![Page 1: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/1.jpg)
123
CHAPTER 5
Characterization of microbial community in
activated sludge by Fluorescence in situ
hybridization technique
![Page 2: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/2.jpg)
124
This chapter describes the application of fluorescently labeled oligonucleotide probes to
identify bacterial isolates in pure culture and to detect bacterial community members
directly in the activated sludge samples under the fluorescent microscope. Hybridization
with sludge samples was performed by domain, group/class, genus and species specific
probes. Nocardioform actinomycete and other filamentous bacteria specific probes were
applied on the bacterial pure cultures isolated from the activated sludge process at Dubai
sewage treatment plant.
5.1 Introduction
The activated sludge process, the most widespread technology for wastewater treatment
in most of the countries at present, is an engineered, enhanced self-purification process
for domestic and municipal wastewater. The engineering intensifies the treatment, but
basic understanding of the microorganisms and their activity under different conditions
are keys for its successful operation. The microbial community members (both
filamentous and non-filamentous bacteria) that cause the most common activated sludge
problems -filamentous bulking and foaming are undesirable in excessive concentration.
According to the filamentous backbone theory proposed by Sezgin et al. (1978), bulking
is due to the excessive growth of filamentous bacteria that interfere with the compaction
and settling of the activated sludge either by producing a very diffuse floc structure or by
growing in profusion beyond the confines of the floc into the bulk medium and bridging
between flocs (Jenkins et al., 1993). Another widespread problems in the activated sludge
is the formation of viscous thick stable foam. Such foam appears as bacterial biomass
floating on the surface of the aeration basin. These viscous foams have been associated
with the presence of the filamentous mycolic acid-containing actinomycetes (mycolata).
![Page 3: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/3.jpg)
125
Such foams are often refereed to as Nocardia foams (Soddell et al, 1995) probably
because the first branching actinomycetes isolated from activated sludge foams was
Nocardia (now Gordona) amarae. However, after that a number of different
actinomycetes have also been isolated and identified from foaming plants including
Nocardia, Rhodococcus, Gordona, Tsukamurella and Mycobacterium, as well as other
gram-positive bacteria such as Microthrix parvicella (De Los Reyes et al., 1997).
In 1975, Eikelboom published a breakthrough paper, defining keys using morphology,
physiology and staining characteristics to identify filamentous organisms in activated
sludge. The Eikelboom keys have been invaluable to wastewater professionals. However,
this identification tool has serious limitations. It was found that one Eikelboom type
might not consist of one single phenotype, and that morphological characters are not
reliable indicators for distinguishing phylogenetic groups because the morphology of
some filaments is known to change (Howarth et al., 1999).
Although it has been widely accepted since the late 1980s that the massive growth
of around 30 different filamentous types is responsible for the decreased settleability of
activated sludge, the effects and contributions of specific filament types or species on
bulking is not known. Filamentous bulking studies have been limited primarily by the
inadequacy and inaccuracy of traditional identification methods that use morphology,
physiology and staining characteristics and the lack of quantitative methods for
determining filamentous biomass in situ. The growth of 16S and 23S ribosomal RNA
sequence databases has enabled researchers to use rRNA-targeted hybridization for
studying activated sludge biomass. Oligonucleotide probes targeting specific domains,
genera, species, or even strains have been developed. These probes can be hybridized
either to isolated nucleic acids immobilized on membrane filters (membrane
![Page 4: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/4.jpg)
126
hybridization or Northern blots) or directly to the rRNA in whole, fixed cells (whole-cell
hybridization or Fluorescent In Situ Hybridization). These phylogenetic methods have the
following advantages compared to the traditional identification methods. (1) Molecular
methods are accurate: unlike morphology, physiology and staining characteristics,
conserved phylogenetic identity does not change over time or under different conditions.
(2) The methods can yield target-specific, quantitative data. Fluorescent In Situ
Hybridization or FISH originated in cytogenetics (Vandekken et al., 1990) and clinical
research (Heitz et al., 1991) and is now applied intensively in environmental
microbiology. The method combines the specificity of nucleic acid sequences with the
sensitivity of detection systems based on fluorochromes. FISH combined with digital
image analysis (use of a digital camera, image analysis software and computer) makes it
possible to obtain not only qualitative information from the samples but also quantitative
data. FISH uses fluorescent dyes for detection. The rRNA probes are conjugated with
fluorochromes and are excited by incandescent light (in epifluorescence microscopy) or a
laser (in confocal laser scanning microscopy). The probe, whose own sequence is
complementary to the target rRNA sequence, will only bind to specific rRNA in target
cells, and the rest of the fluorescent probe will be washed off. The samples are fixed onto
microscopic slides and only the cells containing the target sequence will give a sufficient
signal above background when viewed under a proper light source.
To gain insight into activated sludge bulking, following questions remain to be
answered: For a given activated sludge sample, which filamentous bacteria are dominant?
Under what conditions do certain filaments cause bulking, and to what extent? How does
operation affect the bulking problem? To attempt to answer these questions, culture
dependent and independent studies were undertaken to understand the dominant
![Page 5: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/5.jpg)
127
microbial community members (both filamentous and non-filamentous bacteria)
responsible for the most common activated sludge problems, filamentous bulking and
foaming, and thus for the successful plant operation.
5.2. Objectives of the Study
The investigation aimed to find out about the development of the microbial community
structure that was involved in biological removal of wastewater organic pollutants and to
understand how microbial community changes affect overall treatment plant efficiency of
the activated sludge system of Dubai STP. The overall purpose of the study was to
investigate the microbial community and foaming and bulking causing filamentous
bacteria in the activated sludge unit of the sewage treatment plant in Dubai, UAE.
Fluorescence in-situ hybridization ( FISH ) was carried on the mixed liquor and foaming
sludge samples. A series of probes were used to detect the presence of the different
groups and subgroups of bacteria directly within the sludge samples. The abundance of
these groups was obtained numerically through computer analysis of the images taken
when the hybridized samples were examined under the microscope. Moreover, group,
genus and species specific probes were utilized to identify the pure culture isolates from
sludge and foaming samples. The accurate identification and quantification of bulking-
causative organisms may guide future activated sludge modeling and the development of
rational control measures in activated sludge unit of sewage treatment plant in Dubai.
5.3. Materials and methods
5.3.1. Dubai STP
Activated sludge system of Dubai STP from which the samples were extracted, treat
mixed wastewater received mainly from domestic sources. Dubai STP incorporates two
biological treatment stages involving first stage of activated sludge process followed by
![Page 6: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/6.jpg)
128
biological filter stage for the further removal of nutrients like ammonia and remaining
BOD. During the whole period of sampling, treatment plant was overloaded and suffered
heavy foaming problems. Bulking was also observed on two occasions in the month of
January and February, 2007. The measured dissolved oxygen (DO) in all eight aeration
tanks was found to be about 2mg/l. However, a drastic drop in DO up to 0.04 mg/ l was
frequently observed in the distribution tanks (DT) through which treated wastewater
collected from several aeration tanks is combined before passing to the secondary settling
tanks. Due to this reason highly septic conditions prevailed in all the eight secondary
clarifiers. The sampling was started during mild winter month (January) with an average
air temperature of about 25°C and continued till warmer months of May and June with an
average air temperature of 42°C.
5.3.2 Sampling
The samples of mixed liquor and foam (250 ml) were collected from aeration tanks and
secondary clarifier tanks from the activated sludge unit of DSTP located at Al Aweer in
Dubai. Samples were taken on fortnightly basis beginning January, 2007 till June, 2007
spanning between winter and summer period. After collection, samples were stored at
4°C and morphologically characterized within 24 hours of sampling. For the FISH
analysis mixed liquor and foam samples were fixed immediately after collection by
addition of ethanol to a final concentration of 50% (v/v) and in 4% (w/v)
paraformaldehyde according to the procedure described by Schuppler et al., 1998.
5.3.3. Fluorescence In Situ Hybridization
Fluorescence In Situ Hybridization technique was performed on the sludge samples and
pure culture isolates obtained from sludge samples using the methods described in the
previous studies. (Amman, R.I. 1995; Daims et al., 2005). In order to find out the total
![Page 7: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/7.jpg)
129
area occupied by all the bacteria presented in the biomass sample, staining with DAPI (
4,6-diamino-2-phenylindole ) dye was employed. DAPI would stain all the DNA
presented in the sample. Once they were stained, a visual signal would be emitted and
that would be captured by the imaging system. The list of oligonucleotide probes used
in this study and their specificity is given in the table 5.1 and 5.2.
Table 5.1: List of domain and group specific oligonucleotide probes
Probe
name
Percentage
of
Formamide
Sequence of probe
(5` to 3`)
Probe specificity Reference
Eub338 35 GCTGCCTCCCGTAGGA
GT
Domain bacteria Amman et.al (1990)
Eub338II 35 GCAGCCACCCGTAGGT
GT
Domain bacteria
(Planctomycetales) Daims et.al (1999)
Eub338III 35 GCTGCCACCCGTAGGT
GT
Domain bacteria
(Verrucomicrobiale
s)
Daims et.al (1999)
Alpha 1b 25 CGTTCGYTCTGAGCCA
G alpha-
Proteobacteria Manz et.al (1992)
Beta42a 35 GCCTTCCCACTTCGTTT beta-proteobacteria Manz et.al (1992)
Gamma42a 35 GCCTTCCCACATCGTTT gamma-Proteobacteria Manz et.al (1992)
HGC 69a 20 TATAGTTACCACCGCC
GT
gram positive high
G+C content Roller et.al
(1994)
LGC354A 35 TGG AAG ATT CCC TAC TGC
gram positive low
G+C content
(firmicutes)
Meier et
al.,(1999)
LGC354B 35 CGG AAG ATT CCC TAC TGC
gram positive low
G+C content
(firmicutes)
Meier et
al.,(1999)
LGC354C 35 CCG AAG ATT CCC TAC TGC
gram positive low
G+C content
(firmicutes)
Meier
et.al.,(1999)
![Page 8: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/8.jpg)
130
Table 5.2: List of genus and species specific oligonucleotide probes
Probe
name
% of
Formami
de
Sequence of probe
(5` to 3`)
Probe specificity Reference
SNA 45 CATCCCCCTCTACCGTAC
Sphaerotilus natans,
few Leptothrix spp.,
Eikelboom type
1701
Wagner et al.
(1994a)
LDI 35 CTCTGCCGCACTCCAGCT
“Leptothrix
discophora”,
Aquaspirillum
metamorphum
Wagner et al.
(1994a)
LMU 35 CCCCTCTCCCAAACTCTA Leucothrix mucor Wagner et al.
(1994a)
HHY 20 GCCTACCTCAACCTGATT genus
Haliscomenobacter
Wagner et al.
(1994a)
TNI 45 CTCCTCTCCCACATTCTA Thiothrix nivea Wagner et al.
(1994a)
021N 35 TCCCTCTCCCAAATTCTA Eikelboom type
021N
Wagner et al.
(1994a)
MPA60 20 GGATGGCCGCGTTCGACT “Microthrix
parvicella”
Erhart et al.
(1997)
S-G-Gor-
0596-a-A-
22
20 TGCAGAATTTCACAGACG
ACGC genus Gordona
De Los Reyes
et.al. (1997b)
S-S-G.am
0192-a-A-
18
30 CACCCACCCCCATGCAGG Gordona amarae
De Los Reyes
et.al. (1997b)
S-*-Myb-
0736-a-A-
22
30
CAGCGTCAGTTACTACCCA
GAG
De los Reyes et.
al. (1997)
MNP1 50 TTAGACCCAGTTTCCCAGGCT
nocardioform
actinomycetes
Schuppler
et.al.(1998)
Myc657 30 AGTCTCCCCTGYAGTA
Mycobacterium
subdivision (mycolic
acid-containing
actinomycetes)
Davenport et al.
(2000)
![Page 9: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/9.jpg)
131
The steps of Fluorescence In Situ Hybridization technique are outlined as follows:
5.3.3.1 Fixation
Activated sludge samples were fixed in both ethanol and 4% paraformaldehyde within 4-
6 hours after sampling (Amann, 1995). Gram positive and gram negative pure cultures
were fixed in ethanol and 4% paraformaldehyde respectively according to the procedure
described by schuppler et al. in 1998. The fixation protocols are briefly described as
follows:
Ethanol Fixation: Isolates were grown in nutrient broth at 37 °C for 18 hours. 1.5 ml of
the cell culture was then collected in a sterile eppendorf tube. After vortexing the culture
for 5 minutes, the cells were centrifuged at 14,000 rpm for 5 minutes. 750 µl of the
supernatant was then collected and resuspended by vortexing. 375 µl of 100% Ethanol
and 375 µl of 1X Phosphate buffer saline were then added to the cell suspension. The
cells were stored at - 20°C.
Formaldehyde Fixation: About l-1.5 ml of cell culture in exponential phase was
collected in an eppendorf tube. The aggregated flocs were broken by vortexing for about
10 minutes. The cells were centrifuged at 14000 rpm for 5 mins. After removing 750 µl
of supernatant, the cells were resuspend by vortexing and fixed in 750 µL of fixative.
Cells were then incubated at 4 °C for 3hrs. After incubation, the cells were centrifuged at
6000 rpm for 5 mins and the supernatant was decanted. Cells are now washed with
500µL 1X PBS (Phosphate buffered saline), mixed by vortexing and centrifuged at
6000rpm for 5 mins. (repeated twice). Finally, the cells were resuspended in 250 µL of
lX PBS. Equal volume of 96% Ethanol (EtOH) was added and mixed before storing at -
20 °C.
5.3.3.2 Coating of slides
Teflon printed slides with wells of 8mm diameter from Vermicon identification
technology(VIT), Munich, Germany were used (Figure 3.2). These slides were cleaned in
acid alcohol (1 % Concentrated Hydrochloric Acid and 70 % Ethanol) for 2 hours. The
slides were then rinsed in distilled water and placed in Coplin jars containing dilute poly
![Page 10: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/10.jpg)
132
– L – Lysine (0.01%) for 18 hours at 25 °C. The slides were then drained and dried in a
hot air oven for 1 hour at 60 °C.
Figure 5.1: The slides used in the Fluorescence In Situ Hybridization technique.
5.3.3.3 Dehydration and Lysozyme Treatment
10 µl of the ethanol fixed cells were placed in each of the three wells of a slide. The
slides were then air dried for 10 minutes. The cells were then dehydrated in an ethanol
series (50%, 86% and 96% for 3 minutes each) in Coplin jars. The slides were air dried
for 5 minutes. Three Lysozyme treatments were applied; to one set of slides, 2 µl of 50
µM Lysozyme was added to each well, to another set 2 µl of 20 µM Lysozyme and to the
final set no Lysozyme was added to any of the wells. The slides were then air dried for 15
minutes.
5.3.3.4 Hybridization
Genus and Species level probes were used to identify the isolates in this study. The
oligonucleotide probes used are given in Table 3.2. All oligonucleotide probes were
labeled at 5` end by Tetramethyl Rhodamine Isothiocyanate (TRITC) dye. Hybridization
solution was prepared with varying concentrations of Formamide according to the
compositions shown in Table 3.3. The final volume of the solution per slide was 2 ml.
Table 5.3: The composition of the hybridization solutions used in this study
Solution 20 %* 25 %* 30%* 35 %* 40 %*
Formamide 400 µl 500 µl 600 µl 700 µl 800 µl
5 M NaCl 360 µl 360 µl 360 µl 360 µl 360 µl
1 M Tris-Hcl 40 µl 40 µl 40 µl 40 µl 40 µl
10% SDS 2 v 2 µl 2 µl 2 µl 2 µl
Distilled Water 1198 µl 1098 µl 998 µl 898 µl 798 µl
![Page 11: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/11.jpg)
133
Abbreviation: NaCl – Sodium Chloride, SDS – Sodium Dodesyl Sulphate, Tris
hydroxymethyl aminomethane. *The percentages refer to varying concentrations of
formamide.
The probe mixes were prepared with 9 µl of hybridization solution and 1 µl of the
respective probe. The positive control well contained EUB Probe for all samples. To the
middle well, test probe listed in the table 2.1 and 2.2 was added. The Negative Control
well had only 10 µl of hybridization solution alone added. The slides were then placed in
hybridization chambers with the trays containing the remaining 1.90 ml of hybridization
solution. The chambers were covered with aluminium foil before being placed in the
incubator. The slides were incubated at 46° C for 18 hours.
5.3.3.5 Washing
Washing solutions of varying Formamide concentrations were prepared according to the
composition displayed in Table 5.4. The final volume was 30 ml per each slide.
Table 5.4: Composition of the washing solutions
Solution 20% 25% 30% 35% 40%
1M Tris HCl 1 ml 1 ml 1 ml 1 ml 1 ml
5 M NaCl 2.15 ml 1.58 ml 1.02 ml 0.7 ml 0.46 ml
0.5 M EDTA 0.5 ml 0.5 ml 0.5 ml 0.5 ml 0.5 ml
Distilled Water 26.35 ml 26. 92 ml 26.35 ml 27.48 ml 28.04 ml
Abbreviation used: NaCl – Sodium Chloride, SDS – Sodium Dodesyl Sulphate, Tris
hydroxymethyl aminomethane.
The washing solutions were pre-warmed at 48°C for 30 minutes in a water bath. The
hybridization solution containing trays were then removed carefully without tilting the
slides. The chambers were filled with 30 ml of respective washing solutions and the
slides were replaced. The chambers were incubated in the inverted position for 20
minutes at 48 °C. The slides were rinsed in distilled water followed by air drying until
dry. 4',6-diamidino-2-phenylindole (DAPI) stain was applied to some of the negative
wells for the visualization of DNA and air dried.
![Page 12: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/12.jpg)
134
5.3.3.6 Viewing of the slides:
The hybridized bacteria were visualized by epifluorescence microscopy at 1,000X
magnification on a Nikon Eclipse 80i (Japan) microscope equipped with a 100-W
mercury lamp and filter sets G-2E/C for TRITC, QD605 (excitation wavelength, 540 to
565 nm; dichroic wavelength, 565 nm; emission, 605-655 band pass) and B-2E/C for
FITC (excitation wavelength, 465 to 495 nm; dichroic wavelength, 505 nm; emission,
515-555 band pass). Nonhybridized bacteria were hardly detectable and were identified
by phase-contrast microscopy. Images were captured and analyzed using ProgResC5
digital camera system (JENOPTIK, Germany) (Figure 5.2). Pictures were processed as
tagged-image file format (TIFF) files on a personal computer running Image-J software,
version 1.42 (developed by Wayne Rasband, Research Services Branch, National
Institute of Mental Health, Bethesda, Maryland, USA. http://rsb.info.nih.gov/ij/)
Figure 5.2: The Nikon eclipse 80i (Japan) Fluorescent Microscope and The Progress C5,
Jenoptik (Germany) Digital camera used in this study (Manipal University, Dubai
Campus lab).
![Page 13: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/13.jpg)
135
Once microscopic observation was done, the image was recorded and analyzed with the
aid of a computer program. The program used was Metamorph version 4.6r8 by universal
imaging Corp. The program would calculate the area from which the fluorescence signal
was recorded. The final result was presented in terms of the percentage calculated when
this area was divided by the total area of the field of observation. For each glass well, a
total of 12 fields of observations were made so as to observe the fluorescence signal of 1
tagged probe presented in the well, the percentages were averaged so as to reduce the
experimental errors. The method of calculation is described in Appendix 15.
5.4. Results and Discussion
5.4.1. Optimization of oligonucleotide probes
In the beginning all the probes used in this study were optimized with their target
microorganism in pure cultures. All the bacteria used were representative of their
group/class, genus and species. In order to get best fluorescence signal (hybridization)
different formamide concentration was used in hybridization solution. The target
organisms used and their hybridization with various probes are listed in the Table 5.5.
![Page 14: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/14.jpg)
136
The florescence images of reference cultures hybridized by their respective probes are
shown the figure 5.3
Table 5.5: In situ hybridization of reference strains by 16S rRNA targeted probes
Species Source
Hybridization with probe
Eub-mix HGC69a LGC-mix ALF1b BET42a GAM42a
FA*(35%) (25%) (35%) (20%) (35%) (35%)
Escherichia coli MTCC + + + + + +
Pseudomonas
fluorescens
MTCC
103
+ + + + + +
Salmonella
typhimurium
MTCC
98
+ + + + + +
Shigella Lab
isolate
+ + + + + +
Bacillus subtilis MTCC
121
+ + + + + +
Staphylococcus
aureus
MTCC
96
+ + + + + +
Streptococcus
sp.
MTCC
389
+ + + + + +
Nocardia
asteriodes
ATCC
3377
+ + + + + +
(+ = positive hybridization; - = negative hybridization)
*FA= Formamide concentration in hybridization solution
![Page 15: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/15.jpg)
137
A B
C D
E F
Figure 5.3: Whole cell hybridization of bacterial pure cultures by TRITC labeled probes.
A) E.coli cells by Gam42a probe B) Salmonella typhimurium cells by Gam42a probe C)
Nocardia sp by HGC62a probe; Low GC probe bound to D) Bacillus subtilis, E)
Staphylococcus aureus F) Streptococcus sp. Bar=10µm applies to all photomicrographs.
![Page 16: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/16.jpg)
138
5.4.2. Microbial community Profile in activated sludge system of Dubai STP
In total 24 mixed liquor and foam samples ( fixed with either ethanol or
paraformaldehyde) collected from aeration and secondary settling tanks of Dubai STP
over a period of six months were used in FISH analysis using domain, group, genus and
species specific 16S rRNA targeted oligonucleotide probes. The direct microscopic
examinations of all these samples have shown a large number of filamentous bacteria
during the study period (Chapter 3). According to the Eikelboom identification key the
dominant filamentous bacteria were found to be Nocardioform actinomycetes, Thiothrix,
Sphaerotilus, Eikelboom Type 021N and Nostocoida limicola type I species. Initially
DAPI staining was applied to all mixed liquor and foam samples. DAPI stains the entire
DNA in the biomass sample regardless of whether they are from living or dead cells. The
Eub338 mix (I-III) labeled at 5` by TRITC (which targets the entire domain bacteria
group that has adequate 16S rRNA for hybridization with the probes) was applied to
sludge samples. Table 5.6 revealed that approximately 79.1- 92.9 % of the microbes
stained by DAPI, were targeted by Eub338 mix (I-III). Thus only 7.1-21.9% of the
microbes consisted of dead cells as they lacked sufficient 16S rRNA. This would mean
that the samples were extracted during the exponential phase and they provided valid
results when FISH was conducted on them, since most of the cells in the samples had
adequate 16S rRNA.
Month of sampling
: Jan-07 Feb-
07
March-
07
April-
07
May-
07
June-
07 % of cells stained
by DAPI 100 100 100 100 100 100
% of cells targeted
by Eub338Imix.
TRITC
92.6
± 4.0
82.4
±5.4
92.9
±4.6
90.3
±6.8
81.1
±12.3
79.1
±14.6
Table 5.6: Percentage of cells targeted by Eub338 mix with respect to DAPI
![Page 17: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/17.jpg)
139
Population profile in DSTP over a period of six months
(%with respect to DAPI)
0
10
20
30
40
50
60
70
80
90
Jan’07 Feb’07 Mar’07 Apr’07 May’07 Jun’07
Month
%
Eub338Mix.tritc
Beta42a.tritc
Gamma42a.tritc
LGC354Mix.tritc
Alpha1b.tritc
HGC69a.tritc
Fig 5.4: Population profile in Dubai STP over a period of six months
The Figure 5.4 gives overall average pattern of FISH results obtained for the bacterial
population abundance and their changes in the DSTP activated sludge process over the
period of six months. The numerical values obtained out of FISH analysis are presented
in Appendix 15. From the Fig 5.4, the percentages of bacteria belonging to several groups
like alpha, beta, gamma class of Proteobacteria including gram positive population of
Low G+C and High G+C group remained almost constant irrespective to treatment plant
conditions. In total of 24 samples of mixed liquor, the major bacterial groups identified in
descending order of their frequency of occurrence were: gamma class of proteobacteria,
High G+C group, beta class of proteobacteria, Low G+C group and alpha class of
proteobacteria. In addition, a more specific MNP1 probe (Schuppler et al., 1998) targeted
at the majority of Nocardioform actinomycetes group was applied to the mixed liquor
![Page 18: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/18.jpg)
140
samples. However, quantitative data obtained with MNP1 probe was not included in
comparing the FISH results obtained by group specific probes on bacteria population. In
total six group specific probes were applied to the mixed liquor samples obtained from
aeration tanks and secondary settling tanks. Tables 5.7 and 5.8 indicate that hybridization
with all six probes gave positive result in the mixed liquor samples from aeration tanks
and secondary settling tanks.
Table 5.7: In situ hybridization of sludge samples from aeration tanks by rRNA
targeted probes
Sampling
period
(day/mo/year)
Sample
ID
Hybridization with probe
Eub-mix HGC69a LGC-mix ALF1b BET42a GAM42a
FA*(35%) (25%) (35%) (20%) (35%) (35%)
17/1/07 AT1 + + + + + +
30/1/07 AT2 + + + + + +
15/2/07 AT3 + + + + + +
28/2/07 AT4 + + + + + +
14/3/07 AT5 + + + + + +
29/3/07 AT6 + + + + + +
15/4/07 AT7 + + + + + +
30/4/07 AT8 + + + + + +
16/5/07 AT9 + + + + + +
30/5/07 AT10 + + + + + +
15/6/07 AT11 + + + + + +
29/6/07 AT12 + + + + + + (+ = positive hybridization; - = negative hybridization) FA= Formamide concentration in
hybridization solution
![Page 19: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/19.jpg)
141
Table 5.8: In situ hybridization of samples from secondary settling tanks by rRNA
targeted probes
Sampling
period
(day/mo/year)
Sample
ID
Hybridization with probe
Eub-mix HGC69a LGC-mix ALF1b BET42a
GAM42a
FA*(35%) (25%) (35%) (20%) (35%)
(35%)
17/1/07 SST1 + + + + + +
30/1/07 SST 2 + + + + + +
15/2/07 SST 3 + + + + + +
28/2/07 SST 4 + + + + + +
14/3/07 SST 5 + + + + + +
29/3/07 SST 6 + + + + + +
15/4/07 SST 7 + + + + + +
30/4/07 SST 8 + + + + + +
16/5/07 SST 9 + + + + + +
30/5/07 SST
10
+ + + + + +
15/6/07 SST
11
+ + + + + +
29/6/07 SST
12
+ + + + + +
(+ = positive hybridization; - = negative hybridization; +/-= partial or weak signal) *FA= Formamide concentration in hybridization solution
5.4.3. Populations detected
All the mixed liquor samples (foam and activated sludge) were hybridized by EUBmix
(I-III) probes during the FISH analysis along with different probes. The figure 5.5
indicates the major dominant filamntous bacteria observed in the foam and mixed liquor
samples. In the course of the study, it was found that there were at least three distinct
filamentous bacteria that were targeted by GAM42a, HGC69a and Alpha1b probes.
However, the filamentous bacterial population targeted by GAM42a and HGC69a were
always observed in all the samples during the whole period of study.
Population of the group targeted by Gamma 42a
The three major morphotypes of bacteria targeted by Gamma 42a were large filaments,
cocci with a size of about 2-3 µm and single cell rods (Fig 5.6). They were suspected to
![Page 20: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/20.jpg)
142
belong to the gamma-Proteobacteria group. In all 24 analyzed sludge samples, probe
Gam42a identified long branched irregular filaments and the population of these
filaments remained constant. The larger cocci targeted by Gam42a probe were found to
be in 20 of the 24 samples. These cocci were observed in cluster arrangement on most of
the occasion. The small long and short rods targeted by Gam42a probe were found to be
scattered throughout the sludge samples and were always observed in all the samples.
These could be the bacteria belonging to the enterobacteriacae family. These sludge
samples were also hybridized by various genus and species-specific probes for
filamentous gram negative bacteria like SNA (Sphaerotilus natans), LD1 (Liptothrix
discophora), LMU (Leucothrix mucor), HHY (Haliscomenobacter), TN1 (Thothrix
nivea) and 021N (Eikelboom type 021N). These probes failed to detect any filamentous
and nonfilamntous populations in the sludge and foam samples.
Population of the group targeted by Alpha 1b
The three major morphotypes of bacteria targeted by Alpha1b were small irregular
filaments, cocci with tetrad arrangement and single cell rods (Fig 5.7). They probably
belonged to alpha-Proteobacteria group. In 10 out of 24 analyzed sludge samples, probe
Alpha 1b identified small-branched irregular filaments and the population of these
filaments was not observed in all the samples. However, the tetrad cocci were found in 20
out of 24 samples and were hybridized by Alpha 1b on consistent basis.
Population of the group targeted by Beta 42a
The bacteria targeted by Beta 42a probe were mostly small rods and small cocci with a
size of 1-2 µm (Fig 5.8). They probably belonged to beta-Proteobacteria group. In all 24
analyzed sludge samples, probe Beta 42a identified small rods and population of these
cells remained constant. The small cocci targeted by Beta 42a probe were found to be in
16 of the 24 samples. These cocci were observed in cluster arrangement on most of the
occasion like the cocci targeted by Alpha 1b probe. The small or long rods shaped cells
targeted by Beta 42a probe were found in grouped arrangement within the sludge
samples.
![Page 21: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/21.jpg)
143
Population of the group targeted by LGC mix:
The LGC mix probe targeted mostly large or small spore bearing rods and cocci with a
size of 2-3 µm. In at least 20 out of 24 analyzed sludge samples, LGC mix probe
identified long or small rods and the populations of these rods were found to scattered
throughout the sample. The cocci targeted by LGC probe were found in 18 of the 24
samples. These cocci occurred in clusters or diplococci/streptococci/staphylococci
arrangement on most of the occasions. However, quantitatively LGC probe targeted quite
a small percentage of the bacterial population in comparison to other probes like
GAM42a, HGC69a, Alpha 1b, Beta 42a and MNP1.
![Page 22: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/22.jpg)
144
A B
C D
E F
Figure 5.5 Whole cell rRNA targeted fluorescence in situ hybridization of eubacterial
community in activated sludge samples in Dubai STP. A, B, C, D, E and F: mixed
liquor/foam samples hybridized by TRITC–labeled EUB 338mix probe) Bar =10 µm and
applies to all photomicrographs. Original magnification: 1000X
![Page 23: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/23.jpg)
145
A B
C D
E F
Figure 5.6 Whole cell rRNA targeted fluorescence in situ hybridization of Gamma
subclass of proteobacteria in activated sludge samples in Dubai STP. A, C and E:
sludge samples hybridized by TRITC–labeled Gamma42a probe) and B,D and F:
phase contrast images of the same. For each panel, identical field were viewed by
epifluorescence microscopy. Bar =10 µm and applies to all photomicrographs.
Original magnification: 1000X
![Page 24: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/24.jpg)
146
A B
C D
Figure 5.7 Whole cell rRNA targeted fluorescence in situ hybridization of Alpha
subclass of proteobacteria in activated sludge samples in Dubai STP. A and C: sludge
samples hybridized by TRITC–labeled ALF1b probe. B and D: phase contrast images of
the same. For each panel, identical field were viewed by epifluorescence microscopy. Bar
=10 µm and applies to all photomicrographs. Original magnification: 1000X
![Page 25: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/25.jpg)
147
A B
C D
Figure 5.8 Whole cell rRNA targeted fluorescence in situ hybridization of Beta subclass
of proteobacteria in activated sludge samples in Dubai STP. A, C: sludge samples
hybridized by TRITC–labeled BET42a probe. B and D: phase contrast images of the
same. For each panel, identical field were viewed by epifluorescence microscopy. Bar
=10 µm and applies to all photomicrographs. Original magnification: 1000X
![Page 26: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/26.jpg)
148
Population of the group targeted by HGC 69a
The gram-positive high G+C bacteria were targeted by HGC 69a. This group of bacteria
contained filamentous bacteria population that was not targeted by Gamma 42a and
Alpha 1b. It was noted that the population of this group of high G+C bacteria remained
dominant throughout the sampling period. This was probably because of the foaming
observed in the treatment plant throughout the study period. Most of the bacteria targeted
by HGC69a were either branched filaments or long, medium or small size curved rods
(Fig. 5.9). The filamentous morphotype was the dominant gram positive bacteria in all
foam and mixed liquor samples. All 24 samples gave positive hybridization with
HGC69a probe indicating that the population belonging to the High GC group was the
most significant microbial community in the sewage treatment plant at Dubai. This
observation suggests that these bacteria play an important role in the activated sludge
process of wastewater treatment.
Population of the group targeted by MNP1
In situ hybridization using the nocardioform-specific oligonucleotide probe MNP1
(Schuppler et al. 1998) was performed to identify populations of nocardioform
actinomycetes in the activated sludge from the Dubai sewage treatment plant. For this
study, identical fixed foam and sludge samples were used which had been used
previously in hybridization with HGC69a probe. In situ hybridization with probe MNP1
resulted in the detection of two populations with different morphologies (Fig. 5.10). One
morphotype represented typical branched filaments of nocardioform actinomycetes,
whereas the other morphotype comprised short irregular rods (Fig. 5.10 f). Both
populations simultaneously hybridized with probe HGC69a confirming that the bacteria
belong to the group of actinomycetes. These results are similar to the study conducted by
Schuppler et al. (1998) using MNP1 probe. The sludge samples containing nocardioform
populations detected by probe MNP1 and HGC69a were further analyzed by
hybridization with the Gordona amarae and genus Gordona specific probes (Table 5.2).
These two probes failed to detect bacterial populations in the activated-sludge sample
from the Dubai sewage treatment plant indicating that Gordona amarae was not the
dominant foam causing bacteria in DSTP.
![Page 27: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/27.jpg)
149
A B
C D
E F
Figure 5.9 Whole cell rRNA targeted fluorescence in situ hybridization of High G+C
bacterial group in activated sludge samples in Dubai STP. A, C and E: sludge samples
hybridized by TRITC–labeled HGC69a probe. B, D and F: phase contrast of the same.
For each panel, identical field were viewed by epifluorescence microscopy. Bar =10 µm
and applies to all photomicrographs. Original magnification: 1000X
![Page 28: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/28.jpg)
150
A B
C D
E F
Figure 5.10 Whole cell rRNA targeted fluorescence in situ hybridization of
Nocardioform actinomycetes group in activated sludge samples in Dubai STP. A, B, C,
D, E and F: sludge samples hybridized by TRITC–labeled MNP1 probe. Bar = 10µm and
applies to all photomicrographs. Original magnification: 1000X
![Page 29: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/29.jpg)
151
5.4.4. FISH based detection of Nocardioform actinomycetes pure cultures in Dubai STP
Fluorescent in situ hybridization (FISH) using HGC, MNP1 (specific to nocardioform
actinomycetes group) and Gordona amarae specific probe was performed to detect
nocardioform actinomycetes in pure cultures isolated from the foaming activated sludge
samples. The oligonulceotiode probe hybridization was performed at 46°C and other
conditions were followed according to the procedure described by Schuppler et al., 1998.
No non-specific hybridization was observed for the Nocardioform genera specific probe.
Again, two morphotypes of nocardioforms actinomycetes (single cell rods and branched
filaments) were isolated from both foam and mixed liquor samples. Identification of pure
cultures of suspected nocardioform isolates was performed using HGC, MNP1, Myc657
S-G-Gor- 0596-a-A-22 and S-S-G.am 0192-a-A-18 oligonucleotide probe (Table 5.10
and Figure 5.11 and 5.12). In total out of 16 isolates 10 isolates were simultaneously
hybridized by both HGC 69a and MNP1 indicating that the these isolates were indeed
Nocardioform actinomycetes members. As many as eight of these were able to hybridize
with Myc657 probe. Figure 5.13 shows hybridization of isolates FB05 and FB14 by
TRITC labeled Myc657 probe.
Table 5.9: In situ hybridization of filamentous isolates by group, genus and species
specific probes (+ Hybridization; - No hybridization)
Sl.
No
Isolate
Code
Hybridization with probes
HGC69a
MNP1
Myc657
S-G-Gor-
0596-a-A-22
S-S-G.am
0192-a-A-18
1 FB01 - - - - -
2 FB02 - - - - -
3 FB03 - - - - -
4 FB04 + + + - -
5 FB05
+
+ + - -
6 FB06 + + + - -
7 FB07 + + + - -
8 FB08 - - - - -
9 FB09 - - - - -
10 FB10 + + + - -
![Page 30: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/30.jpg)
152
11 FB11 + + - - -
12 FB12 + + + - -
13 FB13 - - - - -
14 FB14 + + + - -
15 FB15 + + + - -
16 FB16 + + - - -
However, these ten isolates failed to hybridize with Gordona amarae and genus Gordona
specific probe. Several Nocardioform isolates initially exhibited filamentous form
however on repeated sub-culturing started to exhibit single cell form or the mixed
filamentous and non-filamentous morphotypes. However, both these forms were
successfully detected by whole cell in situ hybridization using HGC69a as well as MNP1
probes. These observations suggest that the single cell and filamentous forms of
nocardioform bacteria isolated from foam and sludge samples could be different
morphotypes of same nocardioform species. However, more detailed study regarding
exact identity of these two morphotyes using 16S r-RNA based approach needs to be
conducted.
A B
![Page 31: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/31.jpg)
153
C D
Figure 5.11 Detection of Nocardioform actinomycetes from activated sludge bacterial
isolates hybridized by TRITC–labeled MNP1 probe. A) FB04; B) FB05; C) FB06; D)
FB07; Bar =10 µm and applies to all photomicrographs. Original magnification: 1000X
![Page 32: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/32.jpg)
154
A B
C D
E F
Figure 5.12 Detection of Nocardioform actinomycetes from activated sludge bacterial
isolates hybridized by TRITC–labeled MNP1 probe. A) FB10; B) FB11; C) FB12; D)
FB14; E) FB15; F) FB16. Bar =10 µm and applies to all photomicrographs. Original
magnification: 1000X
![Page 33: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/33.jpg)
155
A B
C D
Figure 5.13 Detection of mycolic acid-containing actinomycetes isolates hybridized by
TRITC–labeled Myc657 probe. A) FB05 hybridized by Myc657 probe B) Identical field
of DAPI stained FB05 C) FB14 hybridized by Myc657 probe D) Identical field of DAPI
stained FB14. Bar =10 µm and applies to all photomicrographs. Original magnification:
1000X
![Page 34: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/34.jpg)
156
5.5 CONCLUSION
This study evaluated the microbial community structure in the activated sludge system of
Dubai STP. The population changes of the major groups like proteobacteria (alpha, beta
and gamma), High GC, Low GC and other groups of microbes were analyzed using
FISH. The samples tested were taken from foaming sludge and mixed liquor of activated
sludge system and a nocardioform actinomycete group member was found to be
dominating in the system. This group of suspected nocardioform actinomycete belonged
to the High GC group of bacteria that was targeted by HGC69a and MNP1. However,
this group of nocardioform actinomycete exhibited both branched and single cell
morphotypes. The second largest dominating group belonged to Gamma sub-class of
proteobacteria. Majority of the bacteria targeted by Gam42a probe were filamentous in
their morphology indicating that they were probably Thiothrix or Type 021N or both.
Specific probes such as SNA (Sphaerotilus natans), LDI (Leptothrix sp), LMU
(Leucothrix sp), HHY (Haliscomenobacter sp), TNI (Thiothrix), 021N (Type 021N) and
MPA60 (Microthrix parvicella) failed to hybridize in the sludge samples. However, a few
of these filaments were observed in the samples. The sludge samples containing
nocardioform populations detected by probe MNP1, Myc657 and HGC69a were further
analyzed by hybridization with the Gordona amarae and genus Gordona specific probes.
These two probes failed to detect bacterial populations in the activated-sludge sample
from the Dubai sewage treatment plant indicating that Gordona amarae was not the
dominant foam causing bacteria in Dubai STP.
In total out of 16 pure culture isolates 10 were successfully hybridized by both
HGC69a and MNP1 indicating that these isolates were nocardioform actinomycetes
![Page 35: CHAPTER 5shodhganga.inflibnet.ac.in/bitstream/10603/8311/15/15_chapter 5.pdfsewage treatment plant. 5.1 Introduction The activated sludge process, the most widespread technology for](https://reader034.vdocument.in/reader034/viewer/2022042211/5eb378639ea91a201352fa20/html5/thumbnails/35.jpg)
157
members. At least eight isolates hybridized with Myc657 probe indicating that these
isolates were mycolic acid containing actinomycetes. However, all the isolates failed to
hybridize with Gordona amarae and genus Gordona specific probe meaning that none of
these isolates belonged to Gordona genus.
It is recommended that this research should be furthered in a number of ways. Firstly a
clone library shall be developed base on the samples obtained. The community DNA
shall be extracted and the 16S rRNA genes are amplified through Polymerase Chain
Reaction (PCR). These genes are later isolated through cloning and plating techniques,
thus creating a clone library. This clone library will be subjected to Denaturing Detergent
Gradient Gel Electrophoresis (DDGE) screening and DNA sequencing. With the rRNA
sequences known, new specific probes will be designed for FISH to further the
investigation. These new probes together with those presently available will help to
reveal the intricate structures present in the filamentous and non-filamentous microbial
community in Dubai Sewage treatment plant.