Download - Chemical Detective website The Chemical Detective program is made up of: *a forensic science website
![Page 1: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/1.jpg)
![Page 2: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/2.jpg)
![Page 3: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/3.jpg)
Chemical Detective websiteChemical Detective website
The Chemical Detective program is made up of:
*a forensic science website
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm* a CD ROM of forensic science teaching resourcesAim:Aim: to encourage the study of molecular and
physical science. It presents science in an enthusiastic and interesting format with
reference to the ‘real world’ so as to encourage Victorian students to continue their
science education into VCE and beyond.
![Page 4: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/4.jpg)
For more information contact the Programme Coordinator, Dr Simon Lewis at;
School of Biological & Chemical SciencesDeakin University, Geelong
VIC 3217, Australia +61 3 52271365 +61 3 52271040
For more information contact the Programme Coordinator, Dr Simon Lewis at;
School of Biological & Chemical SciencesDeakin University, Geelong
VIC 3217, Australia +61 3 52271365 +61 3 52271040
Chemical Detective Chemical Detective websitewebsite
![Page 5: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/5.jpg)
Crime Solving Identification
Evidence Ballistics
Fingerprints Law
Chemical analysis Anatomy
![Page 6: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/6.jpg)
What activities are already being done in class that
can be related to forensic science?
Chromatography
Flame Test
Microscopy
DNA
Blood test
(theory)
Invisible Ink
![Page 7: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/7.jpg)
Example of an aspect of forensic science: Example of an aspect of forensic science:
Blood StainsBlood StainsIs the sample blood?
What is the pattern of the blood stain?
Fe in haemoglobin catalyses Fe in haemoglobin catalyses reaction of luminol to produce reaction of luminol to produce blue light.blue light.
Other things can act as a catalyst Other things can act as a catalyst but blood gives a steady glow.but blood gives a steady glow.
Even after washing or with time, Even after washing or with time, blood still glows.blood still glows.
Hand out
Experiment
Safety!!!Safety!!!
![Page 8: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/8.jpg)
Chemical NotesChemical Notes
• exothermic reactions
• reaction kinetics (changing conditions)
• effect of temperature
Luminol costs ~$15 per kit at toy shops.
![Page 9: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/9.jpg)
FingerprintingFingerprinting
Types of PrintsTypes of Prints
* Dusting
* Fuming - iodine crystals
Do experiment
SAFETY!What Science ??
Crystals subliming
Works best with greasy fingerprints: Child’s fingerprints have shorter fatty acid chains and evaporate quicker compared with adults (iodine attaches to fatty acids and stains it)
Genetics - different patterns of fingerprints
![Page 10: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/10.jpg)
Fingerprinting…Fingerprinting…contdcontd
Compare with other methods of identification of fingerprints:
Luminescent fingerprints - use ninhydrin for staining amino acids (good for old documents but stains
very badly)
Superglue fuming - fluorescent dye (light source, developed at ANU)
Click here for Click here for
more infomore info
![Page 11: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/11.jpg)
Relate to CSFRelate to CSF
Physical and Chemical Science Level 6
change of state
spectrum of light
atomic structure, exciting of electrons
chemiluminescence - light sticks
Biological Science
sweat glands, inheritance of fingerprints
DNA typing
![Page 12: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/12.jpg)
CareersCareers
![Page 13: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/13.jpg)
![Page 14: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/14.jpg)
What is Forensic Science?
What is Forensic Science?
The application of scientific knowledge to solve legal problems Burglary Environmental protection International arms control
Examination and presentation of scientific evidence to solve crimes
Not a new way of science. Applied science.
The application of scientific knowledge to solve legal problems Burglary Environmental protection International arms control
Examination and presentation of scientific evidence to solve crimes
Not a new way of science. Applied science.
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 15: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/15.jpg)
When is Forensic Science Needed?When is Forensic Science Needed?
Police officer arrives at a possible crime scene
Questions to be answered: Has a crime been committed? Who did it? If there is a suspect, can you prove
they did it?
Police officer arrives at a possible crime scene
Questions to be answered: Has a crime been committed? Who did it? If there is a suspect, can you prove
they did it?
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 16: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/16.jpg)
The Forensic ScientistThe Forensic Scientist
The forensic scientist has a three main duties; Examination of physical evidence Reporting on the results
of a forensic examination • investigation in tracing an offender• presentation of a case to a court
present verbal evidence in court (expert testimony)
The forensic scientist has a three main duties; Examination of physical evidence Reporting on the results
of a forensic examination • investigation in tracing an offender• presentation of a case to a court
present verbal evidence in court (expert testimony)
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 17: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/17.jpg)
The Crime SceneThe Crime Scene
A body has been found, a house has been burgled, a car has been broken into
Forensic science begins at the scene recognition of important physical evidence preservation of evidence
No amount of high tech instrumentation or expertise will recover a botched crime
scene investigation
A body has been found, a house has been burgled, a car has been broken into
Forensic science begins at the scene recognition of important physical evidence preservation of evidence
No amount of high tech instrumentation or expertise will recover a botched crime
scene investigation
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 18: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/18.jpg)
Physical EvidencePhysical Evidence
"any and all objects that can establish that a crime has been committed or can
provide a link between a crime and its victim or a crime and its perpetrator“
Saferstein, Criminalistics (6th Edition) Chain of custody or continuity of
evidence Crime scene to the laboratory to the lab
report to the courtroom. If the chain is broken, the forensic
investigation may be fatally compromised
"any and all objects that can establish that a crime has been committed or can
provide a link between a crime and its victim or a crime and its perpetrator“
Saferstein, Criminalistics (6th Edition) Chain of custody or continuity of
evidence Crime scene to the laboratory to the lab
report to the courtroom. If the chain is broken, the forensic
investigation may be fatally compromised
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 19: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/19.jpg)
Forensic DisciplinesForensic Disciplines
Forensic science today is increasingly multidisciplinary
pathologists, chemists, toxicologists, biologists, entomologists, anthropologists, dentists, document examiners, ballistics expert, engineers........
Forensic science today is increasingly multidisciplinary
pathologists, chemists, toxicologists, biologists, entomologists, anthropologists, dentists, document examiners, ballistics expert, engineers........
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 20: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/20.jpg)
![Page 21: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/21.jpg)
What is DNA?What is DNA?
Biopolymer responsible for; passing on genetic information Biochemistry of the body
It is made up of a sequence ofunits based on four chemicals; adenine (A), cytosine (C),
guanine (G) and thymine (T)
Biopolymer responsible for; passing on genetic information Biochemistry of the body
It is made up of a sequence ofunits based on four chemicals; adenine (A), cytosine (C),
guanine (G) and thymine (T)
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 22: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/22.jpg)
DNA StructureDNA Structure
Double strandforms when unitsmatch up to formpairs; G with C
T with A
Double strandforms when unitsmatch up to formpairs; G with C
T with A
C
A
T
T
A
A
T
G
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 23: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/23.jpg)
DNA and IndividualityDNA and Individuality
The DNA of a person is individual and can be shown to be theirs beyond reasonable doubt
How?
Because DNA has PATTERNS that can be identified using modern techniques
The DNA of a person is individual and can be shown to be theirs beyond reasonable doubt
How?
Because DNA has PATTERNS that can be identified using modern techniques
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 24: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/24.jpg)
Sir Alec JeffriesSir Alec Jeffries
The first application of DNA typing to forensic science Dr Alec Jeffries (Leicester University) Called in by police to apply his new
technique of "DNA fingerprinting" to help solve two murders in Leicestershire
Cleared an innocent man
The first application of DNA typing to forensic science Dr Alec Jeffries (Leicester University) Called in by police to apply his new
technique of "DNA fingerprinting" to help solve two murders in Leicestershire
Cleared an innocent man
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 25: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/25.jpg)
RFLP DNA TypingRFLP DNA TypingExtractionExtraction of the DNA from the sample;blood, saliva, semen Production of Restriction FragmentsPurified DNA is then cut into fragmentsby RESTRICTION ENZYMES
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 26: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/26.jpg)
Patterns in DNAPatterns in DNA
Because there are only 4 nucleic acids, patterns occur in the DNA
Take the pattern GCGC Imagine it occurs more than once in the DNA Number of times it occurs is unique to the
individual
Using restriction enzymes we can chop the DNA into two at every place where the GCGC pattern occurs
Because there are only 4 nucleic acids, patterns occur in the DNA
Take the pattern GCGC Imagine it occurs more than once in the DNA Number of times it occurs is unique to the
individual
Using restriction enzymes we can chop the DNA into two at every place where the GCGC pattern occurs
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 27: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/27.jpg)
Patterns in DNAPatterns in DNA
Person 1; 5' GCGCATGTTGCGCAAGAGCGC 3'
Person 2; 5' GCGCATGAAGGCAATGAGCGC 3'
Person 1 - 2 large fragments; 5' G.....CGCATGTTG.....CGCAAGAG.....CGC 3'
Person 2 - 1 large fragment; 5' G.....CGCATGAAGGCAATGAG.....CGC 3'
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 28: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/28.jpg)
Gel ElectrophoresisGel Electrophoresis
22
11
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 29: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/29.jpg)
VisualisationVisualisation
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 30: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/30.jpg)
IdentificationIdentification
Parents and children Suspects at the scene of crime Populations of wildlife species for
conservation and environmental protection
Parents and children Suspects at the scene of crime Populations of wildlife species for
conservation and environmental protection
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 31: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/31.jpg)
DNA Typing TodayDNA Typing Today
Modern forensic DNA typing based on polymerase chain reaction
DNA polymerases enzymes involved in the process of
DNA replication Analysis of minute traces of DNA
found at a crime scene
Modern forensic DNA typing based on polymerase chain reaction
DNA polymerases enzymes involved in the process of
DNA replication Analysis of minute traces of DNA
found at a crime scene
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 32: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/32.jpg)
![Page 33: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/33.jpg)
FingerprintsFingerprints
Main method of identifying criminals Sweat and oils secreted by glands in
the dermis of the skin Tiny ridges of skin on a finger make a
pattern Each fingerprint is unique Even identical twins do not
have the same fingerprints
Main method of identifying criminals Sweat and oils secreted by glands in
the dermis of the skin Tiny ridges of skin on a finger make a
pattern Each fingerprint is unique Even identical twins do not
have the same fingerprints
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 34: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/34.jpg)
HistoryHistory Ancient History
ancient Chinese and Babylonian civilisations legal documents
Sir Francis Galton (1892) classification of fingerprints.
Sir Edward Henry (1897) modified classification system adopted by
Scotland Yard in 1901
FBI (1930) National fingerprint file set up in USA
Ancient History ancient Chinese and Babylonian civilisations legal documents
Sir Francis Galton (1892) classification of fingerprints.
Sir Edward Henry (1897) modified classification system adopted by
Scotland Yard in 1901
FBI (1930) National fingerprint file set up in USA
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 35: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/35.jpg)
Fingerprinting TodayFingerprinting Today
Dusting for prints fine powder that adheres to the traces of
oil and sweat.
Dusting is unsuitable for porous surfaces like paper or cloth another
Chemical treatments are used; iodine fuming ninhydrin superglue fuming
Dusting for prints fine powder that adheres to the traces of
oil and sweat.
Dusting is unsuitable for porous surfaces like paper or cloth another
Chemical treatments are used; iodine fuming ninhydrin superglue fuming
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 36: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/36.jpg)
AFISAFIS
FBI, Metropolitan Police in London (UK)
vast collectionsof fingerprints
making a match Automated
fingerprint identification systems (AFIS)
FBI, Metropolitan Police in London (UK)
vast collectionsof fingerprints
making a match Automated
fingerprint identification systems (AFIS)
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 37: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/37.jpg)
Lasers and FingerprintsLasers and Fingerprints
sample
laser
fibre optic
observer
filter
sample
laser
fibre optic
observer
filter
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm
![Page 38: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/38.jpg)
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/Luminol_test.htm
![Page 39: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/39.jpg)
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/Luminol_test.htm
![Page 40: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/40.jpg)
BloodstainsBloodstains Bloodstains at the scene of a crime;
occurrence of a blood stain in acertain place,
shape, position, size or intensityof a bloodstain
blood typing analysis
Important to be able to; identify a particular stain as
blood or not reveal "hidden" bloodstains
Bloodstains at the scene of a crime; occurrence of a blood stain in a
certain place, shape, position, size or intensity
of a bloodstain blood typing analysis
Important to be able to; identify a particular stain as
blood or not reveal "hidden" bloodstains
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/Luminol_test.htm
![Page 41: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/41.jpg)
The Luminol TestThe Luminol Test Haemoglobin
red pigment transports oxygen
around the body
Luminol Test
chemiluminescent reaction of the luminol reagent with the iron in the haemoglobin
Haemoglobin red pigment transports oxygen
around the body
Luminol Test
chemiluminescent reaction of the luminol reagent with the iron in the haemoglobin
http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/Luminol_test.htm
![Page 42: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website](https://reader035.vdocument.in/reader035/viewer/2022070400/56649f005503460f94c15c63/html5/thumbnails/42.jpg)
Career OpportunitiesCareer Opportunities
Forensic Industry Insurance claim investigation Risk assessment industry Government agencies Industry
chemical food pharmaceutical health
Forensic Industry Insurance claim investigation Risk assessment industry Government agencies Industry
chemical food pharmaceutical health