![Page 1: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/1.jpg)
CSCE555 BioinformaticsCSCE555 Bioinformatics
Lecture 6 Hidden Markov Models
Meeting: MW 4:00PM-5:15PM SWGN2A21Instructor: Dr. Jianjun HuCourse page: http://www.scigen.org/csce555
University of South CarolinaDepartment of Computer Science and Engineering2008 www.cse.sc.edu.
HAPPY CHINESE NEW YEAR
![Page 2: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/2.jpg)
RoadmapRoadmap
Probablistic Models of Sequences
Introduction to HMM
Profile HMMs as MSA models
Measuring Similarity between Sequence and
HMM Profile model
Summary
04/19/23 2
![Page 3: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/3.jpg)
Multiple Sequence Multiple Sequence AlignmentAlignmentAlignment containing multiple DNA / protein
sequencesLook for conserved regions → similar functionExample:
#Rat ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGT#Mouse ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGT#Rabbit ATGGTGCATCTGTCCAGT---GAGGAGAAGTCTGC#Human ATGGTGCACCTGACTCCT---GAGGAGAAGTCTGC#Oppossum ATGGTGCACTTGACTTTT---GAGGAGAAGAACTG#Chicken ATGGTGCACTGGACTGCT---GAGGAGAAGCAGCT#Frog ---ATGGGTTTGACAGCACATGATCGT---CAGCT
3
![Page 4: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/4.jpg)
Probablistic Model: Position-Probablistic Model: Position-specific scoring matrices specific scoring matrices ((PSSMPSSM))
![Page 5: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/5.jpg)
Difficulty in biological Difficulty in biological sequencessequencesVariation in a family of
sequences◦Gaps of variable lengths◦Conserved segments with different
degrees◦PSSM cannot handle variable-length
gaps◦Need a statistical sequence model
5
![Page 6: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/6.jpg)
Regular Expressions Regular Expressions ModelModelRegular expressions
◦Protein spelling is much more free that English spelling
◦
◦ [AT] [CG] [AC] [ACGT]* A [TG] [GC]
6
![Page 7: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/7.jpg)
RoadmapRoadmap
Probablistic Models of Sequences
Introduction to HMM
Profile HMMs as MSA models
Measuring Similarity between Sequence and
HMM Profile model
Summary
04/19/23 7
![Page 8: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/8.jpg)
Hidden Markov Model (HMM)Hidden Markov Model (HMM)HMM is:
◦Statistical model◦Well suited for many tasks in molecular
biologyUsing HMM in molecular biology
◦Probabilistic profile (profile HMM) From a family of proteins, for searching a
database for other members of the family Resemble the profile and weight matrix
methods
◦Grammatical structure Gene finding Recognize signals Prediction (must follow the rules of a gene)
8
![Page 9: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/9.jpg)
Detect Cheating in Coin Toss Detect Cheating in Coin Toss GameGame
Fair and biased coins could be used
Question: is it possible to determine whether a biased coin has been used based on the output sequence of the Head/Tail sequence?
HTTTHTHTHTTHHHHTHTHTHTHHHHTHT
![Page 10: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/10.jpg)
EXAMPLE : Fair Coin TossEXAMPLE : Fair Coin TossConsider the single coin scenarioWe could model the process producing
the sequence of H’s and T’s as a Markov model with two states, and equal transition probabilities: TH
0.5
0.5
0.50.5
Only one fair coin is used here
![Page 11: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/11.jpg)
Example: Fair and Biased Example: Fair and Biased CoinsCoinsConsider the scenario where there are two
coins: Fair coin and Biased coinVisible state do not correspond to hidden
state - Visible state : Output of H or T - Hidden state : Which coin was tossed
HTTTHTHTHTTHHHHTHTHTHTHHHHTHT
![Page 12: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/12.jpg)
12
Hidden Markov ModelsHidden Markov Models
![Page 13: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/13.jpg)
13
Ingredients of a HMMIngredients of a HMM Collection of states: {S1, S2,…,SN}
State transition probabilities (transition matrix)
Aij = P(qt+1 = Si | qt = Sj)
Initial state distribution
i = P(q1 = Si)
Observations: {O1, O2,…,OM}
Observation probabilities:
Bj(k) = P(vt = Ok | qt = Sj)
![Page 14: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/14.jpg)
14
Ingredients of Our HMMIngredients of Our HMM States:{Ssunny, Srainy, Ssnowy}
State transition probabilities (transition matrix)
A =
Initial state distribution
i = (.7 .25 .05)
Observations: {O1, O2,…,OM}
Observation probabilities (emission matrix): B =
.08 .15 .05
.38 .6 .02
.75 .05 .2
.08 .15 .05
.38 .6 .02
.75 .05 .2
![Page 15: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/15.jpg)
15
Probability of a Sequence of Probability of a Sequence of EventsEvents
P(O) = P(Ogloves, Ogloves, Oumbrella,…, Oumbrella)
= P(O | Q)P(Q) = P(O | q1,…,q7)
= 0.7 x 0.86 x 0.32
x 0.14 x 0.6 + …
all Q
q1,…q7
![Page 16: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/16.jpg)
16
Typical HMM ProblemsTypical HMM ProblemsAnnotation Given a model M and an observed
string S, what is the most probable path through M generating S
Classification Given a model M and an observed string S, what is the total probability of S under M
Consensus Given a model M, what is the string having the highest probability under M
Training Given a set of strings and a model structure, find transition and emission probabilities assigning high probabilities to the strings
![Page 17: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/17.jpg)
RoadmapRoadmap
Probablistic Models of Sequences
Introduction to HMM
Profile HMMs as MSA models
Measuring Similarity between Sequence and
HMM Profile model
Summary
04/19/23 17
![Page 18: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/18.jpg)
HMM Profiles as Sequence HMM Profiles as Sequence ModelsModelsGiven the multiple alignment of
sequences, we can use HMM to model the sequences
Each column of the alignment may be represented by a hidden state that produced that column
Insertions and deletions may be represented by other states
![Page 19: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/19.jpg)
Profile HMMsProfile HMMsHMM with a structure that in a natural
way allows position-dependent gap penalties◦Main states
model the columns of the alignment
◦Insert states model highly variable regions
◦Delete states to jump over one or more columns i.e. to model the situation when just a few of
the sequences have a “-” in the multiple alignment at a position
19
![Page 20: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/20.jpg)
HMM Sequences ContinuedHMM Sequences Continued
![Page 21: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/21.jpg)
Profile HMM ExampleProfile HMM Example Consider the following six sequences shown
below A multiple sequence alignment of these
sequences is the first step towards the processing of inducing the hidden markov model
SEQ1 G C C C A
SEQ2 A G C
SEQ3 A A G C
SEQ4 A G A A
SEQ5 A A A C
SEQ6 A G C
![Page 22: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/22.jpg)
Profile HMM TopologyProfile HMM Topology The topology of HMM is established using consensus
sequence The structure of a Profile HMM is shown below:- The square box represent match states Diamonds represent insert states Circles represent delete states
![Page 23: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/23.jpg)
Profile HMM Example Profile HMM Example ContinuedContinued
The aligned columns correspond to either emissions from the match state or to emissions from the insert state
The consensus columns are used to define the match states M1,M2,M3 for the HMM
After defining the match states, the corresponding insert and delete states are used to define the complete HMM topology
![Page 24: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/24.jpg)
Transition ProbabilitiesTransition ProbabilitiesThe values of the transition probabilities are
computed using the frequency of the transitions as each sequence is considered
The model parameters are computed using the state transition sequences shown in the figure below:-
![Page 25: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/25.jpg)
Transition Probabilities Transition Probabilities ContinuedContinued
The frequency of each of the transitions and the corresponding emission probabilities are shown below
State0 1 2 3
MMMDMI
4 5 6 41 0 0 -1 0 0 2
IMIDII
1 0 0 20 0 0 -0 0 0 2
DMDDDI
- 1 0 0- 0 0 -- 0 0 0
![Page 26: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/26.jpg)
Emission ProbabilitiesEmission ProbabilitiesThe emission probability is
computed using the formula:-
The emission probability specifies the probability of emitting each of the symbols in |∑ | in the state k
![Page 27: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/27.jpg)
Emission Probabilities Emission Probabilities ContinuedContinuedThe emission probability for each
state is computed as shown below:
![Page 28: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/28.jpg)
Searching the Profile Searching the Profile HMMHMMSequences can be searched against the
HMM to detect whether or not they belong to a particular family of sequences described by the profile HMM
Using a global alignment, the probability of the most probable alignment and sequence can be determined using the Viterbi algorithm
Full probability of a sequence aligning to the profile HMM determined using the forward algorithm
![Page 29: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/29.jpg)
How A Sequence Fit a How A Sequence Fit a Model?Model?
◦Probability depends on the length of the sequence
◦Not suitable to use as a score29
![Page 30: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/30.jpg)
Length-independent ScoreLength-independent ScoreLog-odds score
◦The logarithm of the probability of the sequence divided by the probability according to a null model
◦
◦
30
![Page 31: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/31.jpg)
Length-independent ScoreLength-independent ScoreHMM using log-odds
◦
◦
31
![Page 32: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/32.jpg)
SummarySummaryHMMHow to build Profile HMM modelScoring Fit between Sequence
and HMM model
![Page 33: CSCE555 Bioinformatics Lecture 6 Hidden Markov Models Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:](https://reader038.vdocument.in/reader038/viewer/2022110403/56649e5c5503460f94b54311/html5/thumbnails/33.jpg)
Next LectureNext LectureGene-findingReading:
◦Textbook (CG) chapter 4◦Textbook (EB) chapter 8