Cell Cycle, Cell Growth and Differentiation
Chapter 7Pages 214-244
Saving burns victims
In 2003, Bali, Indonesia, 28 Australians were badly wounded and burnt as a result of the terrorist bombings that had occurred
These people were returned to Australia as soon as possible for treatment by Professor Fiona Wood, who for about 10 years prior to 2003 had been developing improved methods for growing replacement skin.
‘Spray-on skin’, known commercially as CellSpray lead to it and Professor Wood becoming famous.
In 2005 she was made Australian of the Year in recognition of her work related to treatment of people with severe burns.
Skin: the outer layer
Normal intact skin provides a covering for the human body. The skin is composed of an outer epidermis and an underlying dermis. The epidermis and the dermis are held together by a non-cellular basement membrane.
The epidermis consists of several cell layers:
an outermost region consisting of layers of flattened dead cells
several layers of living cells called keratinocytes
a basal layer which includes stem cells that are constantly dividing. For each two cells produced by division of a stem cell, one becomes a new keratinocyte and the other replaces the stem cell. The continual division of stem cells in the basal layer pushes the overlying keratinocytes towards the skin surface. Another group of cells present in the basal layer are the pigment-producing cells, or melanocytes.
First-degree burns, such as sunburn, involve the epidermis only
Second-degree burns, such as scalds, involve the epidermis and the upper section of the dermis
Severe third-degree burns destroy the epidermis and all or part of the dermis. Burns of this type were those seen in the seriously burnt victims of the Bali bombing and those who are badly burnt in bushfires in this country.
What treatments were available in the past?
Skin grafts Skin is taken from an uninjured part of the victim’s body. Issues?
Covering a burn area with a thin sheet of skin cells grown in plastic dishes in a laboratory. Issues?
Synthetic skin can be used for skin grafts. One example is Integra Template. The outer layer of this artificial skin is a thin film of
silicone, and the second layer is made of cross-linked fibrous proteins (collagen) and a complex carbohydrate (glycosaminoglycan). Synthetic skin is used to cover the burnt area where it acts as a scaffold that enables the patient’s own dermal cells to regenerate the skin dermis. Then the silicone film is removed and covered with a thin epidermal skin graft, thus replacing the skin epidermis.
Spray treatments for burns
Professor Wood’s research first led to the development of a spray-on solution of skin cells, or CellSpray, that contained a suspension of various skin cells.
The cells came from skin harvested from unburnt areas of a patient’s skin.
These cells were first cultured in the laboratory for a period of about 5 days, during which their numbers increased by cell division. Later, when sprayed over a burn area, the cells spread and continued to divide forming a layer of skin.
A further development of this technology is ReCell® Spray on Skin®. The time interval from taking cells from a patient to applying these cells to a burn area on that patient is about 30 minutes.
ReCell Spray on Skin technology is used in conjunction with skin grafts for deep or third-degree burns. In cases of limited thickness or second-degree burns, the technology is used alone and can cover burn areas up to about 1900 cm2. Once the cell suspension is applied to a burn area, the basal stem cells will multiply through repeated cell cycles and, over time, the skin lost by the burn damage will be replaced.
The science involved…
Living skin cells are able to regenerate.
We continually shed our old skin cells and so we continually need to replace them.
Skin cells are continually being replaced by the cell cycle, a process that results in the production of two new cells, each identical to the parent cell that gave rise to
them.
Mitosis is an important part of that cycle and involves the replication of the genetic material in the cell. The cytoplasm of a cell is shared between the two new cells at cytokinesis.
Where to next?
Unit 1:
Life-sustaining processes of the whole organism
Unit 2:
Life continuing processes of the whole organism and, as such, the replacement of individual parts and reproduction of the
whole organism
Desirable characteristics of plants
How do you minimise undesirable characteristics?
Selective breeding?
Issues with this? $$$ Other crops around what you have
can reduce yield i.e. pollination, fungal spores
Farmers therefore use vegetative propagation!
Other field Other field Other field
Other field Your field Other field
Other field Other field Other field
Grafting
A cutting is taken off a mother plant (the scion) and a fork is made in the plant with will be grafted to (the stock).
The two are fit together and then secured
Example: trees, shrubs, roses
Tubers/Bulbs
Certain plants produce tubers or bulbs and when these structures are cut or separated, certain parts will grow into a new plant with the right conditions.
Runners (or stolons)
A structure that some plants send out above ground. When a node on a runner makes contact with soil, roots are sent down to establish a new plant.
Rhizomes
A structure that some plants send out underground. New shoots/stems and roots grow along the rhizome and if separated grow into new plants.
How do these methods produce plants identical to the parent plant?
There must be transference of information/instructions/blueprints that give the parent plant its desirable traits.
Vegetative propagation
A method of asexual reproduction is where an organism genetically identical to the parent is grown without the production of spores or seeds.
The new organism is a clone of the parent.
Chromosomes can be:
i.e Nuclear chromosomes
i.e Bacterial chromosomes
Linear Circular
Sort the chromosomes
1. Empty the bag of chromosomes onto your table
2. Working as a team, sort the chromosomes
3. Are there any other ways that you might be able to sort them?
Chromosome modelling activity
Kangaroo
Homologous chromosomes:• One comes
from the mother, one from the father.
• They are similar but not identical.
• Each carries the same genes in the same order, but the alleles for each trait may not be the same.
Sex chromosomes: This means it
will be a MALE Joey
Autosomes: 6 pairs in a kangaroo
(22 in a human)
Geneo Section of DNA that controls a
certain trait e.g. eye colour, hair colour
Alleleo Specific variations of the gene,
can be recessive or dominant e.g. brown eyes, blue eyes, blonde hair, black hair
Locuso The location on a chromosome
that a gene is found (the locus for eye colour is found near the top of chromosome 1)
E e
m M
gG
HH
cc
Bb
aA
X-chromosome is much larger and carries more genes than the Y-chromosome. They are not genetically identical.
Heterozygous Homozygous
Telomeres
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
Asexual reproduction
A process where the genome of an organism is copied and passed on to offspring. The offspring are genetically identical to the parent.
Plant tissue culture
A sample of plant tissue is collected and sterilised
It is treated with hormones
An undifferentiated cell mass is formed
Sections are collected and treated to grow into new plants.
https://www.youtube.com/watch?v=L7lOL3YW4m8
The benefits of variation
Disease hits crop
Death
Clone with a new trait
Clone
• Variation can increase a species ability to adapt to changes in their environment• Can also introduce new crops with greater yields/quality
Genetically Engineering a Genetically Modified Organism (GMO)
GMO – An organism that has had its DNA, or more specifically genes, altered through the use of genetic engineering techniques.
The potential for this may help to solve problems for farmers, such as insecticides, keeping a consistent crop etc.
Desirable trait
Other types of asexual reproduction
Fission
Amoebae are single celled organisms that reproduce via binary fission
This is the division of a parent nucleus by mitosis and then division of the cytoplasm to produce two new daughter cells
Budding
This involves the development of a new organism or parts of an organism which form from an outgrowth of the parent organism e.g. Hydra, yeast
Spore formation
Spores are single-celled structures formed by cell division in a parent organism.
They are hardy, self-contained capsules that contain DNA
These are easily dispersed by wind, water or animals
Prokaryotes, protists, fungi, ferns and mosses can produce spores.
Review…
Vegetative propagation A process where the genome of an organism is copied and passed on to offspring. The
offspring are genetically identical to the parent.
Reproduction is the creation of a new generation of single cells, single-celled organisms or multicellular organisms.
The production of new cells and new organisms always begins with the division of a single cell.
Cells have evolved complex and exact mechanisms to ensure that genetic information can be passed without error from one cell to two daughter cells of the next generation.
Skin cells are continually being replaced by the cell cycle, a process that results in the production of two new cells, each identical to the parent cell that gave rise to them.
Understanding the process of cell replication
Step 1 – What are chromosomes and DNA?
Step 2 – What is the process of mitosis?
Step 3 – Why do we need mitosis?
What is DNA?
DNA stands for ..................................................................
We refer to the shape as a ................................................
It is made up of three parts
1) ............................................................................
2) ............................................................................
3) ............................................................................
Chains of these together will form DNA.
Adenine will always pair up with .......................................
Cytosine will always pair up with .......................................
Where do chromosomes fit in?
• Chromosomes are structures that are made up of coils of DNA .
• Chromosomes are usually double stranded containing two molecules of DNA which become visible in the nucleus during cell division
• Each strand is an identical copy of the corresponding strand (or chromatid) on the chromosome.
• The position at which the chromosomes are held together is called the centromere
CENTROMERE
CHROMATIDS
How many Chromosomes?
Every species has a certain number of chromosomes unique to them Humans - 46 chromosomes
Blue Whale – 88 chromosomes
Cat – 76 chromosomes
Lettuce – 36 chromosomes
The process of cell division
Cells are constantly being replaced in all organisms. New cells may be required for growth, repair or replacement of dead cells.
This replacement occurs via the multiplication of existing cells through the process of MITOSIS. It is essential that the DNA be correctly copied if the cells are to function normally.
All cells are the products of the division of pre-existing cells. Simple mitotic cell division, or asexual reproduction, normally results in the production of two identical daughter cells, each containing a set of chromosomes identical with those of the parent cell.
Prophase
Metaphase
Anaphase
Telophase
Remember though that this is a continuous process
There are four stages to Mitosis
Standard condition of cell
DNA replicates
Cell enters reproductive cycle with four copies of each chromosome
Interphase
DNA super coils and chromosomes become visible
Nuclear membrane breaks down
Centrosomesmigrate to poles
Prophase
Chromosomes line up centromeres on equator of cell
Centrosomes form spindles
Metaphase
Spindles ‘grip’ centromeres and chromosomes migrate to poles
Anaphase
Nuclear membranes reform
Chromosomes disperse
Cytokinesis begins
Telophase
Both daughter cells are exact copies of the parent cell
Interphase
INTERPHASE
During interphase, a cell grows to roughly twice its original size. While this is occurring, it duplicates its DNA, so that each chromosome is doubled.
During division the duplicate sets are physically separated, and are transported into opposite sides of the cell. The cell then constricts around its equator and pinches in two.
Which stage is which?
Telophase
Metaphase
InterphaseAnaphase
Prophase
1. Growth
2. Replace dead and dying cells
3. Asexual reproduction in some organisms (Binary Fission)
FYI: Each minute your body needs to make
...oh...about 300 MILLION NEW CELLS!
Mitosis/Cell Division is important for 3 main reasons . . .
Applications and emerging issues of cloning in agriculture
Applications and emerging issues of cloning in agriculture
World Dairy Expo. 2013
Clone of Apple Red Apple Red Daughter of Apple Red
Did you know cloning was taking place in agriculture?
Do you know why cloning is taking place in agriculture?
What is your immediate reaction?
Where do you stand in the use of cloning in the cattle industry?
Animal cloning is morally wrong
Disagree Unsure Agree
1 2 9873 64 5 10
Why clone?
Suitability to climate
Market preference
FertilityQuality body type
Dairy – large well attached udder and
carry and deliver calves easily
Beef – muscled and quick maturing
Disease Resistance Low
methane production
Milk yield statistics
Iowa Milk Cow Inventory vs. Annual Milk Production
Source: The Dairy Site, Iowa Dairy Outlook overview, 07 February 2012, Accessed on 25/05/16 fromhttp://www.thedairysite.com/articles/3079/iowa-dairy-outlook-overview/
A carbon tax on methane emissions?
Which animal agricultural practice is producing the most methane gas?
Global estimates of emissions by species. It includes emissions attributed to edible products and to other goods and services, such as draught power and wool. Beef cattle produce meat and non-edible outputs. Dairy cattle produce milk and meat as well as non-edible outputs.
Which is producing the most methane in a per protein basis?
Global emission by commodity. All commodities are expressed as per protein basis. Averages are calculated at global scale and represent an aggregated value across different production systems and agro-ecological zones.
Artificial cloning of mammals – How is it done?
Reproduction in mammals in their natural setting is sexual. Involving fertilisation of an egg by sperm. Usually one fertilisation event typically produces a single offspring.
Recent development now allows for mammals to be cloned using several techniques:
Embryo splitting
Somatic Cell Nuclear Transfer
Embryo splitting to make identical copies
The cow must first be treated with hormones to cause the release of several eggs (super-ovulation).
Does the surrogate mother make any genetic contribution to the embryo?
Embryo splitting to make identical copies
This occurs when the cells of an early embryo are artificially separated, typically into two cell masses (this process mimics the natural process of embryo splitting that produces identical twins or triplets). http://learn.genetics.utah.edu/content/cloning/whatiscloning/
The embryo’s that are split are done so via in-vitro fertilisation (IVF).
This method has been used for some years in the livestock industry e.g. top bull with a prized cow. Instead of one calf being produced, two calves will be produced.
The offspring produced are not genetically identical to either the bull that provided the sperm or the cow that provided the egg. But the two offspring that are produced will be identical to one another.
Somatic cell nuclear transfer – Understanding the biology
Somatic cell nuclear transfer
Remove nucleus from egg cell to
create an enucleated egg
cell
Remove the nucleus from a
somatic cell and place next to
enucleated egg
Nucleus from the somatic cell is place next to the enucleated egg cell and an electrical pulse is delivered to
fuse them together
The embryo is then cultured for a week in
laboratory conditions
The embryo is then transferred
to a surrogate cow/sheep for
gestation
https://www.youtube.com/watch?v=vPvToD6kgmE
Dolly the sheep
February 1997
This was the first case of somatic cell nuclear transfer
The use of adult somatic cells, such as skin cells, to construct new organisms is a remarkable human invention!
This means cells from sterile animals, animals past their reproductive period or even stored cells from dead animals, can provide all of the genetic information of new organisms. In nature, the normal evolutionary processes would not allow these events to occur.
The genetic information in the cloned animal comes from the nucleus of the adult body cell and so the genotype of the cloned animal is determined by the donor nucleus, not by the egg into which the nucleus is transferred.
https://www.youtube.com/watch?v=bbZiOiPVG6c
After Dolly…. What next?
a) Matilda, the first lamb to be cloned in Australia, was born by caesarean section in South Australia. She is pictured here with one of the scientists responsible for the achievement.
b) Suzi, one of two genetically identical Holstein calf clones derived from the skin cell of one cow foetus.
c) cc, shown on the right at 1 year old, was the world’s first cat produced by somatic cell cloning, using a cumulus cell from Rainbow (left).
d) Snuppy, the world’s first dog produced by somatic cell cloning, is shown with the Afghan dog that supplied the ear cell (left) and his surrogate mother, a Labrador (right).
Discuss the following points…
What are the downsides to cloning? Low success rate, fewer than 1% survive beyond birth Those that survive can have abnormalities that can cause early death The death of Dolly in 2003 was caused by lung diseases and arthritis. She was 6 years old
(sheep usually live to around 12). Scientists suggest ageing and telomere length again could be linked, as an adult somatic cell will already have shortened telomeres.
What do you think the public attitudes to cloning are? Mixed Against: is not natural, interferes with nature For: ability to grow tissues which may allow for transplantation down the track It is against the law to clone humans.
What do you think about cloning?
Review questions
Recap 8.3 on page 255
1. Cloning is a process of making an identical copy of an original. Whole organisms or individual genes within an organism can be cloned.
2. Genetic cloning involves the cloning of a single gene; biological cloning involves cloning an entire individual.
3. Embryo splitting is different from nuclear transfer in that an egg is fertilised by a sperm, then the dividing zygote is split. In nuclear transfer, a nucleus from a donor is fused with the cytoplasm of an enucleated egg.
4. Advantages of using cloning in agriculture include the following.
Farmers can quickly increase the number of individuals with desirable traits.
Plants can be propagated using cloning rather than using seeds, reproducing desirable traits.
Plants can be produced all year, rather than waiting for a growing season.
Disadvantages of using cloning in agriculture include the following.
Biodiversity can be reduced.
Genetically identical crops can be at risk of being wiped out by disease or pests.
Diseases can spread more rapidly through a crop.