![Page 1: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/1.jpg)
A couple notes
![Page 2: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/2.jpg)
Lab 4: Transcription and Translation
![Page 3: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/3.jpg)
Where are we today?
![Page 4: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/4.jpg)
Today we’ll go from here... To here
Text
![Page 5: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/5.jpg)
• Transcription:
• Translation:
![Page 6: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/6.jpg)
• Transcription: writing again
• Translation:
![Page 7: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/7.jpg)
• Transcription: writing again
• Translation: changing languages
![Page 8: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/8.jpg)
Off to see the wizard...
• DNA replication
– both strands => new DNA
– => new cell
• Transcription– 1 strand => new RNA– => new protein
Sending ‘messages’ out from DNA
![Page 9: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/9.jpg)
Amino Acids
• You & partner have an amino acid; which is it? (homepage => quick refs -> amino acids)
![Page 10: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/10.jpg)
Amino Acids
• How are they similar?
• How are they different?
• What do the differences mean in terms of “feel”?
• How many are there?
• Possible?
![Page 11: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/11.jpg)
Nucleic Acids• How are they similar?• How are they different?• What do the differences mean in terms of
“feel”?• Which is more diverse in terms of shape
and ‘feel’?• Which would allow for more diverse
shapes and surfaces when ‘connected’?
![Page 12: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/12.jpg)
A little Vocab
• DNA
• mRNA
• rRNA
• tRNA
• Codon
• Anticodon
![Page 13: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/13.jpg)
How does a codon ‘mean’ an amino acid?
![Page 14: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/14.jpg)
Translation
• Short video– http://www.youtube.com/watch?v=5bLEDd-PS
TQ
![Page 15: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/15.jpg)
The Play is the thing…
![Page 16: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/16.jpg)
The Play is the thing…
Or, Fun With Blocks
![Page 17: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/17.jpg)
The Play is the thing…
• ‘Types of Bonds’– Velcro – can be easily broken/re-made
during lab– Duct tape – breaking it gets you a zero (0)
for this week’s quiz
![Page 18: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/18.jpg)
The Play is the thing…
• The Players
![Page 19: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/19.jpg)
The Play is the thing…
• The Players– tRNA
![Page 20: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/20.jpg)
The Play is the thing…
• The Players– tRNA– Ribosome
![Page 21: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/21.jpg)
The Play is the thing…
• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase
![Page 22: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/22.jpg)
The Play is the thing…
• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase– RNA polymerase
![Page 23: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/23.jpg)
The Play is the thing…
• The Players– tRNA (4 people)– Ribosome (1)– Aminoacyl tRNA synthetase (4)– RNA polymerase (1-2) * and RNA– Termination factor (1)
Numbers are per molecule for 2 molecules going at once
![Page 24: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/24.jpg)
Learning your ‘lines’
• Handout: In pairs, answer questions related to your task
• Lab manual, textbook, internet OK as sources
• Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts
5’ end is pointy/spiky3’ end is soft/furry
![Page 25: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/25.jpg)
DNA Template
• 5’ CTTAAATCCGAATGCCCATG 3’
5’ is “sticky”, 3’ is “fuzzy”
![Page 26: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/26.jpg)
5’ CTTAAATCCGAATGCCCATG 3’5’ is “sticky”, 3’ is “fuzzy”
![Page 27: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/27.jpg)
Wielding the Power
• ‘Recall’ that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit
• Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!
![Page 28: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/28.jpg)
Walk-through with 1 tRNA• Everybody watches visits to synthetase,
ribosome• In reality, how is everyone finding each
other?• In the real world, everything is happening
all the time; all is happenstance
![Page 29: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/29.jpg)
Ready?• mRNA at the central bench
• ribosome assembles around it
• synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA)
• tRNAs will ‘diffuse’ by following a path through the room
• When any event first happens*, action stops, molecules involved will announce, explain
• Go until a protein happens
Includes ‘didn’t work’
![Page 30: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/30.jpg)
“Who” knows what’s going on?
• What happens if a tRNA carries the wrong amino acid?
• What happens if the mRNA contains a copy error relative to DNA?
• What happens if a tRNA has a mutated anticodon
![Page 31: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/31.jpg)
Meet your new best friends
![Page 32: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/32.jpg)
Protocol
• ½ inch layer of milk onto plate
• 1 drop of each food coloring onto various locations around perimeter
• Dab wooden stick with detergent
• Touch stick to center of milk
• Observe!
• Hypothesize!
• Open rubric
![Page 33: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/33.jpg)
33
Power Balance
![Page 34: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/34.jpg)
34
Background• I want to talk to you briefly about a
product.
• According to a number of testimonials, it can...– improve your balance– improve your athletic performance
![Page 35: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/35.jpg)
35
Says who?
“I don’t really do a lot of testimonials, but this really works! I came across Power Balance when someone did the test on me. That night, while playing for the Phoenix Suns, there were about three of my teammates with the product on and we won that game by 57 points! I kept feeling something when I wore the bracelet, so I kept wearing it. When I took it off I went back to normal. I’ve been wearing the bracelet ever since. I want to do everything to get the slightest advantage; wristbands, necklaces, t-shirts, band-aids, everything and anything we can get our hands on. I’m here to tell you it works!”
SHAQUILLE O'NEAL
![Page 36: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/36.jpg)
36
How does it do that?• According to the company:
...its Performance Technology that uses holograms embedded with frequencies designed to work positively with your body’s natural energy field
--Power Balance websitehttp://www.powerbalance.com
![Page 37: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/37.jpg)
37
Offer• I can get you these for 1/2 off the website’s
selling price of $30• You can take home one of the used ones today
for $10• Anybody interested?
![Page 38: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/38.jpg)
38
Offer• I can get you these for 1/2 off the website’s selling price
of $30• You can take home one of the used ones today for $10• Anybody interested?• What would it take to persuade you?
![Page 39: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/39.jpg)
39
Turn in…• Write names of all group members and
hand in
![Page 40: A couple notes. Lab 4: Transcription and Translation](https://reader036.vdocument.in/reader036/viewer/2022062423/56649e9d5503460f94b9e066/html5/thumbnails/40.jpg)