![Page 1: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/1.jpg)
December 14, 2012
Ted LiefeldBroad Institute of MIT and Harvard
![Page 2: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/2.jpg)
Gene mutation causing Leigh Syndrome French Canadian Type (LFSC) and 8 other mitochondrial diseases Integrate: candidate genomic region, mitochondrial proteomic data, and cancer expression compendium Authors: Mootha et al. 2003, Calvo et al. 2006Subtle repression of oxphos genes in diabetic muscle: role for mitochondrial dysregulation in diabetes pathology; new computational approach Gene Set Enrichment Analysis Integrate: Gene sets/pathways & processes with expression profilesAuthors: Mootha et al. 2003, Subramanian & Tamayo et al. 2005
IKBKE as a new breast cancer oncogeneIntegrate: RNAi screens, transformation of activated kinases, and copy number from SNP arrays of cell lines
Authors: Boehm et al. 2007
~3000 novel, large non-coding RNAs with functions in development, the immune response and cancerIntegrate: Genome sequences from 21 mammals, epigenomic maps, and expression profiles
Authors: Guttman, Rinn et al. 2009
Discovery of 3 new genes involved in Glioblastoma Multiforme (NF1, ERRB2, PIK3R1); Confirmation of TP53, PTEN, EGFR, RB1, PIK3CAIntegrate: DNA sequence, copy number, methylation aberrations and expression profiles in 206 glioblastomas
Authors: TCGA Research Network 2008
Characterization of disease subtypes and improved risk stratification for medulloblastoma patientsIntegrate: Copy number, expression, clinical data for 96 medulloblastoma patients
Authors: Tamayo et al., Cho et al. 2011
The promise of integrative genomics research
![Page 3: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/3.jpg)
Integrative genomics for translational research
GenePattern Cytoscape IGV/UCSC Genomica
Network
Compendium
Expression
Alterations
atcgcgtttattcgataaggatcgcgttttttcgataagg
CMAP
Add Transcription Factor track from UCSC
6
Looks close to p53 site
7 Test for similarity of
p53 and gene location
8
Extractmodule
ii
Learn p53 site/score on
promoteriv
Load compendium Show module
map i
Show Chromosome
5
Expand +1 (include
neighbors)
4
Show network
3
Differentially Expressed
Genes
1
Idea
GSEA test enrichment
2
iii
Arrests G2/M
Conclusionvi
Pathwayactivation
Added to GenePattern
v
ODF GMT
HTML
SIF
GCT GXP
NA gene list
GXC GRP
GFF GXA
![Page 4: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/4.jpg)
GenePatternCytoscapeIGV
GenomicaCMAPUCSC Browser
Analysis stepAnalysis conclusionWithin toolAcross tools
12 steps, 6 tools, 7 transitions
6 8
2 3 ii iii
4 5 iv v
1 i
![Page 5: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/5.jpg)
• A lightweight “connection layer” for a wide variety of integrative genomic analyseso Support for all types of resource: Web-based,
desktop, etc.o Automatic conversion of data formats between toolso Easy access to data from any locationo Any tool that joins is automatically connected to the
community of toolso Ease of entry into the environment
The Need
![Page 6: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/6.jpg)
Cloud-based storage API connectivity layer
Success stories from outside bioinformatics
![Page 7: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/7.jpg)
3 Driving BiologicalProjects
lincRNAs
Cancer stem cells
Patient Stratification
6 Seed Tools
CytoscapeGalaxy
GenePatternGenomica
IGVUCSC Browser
Outreach: new tools
Outreach: new DPBs
Online community to share diverse computational tools
www.genomespace.org
![Page 8: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/8.jpg)
![Page 9: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/9.jpg)
Seed Tools
Cytoscape Galaxy GenePattern
Genomica IGV UCSC Genome Browser
![Page 10: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/10.jpg)
GenomeSpace UI
![Page 11: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/11.jpg)
GenomeSpace Tool Enablement: GenePattern
![Page 12: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/12.jpg)
GenomeSpace Tool Enablement: GenePattern
![Page 13: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/13.jpg)
GenomeSpace Enablement: Cytoscape Plugin
![Page 14: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/14.jpg)
Automatic Data TransformationFrom format To Format Description
genomicatab gct Converts Genomica Tab format to gct formatadj xgmml Converts adjacency file to XGMMLgct gxp Converts gct stream to gxp format
gmt genomicatabConverts from gmt to Genomica tab using Perl script
res genomicatab Converts res to Genomica tab formatgct geneset.tab Converts gct to Genomica geneset.tab
reg2target gmtConverts galaxy regulators text format to MSigDB gmt
gct Cytoscape ATTRConverts GenePattern gct file to Cytoscape attribute format
res geneset.tab Converts res to Genomica geneset.tab
odf Cytoscape ATTRConverts GenePattern CMS results ODF file to Cytoscape attribute format
geneset.tab reg2targetConverts Genomica geneset.tab format to galaxy regulators text
gct geWorkbench exp Converts gct file to exp file.res gxp Converts res stream to gxp format
Cytoscape ATTR Cytoscape GeneMania attr Converts attr to GeneMania attrgxp gct Converts gxp stream to gct formatgct genomicatab Converts gct to Genomica tab format
reg2target geneset.tabConverts galaxy regulators text format to Genomica geneset.tab
![Page 15: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/15.jpg)
Additional Features• Collaborative tools
– Share folders to individuals, groups or the public– Create and manage groups– Make folders publicly viewable
• Additional storage options– Amazon S3 buckets– Local disk drives via OpenStack (in development)– Google Drive (planned development)– Dropbox (planned development)
• Utilities– File manipulation– Zip/unzip (planned development)
• Open Source– https://bitbucket.org/GenomeSpace/
![Page 16: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/16.jpg)
Community
As of Dec 8, 2012
1155 registered users~200 tool launches/week (all tools)
~580 file uploads/week1.7 TB of managed data files
![Page 17: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/17.jpg)
Plugin
• Plugin available for Cytoscape 2.8– Jnlp launch
• App for 3.0 is coming– OSGI packaging of Java CDK is complete– Should make it possible for other apps to use GS
dialogs to load/save data
![Page 18: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/18.jpg)
GenomeSpace-enablement of new tools & Cytoscape Plugins/Apps
Basic GenomeSpace enablement in ≤ 1 programmer day– GenomeSpace RESTful API– Client Development Kit (CDK)– Data Transfer Utilities– Documentation
![Page 19: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/19.jpg)
Cistrome (DFCI) geWorkbench (Columbia U)
InSilicoDB (ULB) ArrayExpress (EBI)
![Page 20: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/20.jpg)
Archon Genomics X-Prize
![Page 21: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/21.jpg)
Other collaborating projects
• Reactome (Ontario Institute for Cancer Research)
• Taverna/MyExperiment (University of Manchester)
• Sage Synapse (Sage Bionetworks)
• National Center for Biomedical Ontology (Stanford University)
• ISA Tools (University of Oxford)
![Page 22: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/22.jpg)
Be an adopter!
Explore GenomeSpacesign up for an account
www.genomespace.org
• Users with driving biological projects• Cytoscape Plugin/App Developers
– Add your tools– Contribute format converters
• Build the infrastructure – its open source• Data providers
– Link your data
![Page 23: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/23.jpg)
Acknowledgements
Broad InstituteTed LiefeldHelga ThorvaldsdottirJim RobinsonMarco OcanaThorin TaborJill Mesirov, PI
GenomeSpace CollaboratorsCytoscape: Trey Ideker Lab, UCSDGalaxy: Anton Nekrutenko Lab, Penn State University Genomica: Eran Segal Lab, Weizmann InstituteUCSC Browser TeamGenePattern TeamIGV Team
Driving Biological ProjectsHoward Chang Lab – Stanford UniversityAviv Regev Lab – Broad Institute Funding
GenomeSpace team: [email protected]
![Page 24: December 14, 2012 Ted Liefeld Broad Institute of MIT and Harvard](https://reader031.vdocument.in/reader031/viewer/2022012922/56816777550346895ddc7508/html5/thumbnails/24.jpg)
Thank You…