Download - Basics of bioinformatics
![Page 1: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/1.jpg)
Need & Emergence of the Field
Speaker Shashi Shekhar Head of computational Section Biowits Life Sciences
![Page 2: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/2.jpg)
The marriage between computer science and molecular biology ◦ The algorithm and techniques of computer science
are being used to solve the problems faced by molecular biologists
‘Information technology applied to the
management and analysis of biological data’ ◦ Storage and Analysis are two of the important
functions – bioinformaticians build tools for each.
![Page 3: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/3.jpg)
Biology
Chemistry
Statistics
Computer Science
Bioinformatics
![Page 4: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/4.jpg)
The need for bioinformatics has arisen from the recent explosion of publicly available genomic information, such as resulting from the Human Genome Project.
Gain a better understanding of gene analysis, taxonomy, & evolution.
To work efficiently on the rational drug designs and reduce the time taken for the development of drug manually.
![Page 5: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/5.jpg)
To uncover the wealth of Biological information hidden in the mass of sequence, structure, literature and biological data.
It is being used now and in the foreseeable future in the areas of molecular medicine.
It has environmental benefits in identifying waste and clean up bacteria.
In agriculture, it can be used to produce high yield, low maintenance crops.
![Page 6: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/6.jpg)
Molecular Medicine
Gene Therapy
Drug Development
Microbial genome applications
Crop Improvement
Forensic Analysis of Microbes
Biotechnology
Evolutionary Studies
Bio-Weapon Creation
![Page 7: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/7.jpg)
In Experimental Molecular Biology
In Genetics and Genomics
In generating Biological Data
Analysis of gene and protein expression
Comparison of genomic data
Understanding of evolutionary aspect of Evolution
Understanding biological pathways and networks in System Biology
In Simulation & Modeling of DNA, RNA & Protein
![Page 8: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/8.jpg)
Bioinformatics lecture March 5, 2002
organisation of knowledge
(sequences, structures,
functional data)
e.g. homology
searches
![Page 9: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/9.jpg)
Prediction of structure from sequence
◦ secondary structure
◦ homology modelling, threading
◦ ab initio 3D prediction
Analysis of 3D structure
◦ structure comparison/ alignment
◦ prediction of function from structure
◦ molecular mechanics/ molecular dynamics
◦ prediction of molecular interactions, docking
Structure databases (RCSB)
![Page 10: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/10.jpg)
![Page 11: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/11.jpg)
Sequence Similarity
Tools used for sequence similarity searching
There uses in biology or to us
Databases
Different types of databases
![Page 12: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/12.jpg)
One could align the sequence so that many corresponding residues match.
Strong similarity between two sequences is a strong argument for their homology.
Homology: Two(or more) sequences have a common ancestor.
Similarity: Two(or more) sequences are similar by some criterion, and it does not refer to any historical process.
![Page 13: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/13.jpg)
To find the relatedness of the proteins or gene, if they have a common ancestor or not.
Mutation in the sequences, brings the changes or divergence in the sequences.
Can also reveal the part of the sequence which is crucial for the functioning of gene or protein.
![Page 14: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/14.jpg)
Optimal Alignment: The alignment that is the best, given a defined set of rules and parameter values for comparing different alignments.
Global Alignment: An alignment that assumes that the two proteins are basically similar over the entire length of one another. The alignment attempts to match them to each other from end to end.
Local Alignment: An alignment that searches for segments of the two sequences that match well. There is no attempt to force entire sequences into an alignment, just those parts that appear to have good similarity.
(contd.)
![Page 15: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/15.jpg)
Gaps & Insertions: In an alignment, one may achieve much better correspondence between two sequences if one allows a gap to be introduced in one sequence. Equivalently, one could allow an insertion in the other sequence. Biologically this corresponds to an mutation event.
Substitution matrix: A Substitution matrix describes the two residue types would mutate to each other in evolutionary time. This is used to estimate how well two residues of given types would match if they were aligned in a sequence alignment.
Gap Penalty: The gap penalty is used to help decide whether or not to accept a gap or insertion in an alignment when it is possible to achieve a good alignment residue to residue at some other neighboring point in the sequence.
![Page 16: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/16.jpg)
Similarity indicates conserved function
Human and mouse genes are more than 80% similar at sequence level
But these genes are small fraction of genome
Most sequences in the genome are not recognizably similar
Comparing sequences helps us understand function
◦ Locate similar gene in another species to understand your new gene
![Page 17: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/17.jpg)
Match score: +1
Mismatch score: +0
Gap penalty: –1
ACGTCTGATACGCCGTATAGTCTATCT
||||| ||| || ||||||||
----CTGATTCGC---ATCGTCTATCT
Matches: 18 × (+1)
Mismatches: 2 × 0
Gaps: 7 × (– 1)
Score = +11
![Page 18: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/18.jpg)
We want to find alignments that are evolutionarily likely. Which of the following alignments seems more likely to
you?
We can achieve this by penalizing more for a new gap, than for extending an existing gap
ACGTCTGATACGCCGTATAGTCTATCT
ACGTCTGAT-------ATAGTCTATCT
ACGTCTGATACGCCGTATAGTCTATCT
AC-T-TGA--CG-CGT-TA-TCTATCT
![Page 19: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/19.jpg)
Match/mismatch score: +1/+0
Origination/length penalty: –2/–1
ACGTCTGATACGCCGTATAGTCTATCT
||||| ||| || ||||||||
----CTGATTCGC---ATCGTCTATCT
Matches: 18 × (+1)
Mismatches: 2 × 0
Origination: 2 × (–2)
Length: 7 × (–1)
Score = +7
![Page 20: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/20.jpg)
Alignment scoring and substitution matrices
Aligning two sequences
◦ Dotplots
◦ The dynamic programming algorithm
◦ Significance of the results
Heuristic methods
◦ FASTA
◦ BLAST
◦ Interpreting the output
![Page 21: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/21.jpg)
Examples:
Staden: simple text file, lines <= 80 characters
FASTA: simple text file, lines <= 80 characters, one line header marked by ">"
GCG: structured format with header and formatted sequence
Sequence format descriptions e.g. on http://www.infobiogen.fr/doc/tutoriel/formats.html
![Page 22: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/22.jpg)
Local sequence comparison:
assumption of evolution by point mutations
◦ amino acid replacement (by base replacement)
◦ amino acid insertion
◦ amino acid deletion
scores:
◦ positive for identical or similar
◦ negative for different
◦ negative for insertion in one of the two sequences
![Page 23: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/23.jpg)
Simple comparison without alignment
Similarities between sequences show up in 2D diagram
![Page 24: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/24.jpg)
identity (i=j)
similarity of sequence with other parts of itself
![Page 25: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/25.jpg)
The 1st alignment: highly significant
The 2nd: plausible
The 3rd: spurious
Distinguish by alignment score
Similarities increase score
Mismatches decrease score
Gaps decrease score
substitution matrix
gap penalties
![Page 26: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/26.jpg)
Substitution matrix weights replacement of one residue by another:
◦ Similar -> high score (positive)
◦ Different -> low score (negative)
Simplest is identity matrix (e.g. for nucleic acids)
A C G T
A 1 0 0 0
C 0 1 0 0
G 0 0 1 0
T 0 0 0 1
![Page 27: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/27.jpg)
PAM matrix series (PAM1 ... PAM250):
◦ Derived from alignment of very similar sequences
◦ PAM1 = mutation events that change 1% of AA
◦ PAM2, PAM3, ... extrapolated by matrix multiplication
e.g.: PAM2 = PAM1*PAM1; PAM3 = PAM2 * PAM1 etc
Problems with PAM matrices:
◦ Incorrect modelling of long time substitutions, since conservative mutations dominated by single nucleotide change
◦ e.g.: L <–> I, L <–> V, Y <–> F long time: any Amino Acid change
![Page 28: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/28.jpg)
positive and negative values
identity score depends on residue
![Page 29: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/29.jpg)
BLOSUM series (BLOSUM50, BLOSUM62, ...)
derived from alignments of distantly related sequence
BLOCKS database:
◦ ungapped multiple alignments of protein families
at a given identity
BLOSUM50 better for gapped alignments
BLOSUM62 better for ungapped alignments
![Page 30: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/30.jpg)
Blosum62 substitution matrix
![Page 31: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/31.jpg)
Significance of alignment:
Depends critically on gap penalty
Need to adjust to given sequence
Gap penalties influenced by knowledge of structure etc.
Simple rules when nothing is known (linear or affine)
![Page 32: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/32.jpg)
Dynamic programming = build up optimal alignment using previous solutions for optimal alignments of subsequences.
The dynamic programming relies on a principle of optimality. This principle states that in an optimal sequence of decisions or choices, each subsequence must also be optimal.
The principle can be related as follows: the optimal solution to a problem is a combination of optimal solutions to some of its sub-problems.
![Page 33: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/33.jpg)
Construct a two-dimensional matrix whose axes are the two sequences to be compared.
The scores are calculated one row at a time. This starts with the first row of one sequence, which is used to scan through the entire length of the other sequence, followed by scanning of the second row.
The scanning of the second row takes into account the scores already obtained in the first round. The best score is put into the bottom right corner of an intermediate matrix.
This process is iterated until values for all the cells are filled.
![Page 34: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/34.jpg)
Contd.
![Page 35: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/35.jpg)
Contd.
![Page 36: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/36.jpg)
The results are traced back through the matrix in reverse order from the lower right-hand corner of the matrix toward the origin of the matrix in the upper left-hand corner.
The best matching path is the one that has the maximum total score.
If two or more paths reach the same highest score, one is chosen arbitrarily to represent the best alignment.
The path can also move horizontally or vertically at a certain point, which corresponds to introduction of a gap or an insertion or deletion for one of the two sequences.
![Page 37: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/37.jpg)
![Page 38: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/38.jpg)
Global alignment (ends aligned)
◦ Needleman & Wunsch, 1970
Local alignment (subsequences aligned)
◦ Smith & Waterman, 1981
Searching for repetitions
Searching for overlap
![Page 39: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/39.jpg)
![Page 40: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/40.jpg)
Multi-step approach to find high-scoring alignments
Exact short word matches
Maximal scoring ungapped extensions
Identify gapped alignments
![Page 41: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/41.jpg)
Contd.
![Page 42: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/42.jpg)
![Page 43: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/43.jpg)
FASTA also uses E-values and bit scores. The FASTA output provides one more statistical parameter, the Z-score.
This describes the number of standard deviations from the mean score for the database search.
Most of the alignments with the query sequence are with unrelated sequences, the higher the Z-score for a reported match, the further away from the mean of the score distribution, hence, the more significant the match.
For a Z-score > 15, the match can be considered extremely significant, with certainty of a homologous relationship.
If Z is in the range of 5 to 15, the sequence pair can be described as highly probable homologs.
If Z < 5, their relationships is described as less certain.
![Page 44: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/44.jpg)
Multi-step approach to find high-scoring alignments
List words of fixed length (3AA) expected to give score larger than threshold
For every word, search database and extend ungapped alignment in both directions
New versions of BLAST allow gaps
![Page 45: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/45.jpg)
Contd.
![Page 46: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/46.jpg)
![Page 47: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/47.jpg)
The E-value provides information about the likelihood that a given sequence match is purely by chance. The lower the E-value, the less likely the database match is a result of random chance and therefore the more significant the match is.
If E < 1e − 50 (or 1 × 10−50), there should be an extremely high confidence that the database match is a result of homologous relationships.
If E is between 0.01 and 1e − 50, the match can be considered a result of homology.
If E is between 0.01 and 10, the match is considered not significant, but may hint at a tentative remote homology relationship. Additional evidence is needed.
If E > 10, the sequences under consideration are either unrelated or related by extremely distant relationships that fall below the limit of detection with the current method.
![Page 48: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/48.jpg)
Various versions:
Blastn: nucleotide sequences
Blastp: protein sequences
tBlastn: protein query - translated database
Blastx: nucleotide query - protein database
tBlastx: nucleotide query - translated database
![Page 49: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/49.jpg)
Very fast growth of biological data
Diversity of biological data: ◦ Primary sequences
◦ 3D structures
◦ Functional data
Database entry usually required for publication ◦ Sequences
◦ Structures
Database entry may replace primary publication ◦ Genomic approaches
![Page 50: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/50.jpg)
Nucleic Acid Protein
EMBL (Europe) PIR -
Protein Information
Resource
GenBank (USA) MIPS
DDBJ (Japan) SWISS-PROT
University of Geneva,
now with EBI
TrEMBL
A supplement to SWISS-
PROT
NRL-3D
![Page 51: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/51.jpg)
Three databanks exchange data on a daily basis
Data can be submitted and accessed at either location
GenBank
◦ www.ncbi.nlm.nih.gov/Genbank/GenbankOverview.html
EMBL
◦ www.ebi.ac.uk/embl/index.html
DNA Databank of Japan (DDBJ)
◦ www.nig.ac.jp/home.html
![Page 52: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/52.jpg)
As there are many databases which one to search? Some are good in some aspects and weak in others?
Composite databases is the answer – which has several databases for its base data
Search on these databases is indexed and streamlined so that the same stored sequence is not searched twice in different databases.
![Page 53: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/53.jpg)
OWL has these as their primary databases.
◦ SWISS PROT (top priority)
◦ PIR
◦ GenBank
◦ NRL-3D
![Page 54: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/54.jpg)
Store secondary structure info or results of searches of the primary databases.
Composite
Databases
Primary Source
PROSITE SWISS-PROT
PRINTS OWL
![Page 55: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/55.jpg)
We have sequenced and identified genes. So we know what they do.
The sequences are stored in databases.
So if we find a new gene in the human genome we compare it with the already found genes which are stored in the databases.
Since there are large number of databases we cannot do sequence alignment for each and every sequence
So heuristics must be used again.
![Page 56: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/56.jpg)
Applications:- Bioinformatics joins mathematics, statistics, and computer science and information technology to solve complex biological problems.
Sequence Analysis:- The application of sequence analysis determines those genes which encode regulatory sequences or peptides by using the information of sequencing. These computers and tools also see the DNA mutations in an organism and also detect and identify those sequences which are related. Special software is used to see the overlapping of fragments and their assembly.
Contd.
![Page 57: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/57.jpg)
Prediction of Protein Structure:- It is easy to determine the primary structure of proteins in the form of amino acids which are present on the DNA molecule but it is difficult to determine the secondary, tertiary or quaternary structures of proteins. Tools of bioinformatics can be used to determine the complex protein structures.
Genome Annotation:- In genome annotation, genomes are marked to know the regulatory sequences and protein coding. It is a very important part of the human genome project as it determines the regulatory sequences.
![Page 58: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/58.jpg)
Comparative Genomics:- Comparative genomics is the branch of bioinformatics which determines the genomic structure and function relation between different biological species. For this purpose, intergenomic maps are constructed which enable the scientists to trace the processes of evolution that occur in genomes of different species.
Health and Drug discovery:- The tools of bioinformatics are also helpful in drug discovery, diagnosis and disease management. Complete sequencing of human genes has enabled the scientists to make medicines and drugs which can target more than 500 genes.
![Page 59: Basics of bioinformatics](https://reader036.vdocument.in/reader036/viewer/2022081505/554fb5dfb4c9057b298b53e4/html5/thumbnails/59.jpg)