![Page 1: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/1.jpg)
DNA
How is the expression of genes controlled in prokaryotes?
What are some ways the expression of genes are controlled in eukaryotes?
What are histones?
![Page 2: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/2.jpg)
DNA Technology
Meet Dolly
![Page 3: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/3.jpg)
Biotechnology
The manipulation of organisms or use of living things as technology
i.e. genetic engineering, manipulating genes for practical purposes
![Page 4: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/4.jpg)
Studying One Gene
If we want to study a particular gene in depth, it is cumbersome to use the entire DNA molecule
Much easier if we can make multiple copies of that one gene to focus on
![Page 5: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/5.jpg)
Gene Cloning
We will first look at the overview of cloning a particular gene, then go into it in detail
The goal is to create multiple copies of a single segment of DNA
![Page 6: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/6.jpg)
Step 1A
Isolate a plasmid from a bacterial cell
![Page 7: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/7.jpg)
Step 1B
Isolate the DNA we wish to clone
![Page 8: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/8.jpg)
Step 2
Insert gene into plasmid
Recombinant DNA
![Page 9: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/9.jpg)
Step 3
Reinsert Plasmid into Bacteria
Recombinant Bacterium
![Page 10: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/10.jpg)
Step 4
Plasmids replicate independently, reproducing the gene of interest
![Page 11: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/11.jpg)
Step 5 / Step 6
Identify the bacterial plasmids that did in fact clone the gene
Use the gene! Can use copies of the gene itself Can use the protein products of the gene
![Page 12: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/12.jpg)
Why Is This Useful?
We can insert genes into other organisms
i.e. in agriculture we can introduce pest-resistance to crops
Alter bacteria to accomplish a task Create proteins for medicines and other uses
Create Human Growth Hormone to treat short kids
![Page 13: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/13.jpg)
Restriction Enzymes
Cut DNA at specific places (recognize target sequences)
Used to combat foreign DNA in nature
Create restriction fragments
Creates the same fragments every time
![Page 14: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/14.jpg)
Sticky Ends
Doesn't cut at the same spot on both strands
Leaves single stranded edges called sticky ends
These two ends can be resealed by DNA ligase
Or new DNA can be inserted between
![Page 15: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/15.jpg)
Recombinant DNA using Restriction Enzymes
![Page 16: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/16.jpg)
DNA
What is a restriction enzyme? What are sticky ends? What is a plasmid? What are some of the uses of genetic
engineering?
![Page 17: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/17.jpg)
A More Detailed Look at Cloning
We use a plasmid containing 2 useful genes
1 – ampicillin resistance
2 – lacz gene Called a cloning
Vector Easy to insert in
bacteria
![Page 18: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/18.jpg)
Restriction Enzyme Targets lacz Gene
A restriction enzyme recognizes and cuts a segment of the lacz gene
Also cuts DNA containing gene of interest into small fragments
![Page 19: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/19.jpg)
Mix Plasmids with Our DNA
Sticky ends of plasmid can base pair with sticky ends of DNA
Also end up with plasmid-plasmid combos and DNA-DNA combos etc.
Seal Plasmid and DNA using DNA ligase
![Page 20: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/20.jpg)
Some Plasmids take in the DNA, some Don't
DNA is inserted in the middle of the lacz gene if DNA is taken by plasmid
Amp gene is intact either way
![Page 21: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/21.jpg)
Introduction of Plasmids to Bacterial Cells
Recall transformation, bacteria will take up plasmids
The bacteria do not have the lacz gene
Some bacteria take in plasmids with our DNA
Some take in unaffected plasmids
![Page 22: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/22.jpg)
Plate the Bacteria
We place the bacteria on a plate containing ampicillin and X-gal
Only bacteria containing the plasmid can grow (the ampicillin resistance allows their survival)
Bacterial Colonies
![Page 23: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/23.jpg)
What Is X-Gal?
X-gal reacts with galactosidase to create a blue product
The product of the lacz gene breaks down galactosidase
If the lacz gene is intact – no blue
If there is foreign DNA then lacz gene is interrupted and bacteria are blue White Blue
![Page 24: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/24.jpg)
Checking our Agar Plate
Blue colonies have taken in foreign DNA in their plasmids
White colonies have the plasmid – but no foreign DNA is in the plasmid and the lacz gene is intact
![Page 25: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/25.jpg)
Isolate Our Gene of Interest
The foreign DNA may not have been the gene we care about!
We must use nucleic acid probe (a short segment of complementary DNA) to find the gene of interest
Attach fluorescent protein to probe
![Page 26: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/26.jpg)
Making the Bacteria Express the Gene
We can express the gene in the bacteria, but sometimes we need to insert a promoter as well
Called an expression vector
The promoter tells the prokaryotic RNA polymerase to transcribe the gene
![Page 27: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/27.jpg)
cDNA
Introns are a pain for prokaryotes
Sometimes it's necessary to make DNA without the introns first
Use reverse transcriptase to make cDNA from mRNA
![Page 28: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/28.jpg)
Genomic Library vs. cDNA library
Collection of all of the segments of the DNA that is separated by restriction fragments
The library will have multiple copies of each gene
Some genes are split between two segments
cDNA library contains only the segments that code for a gene
In fact only codes for genes transcribed – useful for studying genes expressed in brain cells for example
![Page 29: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/29.jpg)
Polymerase Chain Reaction (PCR)
Allows us to quickly make many copies of a segment of DNA
Very specific, due to use of specific primers that recognize each gene
Need only small amount of DNA to replicate
![Page 30: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/30.jpg)
PCR
Heat the DNA to separate the strands
Cool strands and allow DNA primers to bind to DNA
DNA polymerase synthesizes new strand
Repeat
![Page 31: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/31.jpg)
Why is PCR So Amazing?
From a small amount of DNA we can make millions of copies
Important in solving crimes with DNA, determining paternity etc.
Useful for a lot of other biotech processes
![Page 32: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/32.jpg)
Gel Electrophoresis
Separates DNA, Proteins etc. based on charge and size
For DNA, all molecules have the same charges, so separates DNA by length of strand
![Page 33: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/33.jpg)
Restriction Fragment Analysis
Cut pieces of DNA with restriction enzymes
The same DNA with the same enzymes will produce the same fragments every time
Show up as bands on gel electrophoresis
![Page 34: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/34.jpg)
Southern Blotting
The full genome has too many genes to use simple gel electrophoresis (get too many bands)
But we can use Southern Blotting to identify only the genes we care about
![Page 35: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/35.jpg)
Southern Blotting
We add radioactively labelled DNA to our gel electrophoresis
We can figure out A) if the DNA segment we are interested in is present and
B) What size fragment the segment is located on
C) How many times the gene is present
![Page 36: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/36.jpg)
![Page 37: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/37.jpg)
Restriction Length Polymorphisms (RFLPs)
Recall that human's have DNA that is 99.9% similar
So how can we compare DNA? By identifying locations in the genome where
people often differ If two people differ in a nucleotide that is part of
a restriction site, then only one of the people will have their DNA cut by that restriction enzyme
![Page 38: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/38.jpg)
RFLPs
![Page 39: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/39.jpg)
Finding Genes in Genomes
In situ hybridization Use a radioactive
probe that can base pair with the gene
i.e. we can see if a gene from a mouse is present in humans
![Page 40: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/40.jpg)
The Human Genome Project
Working version of genome worked out in 2000
“Final Draft” in 2003 Not a single individual
– there are many places where nucleotides differ
Available on the Internet
![Page 41: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/41.jpg)
Genetic Linkage Mapping
As discussed earlier, we can figure out the order of genes by the frequency of recombination
Genes that are further apart are more likely to be separated during crossing over
![Page 42: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/42.jpg)
Getting the Whole Genome
Cut the genome into tons of little pieces
These pieces are identifiable restriction fragments
Then order fragments by how they overlap
Must first clone DNA so we have copies
![Page 43: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/43.jpg)
Chromosome Walking
Each segment overlaps, so we can use the end of one segment to probe for the next segment
![Page 44: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/44.jpg)
DNA Sequencing (The Basics)
We take a strand of DNA and make copies of it The DNA is added to a solution containing
everything necessary for DNA replication Primer, DNA Polymerase, A, T, G and C
nucleotides One more ingredient in each batch
![Page 45: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/45.jpg)
Dideoxy Nucleotides!
Special nucleotides that are missing another OH group
ddA nucleotides are added to the DNA
If a dd nucleotide is added DNA replication ends
No phosphodiester bond can be made
Each dd nucleotide is labelled with a fluorescent color
![Page 46: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/46.jpg)
Synthesize New DNA
The DNA is replicated, BUT replication ends as soon as a dd nucleotide is added
We end up with a bunch of different length strands, each labelled by the dd nucleotide on the end
![Page 47: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/47.jpg)
DNA Segments Are Separated By Size
DNA is run through a machine – smaller segments get through faster
A computer reads the color at the end
Tells us the order of the nucleotides
![Page 48: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/48.jpg)
Much Faster than the Sanger Method
This revolutionized the Human Genome Project Sanger method – have 4 batches, introduce 1
dd nucleotide to each batch Use gel electrophoresis 4 separate times to
determine the length of the strands ending in A, C, G and T
![Page 49: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/49.jpg)
We Can Use cDNA to Identify Which Genes Are Expressed
Separate genes (by gene cloning and hybridization)
Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA
![Page 50: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/50.jpg)
Microassay
![Page 51: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/51.jpg)
Practical Applications
Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!
![Page 52: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/52.jpg)
Identifying Diseases
Using PCR we can identify a small amount of a virus in a blood sample
Can examine a person's genes to look for diseases
i.e. Huntington's disease
![Page 53: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/53.jpg)
Gene Therapy
Correct genetic disorders by changing genes or inserting genes
Can we change a person's genes using retroviruses?
Ethical dilemma?
![Page 54: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/54.jpg)
Pharmaceuticals
Make hormones and proteins using bacteria
Make vaccines by altering viruses
Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?
![Page 55: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/55.jpg)
Forensics
We can match up DNA found at a crime scene with suspect's DNA
Used both to help prove guilt and innocence!
Ethical dilemma – should we store DNA of convicted criminals?
![Page 56: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/56.jpg)
Agricultural Uses
Bovine Growth Hormone to raise milk production
Can speed up growth of animals
Easier to manipulate genes in plants
Can introduce pest resistance, or change nutrition
![Page 57: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/57.jpg)
Ti Plasmids in Plants
Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria
Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant
![Page 58: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/58.jpg)
![Page 59: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/59.jpg)
Gene CloningRestriction Enzyme
Plasmid
![Page 60: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/60.jpg)
Restriction Enzyme Cuts Plasmid
Sticky Ends
![Page 61: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/61.jpg)
Same Restriction Enzyme Cuts DNA
![Page 62: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/62.jpg)
Mix Plasmid and DNA
![Page 63: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/63.jpg)
Make Bacteria Take Up Plasmid
![Page 64: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/64.jpg)
Place Bacteria on Agar Plate
![Page 65: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/65.jpg)
Bacteria with No Plasmids Are Killed By Ampicillin
ampicillin
![Page 66: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/66.jpg)
Bacteria with DNA Turns Blue
Our DNA
![Page 67: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/67.jpg)
Bacteria and Plasmids Replicate
![Page 68: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/68.jpg)
DNA Libraries
![Page 69: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/69.jpg)
DNA Libraries
Genomic(all DNA)
cDNA(DNA expressed)
Then we make copies!
![Page 70: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/70.jpg)
Isolate Cells and Collect mRNA
Cells from Brain Tissue
RNA Polymerase
pre-mRNA
SpliceosomemRNA
![Page 71: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/71.jpg)
Make cDNA out of RNA
mRNAReverse Transcriptase
DNA
DNA Polymerase
cDNA
![Page 72: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/72.jpg)
DNA Libraries
Genomic(all DNA)
cDNA(DNA expressed)
![Page 73: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/73.jpg)
Restriction Fragment Length Polymorphism
AAAATTTTAAAATTTTAAAATTTT TTTTAAAATTTTAAAATTTTAAAA
AAAATTTTAAAGTTTTAAAATTTT TTTTAAAATT TCAAAATTTTAAAA
We find the one spot in the sequence where human's are known to differ. We can then find a restriction enzyme that cuts around that spot
![Page 74: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/74.jpg)
If We Then Place the DNA in Gel Electrophoresis, We Can Tell the
DNA Apart
![Page 75: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/75.jpg)
Southern Blotting
DNA A DNA B DNA C
Red is our gene of interest. We can check if any of the 3 individuals have it and how many times. If we have a sample containing the gene 3 times, we can figure out which person it belongs to
![Page 76: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/76.jpg)
Chop up DNA with Restriction Enzyme
DNA A DNA B DNA C
![Page 77: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/77.jpg)
Use Gel Electrophoresis to Separate Fragments
![Page 78: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/78.jpg)
Use X-Ray to View Only the Gene of Interest
Compare that to our sample DNA to confirm a match!
![Page 79: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/79.jpg)
Chromosome Walking
ACGTTGCATTGCAACGTA Use GCAT as a probe
![Page 80: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/80.jpg)
Chromosome Walking
ACGTTGCATTGCAACGTA
GCATACGTCGATTGCGTATGCAGCTAAC
Use ATTG as probeGATTGCCTGC
CTAACCGACG
![Page 81: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/81.jpg)
We Can Use cDNA to Identify Which Genes Are Expressed
Separate genes (by gene cloning and hybridization)
Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA
![Page 82: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/82.jpg)
Microassay
Fluorescent labelled cDNA from a salivary gland
![Page 83: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/83.jpg)
Practical Applications
Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!
![Page 84: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/84.jpg)
Identifying Diseases
Using PCR we can identify a small amount of a virus in a blood sample
Can examine a person's genes to look for diseases
i.e. Huntington's disease
![Page 85: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/85.jpg)
Gene Therapy
Correct genetic disorders by changing genes or inserting genes
Can we change a person's genes using retroviruses?
Ethical dilemma?
![Page 86: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/86.jpg)
Pharmaceuticals
Make hormones and proteins using bacteria
Make vaccines by altering viruses
Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?
![Page 87: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/87.jpg)
Forensics
We can match up DNA found at a crime scene with suspect's DNA
Used both to help prove guilt and innocence!
Ethical dilemma – should we store DNA of convicted criminals?
![Page 88: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/88.jpg)
Agricultural Uses
Bovine Growth Hormone to raise milk production
Can speed up growth of animals
Easier to manipulate genes in plants
Can introduce pest resistance, or change nutrition
![Page 89: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/89.jpg)
Ti Plasmids in Plants
Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria
Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant
![Page 90: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?](https://reader030.vdocument.in/reader030/viewer/2022032606/56649eb45503460f94bbc1fc/html5/thumbnails/90.jpg)
DNA
How can we separate bacteria that took up the plasmid from those that did not? What important gene does the plasmid contain?
How can we separate bacteria that have our DNA in them from those that do not What gene gets interrupted when foreign DNA is
inserted? What is Gel Electrophoresis?