Download - DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)
![Page 1: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/1.jpg)
DNA Study Guide
35 multiple choice 1 DNA problem (replication, transcription, & translation)
![Page 2: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/2.jpg)
Experiments leading to the structure of DNA…a) What happened when Griffith mixed heat-
killed, disease causing bacteria with live harmless bacteria?
The mice died
b) What did Avery’s experiments prove about the transformation factor?
It was DNA
![Page 3: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/3.jpg)
Experiments leading to the structure of DNA…
c) State Chargaff’s Rule
A pairs with TC pairs with G
d) What did Wilkins and Franklin learn with their x-ray diffraction photographs?
DNA molecule is arranged as a tightly coiled double helix
![Page 4: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/4.jpg)
Experiments leading to the structure of DNA…
e) Which scientist (s) are given credit for determining the structure of DNA?
- Francis Crick and James Watson
e) What is so important about DNA? It stores and transmits our
genetic information!
![Page 5: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/5.jpg)
Nucleotide unique to DNAThymine!! Bases in DNA:
A (adenine)T (thymine)C (cytosine)G (guanine)
DEOXYRIBOSE
THYMINE
![Page 6: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/6.jpg)
Nucleotide unique to RNA Uracil!!
Bases in RNA: A (adenine) U (uracil) C (cytosine) G (guanine)
RIBOSEURACIL
![Page 7: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/7.jpg)
Nucleotides – building blocks of DNA & RNA1. What is different about
these nucleotides?
The nitrogen base DNA – thymine RNA - uracil
Sugar DNA – deoxyribose RNA - ribose
2. What is the same about them?
Both have a phosphate group
Both have the bases A, C, G
![Page 8: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/8.jpg)
3. What instructions do your genes carry? Instructions for making a protein
4. What are purines and pyrimidines? Nitrogen bases found in DNA & RNA
nucleotides
5. What is true about the percentage of purines and pyrimidines in a DNA molecule?
They are equal
6. In RNA, what base does adenine pair with? URACIL
![Page 9: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/9.jpg)
DNA Replication7. What is the purpose of DNA replication?
Copy DNA (for cell division later)8. What is the complementary DNA strand?
A T T C G C A T G GT A A G C G T A C C
9. Describe the strands of the new DNA molecule.
Each with 1 new strand that is complementary to the original strand.
![Page 10: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/10.jpg)
DNA Replication
10. Name the enzyme responsible for adding nucleotides to the growing DNA chain.
DNA Polymerase
![Page 11: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/11.jpg)
Name that Process…
11. Process that makes RNA molecules:
Transcription
12. Cell uses information from mRNA to produce proteins:
Translation
![Page 12: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/12.jpg)
Protein Synthesis
13. Types of RNA needed for protein synthesis…
mRNA
tRNA
rRNA
![Page 13: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/13.jpg)
Protein Synthesis15. Which type of RNA forms ribosomes?
rRNA16. Where does mRNA go once it is made? (hint:
organelle responsible for making proteins)
ribosome17. During translation, how does your body determine
the type of amino acid to add to the polypeptide chain?
Codon on the mRNA & the complementary anticodon on the tRNA where the amino acid is attached
![Page 14: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/14.jpg)
Protein Synthesis18. How does tRNA act as an “interpreter” during
protein synthesis? It brings an amino acid to its
correct codon19. What is the name for a nucleotide triplet in
mRNA, which identifies a specific amino acid? CODON
20. How many codons are needed to specify 3 amino acids?
THREE
![Page 15: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/15.jpg)
Protein Synthesis21. Why is it possible for an amino acid to be
specified by more than one kind of codon? There are 64 codons that code for
amino acids and only 20 amino acids22. During translation, what happens when a
tRNA anticodon binds to a mRNA codon? The amino acid detaches from the
tRNA and attaches to the end of a growing protein chain
![Page 16: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/16.jpg)
Mutation open-ended:
What’s a mutation – What are the 3 types –Which type is the most disastrous?Can mutations be passed on?Identify a common mutagen.
![Page 17: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/17.jpg)
DNA: CCATTGAGATCAATTGCGGTAT
DNA:
![Page 18: DNA Study Guide 35 multiple choice 1 DNA problem (replication, transcription, & translation)](https://reader035.vdocument.in/reader035/viewer/2022072011/56649e265503460f94b15618/html5/thumbnails/18.jpg)
DNA:TACAGATTCCAAGGGCTCTCTGATT
mRNA:
tRNA:
AA: