reverse primer GFP 5'- GACTAGGCCTGGGAGTAAAGGAGAAGAACTTTTCAC StuI 774 775 wzxEcO157-K244GFP Forward primer K244 5’-GACTAGGCCTTTTTGTAAACTTTATTAATCGCTTTAT StuI 776 wzxEcO157-T288GFP Forward primer T288 5’-GACTAGGCCTAGTAACACCCAATGTTATAGATAT StuI 777 wzxEcO157-Q301GFP Forward primer Q301 5’-GACTAGGCCTTTGAAATAATCTCTGTGTAATGCT StuI 778 wzxEcO157—T308GFP Forward primer T308 5’-GACTAGGCCTCGTAAGAGGGACCGTAGATATTTG StuI 779 wzxEcO157-D320GFP Forward primer D320 5’-GACTAGGCCTATCTGCATAAGCAGCCCATAACGGGAT StuI 780 wzxEcO157-K331GFP Forward primer K331 5’-GACTAGGCCTTTTTATAAATTGAGTATCATTGCGTGCA StuI 781 wzxEcO157-G397GFP Forward primer G397 5'- GACTAGGCCTACCATTAAAGCTTGCAAATGTAT StuI 782 783 wzxEcO157-FLAG-5xHis pBL1 2317 5’-CTAGCTCGAGTCCTCTTATATTTAACTGTCT) XhoI 784 785 phoA gene gene cloning 4771 5’-CTATCTGCAGCCTGTTCTGGAAAACCGGGCTG PstI 786 gene cloning 4770 5’-AAGCCGCTCTGGGGCTGAAATAAGCTTTAAG) HindIII 787 788 wzxEcO157-K367PhoA(PstI)
a 4769 5’-TTTTGGGCTAGCAGGAGGAATTCAC NheI 789
4772 5’-GAAGTCGTTAATATTTGGACAGAAGGAAAGCTGCAGCCTG PstI 790 791 PhoA fusions Reverse primer 4768 5’-CCTGTTCTGGAAAACCGGGC 792 793 WzxEcO157-K367PhoA/ Forward primer 4764 5’-GAAGTCGTTAATATTTGGACAGAAGGAAAG 794 WzxEcO157-V360PhoA 795 WzxEcO157-T288PhoA Forward primer 4766 5’-GGTGATAACTTTATAATATCTATAACATTGGGTGTTACT 796 WzxEcO157-F242PhoA Forward primer 4767 5’-GGCATGATTGATTGGCAACTAGTAATAAAA 797 WzxEcO157-W138PhoA Forward primer 4816 5’-CAATTAATCTTATTATAAAGCGATTAATAAAGTTTACAAAA 798 799 wzxEcO157-1-K367 verification of 4817 5’-CTGATTGGCGATGGGATGG 800 (pAH18) cloned fragment 801 802 803 a This construct has a PstI site, added to facilitate cloning, which adds two additional amino acids, between K376 and the PhoA reporter (See 804
Materials and Methods). 805 806 807 808 809 810 811 812 813
814
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
32
TABLE 3. Properties of the replacement mutants of the cysteineless WzxEcO157 814
815
Plasmid Biotinylationa Location of O-antigen expression
c 816
Whole cells Vesicles amino acid residueb 817
818
pML203-K144C + ND P 100 819
pML203-K176C ND + C 40 820
pML203-H209C + ND P 90 821
pML203-K244C - + C 60 822
pML203-P254C ND - TM 100 823
pML203-F264C ND - TM 100 824
pML203-D277C + + P 100 825
pML203-G286C ND - ? 100 826
pML203-F293C - - ? 100 827
pML203-R298C + ND P 0 828
pML203-P306C - - TM 70 829
pML203-P313C - - TM 50 830
pML203-D320C - + C 30 831
pML203-R324C - + C 90 832
pML203-K331C - + C 70 833
pML203-K367C + + P 90 834
pML203-K402C ND ND C 80 835
836
a Bacteria were transformed with derivatives of pML203 expressing the cysteineless version of 837
WzxEcO157 carrying single cysteine substitutions at the indicated location. Biotinylation was 838
performed in whole cells and membrane vesicles (see data in Fig. 4). Biotinylation of membrane 839
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
33
vesicles, combined with and without treatment with the blocking reagent MTSET, allowed us to 840
determine the cytoplasmic location of amino acid residues, as described in Results. ND, not 841
determined. 842
b P, periplasm; C, cytoplasm; TM, transmembrane helix; see also Fig. 2 for a graphical location. 843
c O antigen surface expression based on complementation experiments using the strain 844
CLM17/pMF19 (see data in Fig. 5). LPS O antigen was quantified by densitometry as described in 845
Materials and Methods, and the relative expression values are indicated as percent of the 846
expression found in cell lysates of CLM17/pMF19 containing the positive control plasmid 847
pML203, which were included in each gel. 848
849
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
34
Legend to figures 849
FIG. 1. Graphical representation of the topological predictions by the various programs used in 850
this work. The numbers indicate the position of the amino acids in WzxEcO157 (463 amino acids). 851
The location of soluble segments (cytosolic or periplasmic) and the positions of predicted TM 852
helices are indicated. The colored square denotes the region of the protein, roughly between amino 853
acids 260-425, where the predictions showed the greatest differences among the programs used. 854
FIG. 2. LPS profiles (A) and protein expression (B) of CLM17(pMF19) cells expressing 855
parental WzxEcO157 or the constructs containing the single (wzx-1xC-), double (wzx-2xC
-), triple 856
(wzx-3xC-), quadruple (wzx-4xC
-) and quintuple (wzx-5xC
-) cysteine-less constructs. The 857
characteristics of the plasmids pBL1, pBL2, pBL3, pBL4, pML202, and pML203 are indicated in 858
Table 1. A, LPS was prepared from cultures induced with 0.2% (w/v) arabinose. Samples were 859
separated on a 14 % Tricine gel and the gel was stained with silver nitrate. B, Total membranes 860
were prepared from CLM74 cells containing the various constructs and vector control. 20 µg of 861
protein were separated on a 14 % SDS-PAGE, transferred to a nitrocellulose membrane and the 862
blot was incubated with anti-FLAG rabbit polyclonal antibodies. The specific bands were detected 863
with fluorescence using Alexa Flour® 680 anti-mouse IgG antibodies and IRDye800CW anti-864
rabbit IgG antibodies. M, Broad Range Prestained SDS-PAGE Standard (Bio-Rad). 865
FIG. 3. Topological model of WzxEcO157 by a combination of bioinformatics, GFP and PhoA 866
deletion-fusion analyses, and substituted cysteine accessibility (SCAM) experiments. The model 867
was originally derived according to HHMTOP computer program and graphically displayed with 868
VHMPT (27). The residues spanning predicted TM helices are enclosed in dotted boxes. The 869
numbering of periplasmic and cytosolic loops is shown. Small square boxes (in red) and circles 870
indicate residues whose replacement affects and does not affect O antigen production, 871
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
35
respectively. Black-filled small squares and circles indicate the residues labeled with biotin-872
maleimide; grey-filled circles indicate residues that did not react with BM. Rectangular boxes 873
and underlined residues indicate the endpoint of the GFP (green) and PhoA (blue) fusions. Filled 874
boxes indicate the fusions that were positive for fluorescence or alkaline phosphatase activity, as 875
applicable, and clear boxes indicate those that did not fluoresce or were enzymatically inactive. 876
FIG. 4. Labeling experiments with biotin maleimide (BM) with (-) or without (+) MTSET pre 877
treatment performed on cysteine replacement mutants of WzxEcO157. Labeled proteins were isolated 878
by NTA-Ni2+
affinity chromatography and detected with anti-FLAG antibodies as described in 879
Material and Methods. M, Broad Range Prestained SDS-PAGE Standard (Bio-Rad). A, labeling 880
of whole cells; B, labeling of membrane vesicles. 881
FIG. 5. Analysis of wzxEcO157 –GFP fusion constructs. For panels A and B, protein samples 882
were prepared as indicated in the legend to Fig. 1. A, Expression of wild type wzxEcO157 –GFP 883
fusion protein. B, expression of deleted wzxEcO157 –GFP fusion proteins. Proteins from cells 884
expressing: lane 1, WzxEcO157-GFP (~81, kDa; pCM256); lane 2, WzxEcO157-G397GFP (72.2 kDa); 885
lane 3, WzxEcO157-K331GFP (65.3 kDa); lane 4, WzxEcO157-D320GFP (64 kDa); lane 5, WzxEcO157-886
T308GFP (62.6 kDa); lane 6, WzxEcO157-Q301GFP (62 kDa); lane 7, WzxEcO157-T288GFP (60 kDa); lane 8 887
WzxEcO157-K244GFP (53 kDa). C, Fluorescence microscopy of CLM74 cells expressing wzxEcO157 –888
GFP fusion proteins. pCM256 (WzxEcO157-GFP), K331 (WzxEcO157-K331GFP), K244 (WzxEcO157-889
K244GFP), D320 (WzxEcO157-D320GFP). Arrowheads point to the fluorescence accumulated on the cell 890
perimeter, indicating a membrane location of the GFP fusion protein. 891
FIG. 6. O-antigen and WzxEcO157 protein expression in CLM17(pMF19) cells containing 892
plasmids encoding protein constructs with alanine or serine amino acid replacements. A, amino 893
acid replacements located on either periplasmic or cytosolic loops. B, amino acid replacements 894
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
36
located within TM helices. LPS samples were prepared and analyzed as described in the legend to 895
Fig. 1 and in Materials and Methods. The O antigen expression was quantified by densitometry as 896
described in Materials and Methods, and the relative expression values are indicated as percent of 897
the expression found in cell lysates of CLM17(pMF19) containing the positive control plasmid 898
pBL1, which were included in each gel. 899
FIG. 7. O-antigen (upper panel) and wzxEcO157 (lower panel) expression of CLM17(pMF19) 900
cells containing constructs with single amino acids replacements, as indicated, at positions R298, 901
D85, D 326, and K419. LPS and proteins were prepared and analyzed as described in the legend to 902
Fig. 2 and in Materials and Methods. The O antigen expression was quantified by densitometry as 903
described in Materials and Methods, and the relative expression values are indicated as percent of 904
the expression found in cell lysates of CLM17(pMF19) containing the positive control plasmid 905
pBL1, which were included in each gel. 906
907
908
909
910
911
912
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
37
913
Marolda et al. Fig. 1 914
915
916
917
Marolda et al. Fig. 2 918
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
38
919
Marolda et al. Fig. 3 920
921
922
Marolda et al. Fig. 4 923
924
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
39
925
Marolda et al. Fig. 5 926
927
928
929
930
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
40
931
932
Marolda et al. Fig. 6 933
934
935
936
Marolda et al. Fig. 7 937
938
on August 30, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
JOURNAL OF BACTERIOLOGY, Mar. 2011, p. 1291–1292 Vol. 193, No. 50021-9193/11/$12.00 doi:10.1128/JB.01489-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.
ERRATUM
Membrane Topology and Identification of Critical Amino Acid Residues in theWzx O-Antigen Translocase from Escherichia coli O157:H7Cristina L. Marolda, Bo Li, Michael Lung, Mei Yang, Anna Hanuszkiewicz,
Amanda Roa Rosales, and Miguel A. ValvanoCenter for Human Immunology, Siebens-Drake Research Institute, Departments of Microbiology and Immunology and Medicine,
University of Western Ontario, London, N6A 5C1 Ontario, Canada
Volume 192, no. 23, p. 6160-6171, 2010. Page 6160: The title should appear as shown above.Page 6165: Fig. 3 should appear as shown below. (The wzxEcO157 gene was obtained by PCR cloning from genomic DNA of strain
UWO934-88, a clinical isolate of E. coli O157:H7 [Marolda et al., Microbiology 150:4095-4105, 2004], and its amino acid sequenceis identical to that of GenBank accession no. AE005429_8. The amino acid sequence of WzxEcO157 includes an N-terminal fusionto the FLAG epitope. To construct this fusion, the first Met of wild-type WzxEcO157 was changed to Gly [position 1/13]. The aminoacid numbers in the figure correspond to the original positions in the wild-type protein [Gly-13 corresponds to Met-1]. The tyrosineresidue at position 319 in the original figure was misplaced, and its normal location is at position 253. The methionine at position405 was displaced graphically but is actually located at the end of cytosolic loop 5.)
FIG. 3.
1291
Page 6168: Table 3 should appear as shown below (column heads have been corrected).
TABLE 3.
Plasmid
BiotinylationaLocation ofamino acid
residueb
O-antigenexpressioncWhole
cells Vesicles
pML203-K144C � ND P 100pML203-K176C ND � C 40pML203-H209C � ND P 90pML203-K244C � � C 60pML203-P254C ND � TM 100pML203-F264C ND � TM 100pML203-D277C � � P 100pML203-G286C ND � ? 100pML203-F293C � � ? 100pML203-R298C � ND P 0pML203-P306C � � TM 70pML203-P313C � � TM 50pML203-D320C � � C 30pML203-R324C � � C 90pML203-K331C � � C 70pML203-K367C � � P 90pML203-K402C ND ND C 80
1292 ERRATUM J. BACTERIOL.