DOCTOR OF PHILOSOPHY (PH.D.) DISSERTATION
ROLE OF ADENOSINE RECEPTORS IN REGULATING CLASSICAL
AND ALTERNATIVE ACTIVATION OF MICROGLIA AND
MACROPHAGES
BALÁZS KOSCSÓ
SUPERVISOR: GYÖRGY HASKÓ, MD, PHD
EÖTVÖS LÓRÁND UNIVERSITY
DOCTORATE SCHOOL IN BIOLOGY
IMMUNOLOGY PROGRAM
HEAD OF SCHOOL AND PROGRAM: PROF. ANNA ERDEI
INSTITUTE OF EXPERIMENTAL MEDICINE, HUNGARIAN ACADEMY OF SCIENCES,
BUDAPEST, HUNGARY
UNIVERSITY OF MEDICINE AND DENTISTRY OF NEW JERSEY, NEWARK, NEW JERSEY,
USA
BUDAPEST, 2012
2
Table of Contents
1. Abstract .................................................................................................................................... 4
2. Abbreviatons:........................................................................................................................... 5
3. Introduction ............................................................................................................................. 7
3.1. Mononuclear phagocytes.................................................................................................. 7
3.2. Microglia: mononuclear phagocytes of the brain ............................................................. 7
3.3. Cytokine production by microglia.................................................................................... 9
3.4. Alternative activation of macrophages ........................................................................... 11
3.5. Adenosine is an extracellular signaling molecule .......................................................... 13
3.6. Adenosine receptors (ARs) ............................................................................................ 14
3.7. Immunomodulatory effects of adenosine ....................................................................... 14
3.8. Aims of the study ........................................................................................................... 15
4. Materials and methods ........................................................................................................... 17
4.1. Drugs and reagents ......................................................................................................... 17
4.2. Experimental animals ..................................................................................................... 18
4.3. Cell cultures.................................................................................................................... 18
4.4. Enzyme-linked immunosorbent assay (ELISA) for determining cytokine production.. 19
4.5. RNA extraction, cDNA synthesis, and real-time polymerase chain reaction (PCR) ..... 19
4.6. Transient transfection of BV-2 cells with IL-10 promoter-luciferase and pCRE
luciferase constructs and luciferase assay ................................................................................. 20
4.7. Transient transfection of RAW 264.7 cells with arginase-1 promoter-luciferase
construct, C/EBP luciferase construct, and luciferase assay ..................................................... 21
4.8. Whole cell protein isolation and Western blotting ......................................................... 21
4.9. Silencing CREB using lentivirally-delivered shRNA .................................................... 22
4.10. Chromatin immune precipitation (ChIP) .................................................................... 23
4.11. Determination of arginase activity from macrophage cell extracts ............................ 23
4.12. Statistical analysis....................................................................................................... 23
5. Results ................................................................................................................................... 24
5.1. Adenosine augments IL-10 and inhibits IL-6, TNF-α and IL-12 production by activated
microglia.................................................................................................................................... 24
5.2. The effect of adenosine on IL-10 production by BV-2 cells is A2BAR-dependent........ 25
5.3. AR activation augments IL-10 mRNA accumulation in a CREB-dependent manner ... 27
3
5.4. Adenosine augments IL-4- and IL-13-induced alternative macrophage activation by a
TLR4-independent mechanism ................................................................................................. 33
5.5. Role of A2A and A2B ARs in mediating the stimulatory effect of adenosine on alternative
macrophage activation............................................................................................................... 37
5.6. C/EBP is required but CREB and STAT-6 are dispensable for the stimulatory effect of
adenosine on arginase-1 expression in IL-4-stimulated macrophages ...................................... 39
5.7. Role of intracellular kinases in mediating the effect of adenosine on alternative
macrophage activation............................................................................................................... 42
6. Discussion .............................................................................................................................. 44
6.1. Stimulatory effect of AR activation on IL-10 production by microglia ........................ 44
6.2. Adenosine enhances the alternative activation of macrophages .................................... 47
7. References ............................................................................................................................. 52
8. List of publications: ............................................................................................................... 71
9. Acknowledgements ............................................................................................................... 72
10. Összefoglalás ......................................................................................................................... 73
4
1. Abstract
Mononuclear phagocytes in both the central nervous system and periphery are central to
orchestrating innate immune responses to pathogens. The function of mononuclear phagocytes is tightly
regulated by adenosine, an endogenous purine nucleoside, which is a ligand of four G protein-coupled
adenosine receptors (ARs): A1AR, A2AAR, A2BAR and A3AR. Microglia, which are the main
mononuclear phagocyte population in the central nervous system, are activated by pathogen-associated
molecular patterns and produce proinflammatory cytokines, such as tumor necrosis factor-α, interleukin
(IL)-6, and IL-12, and the anti-inflammatory cytokine IL-10. ARs have been shown to suppress TNF-α
production by microglia, but their role in regulating IL-10 production has not been studied. Here, we
demonstrate that adenosine augments IL-10 production by murine microglia activated by Toll-like
receptor ligands while suppressing the production of proinflammatory cytokines. Our data from
pharmacological experiments suggest that the stimulatory effect of adenosine on IL-10 production is
mediated by the A2BAR. Mechanistically, adenosine augmented IL-10 mRNA accumulation by a
transcriptional process. Using mutant IL-10 promoter constructs we showed that a cAMP responsive
element binding protein (CREB)-binding region in the promoter mediated the augmenting effect of
adenosine on IL-10 transcription. The role of CREB was confirmed by chromatin immunoprecipitation
analysis and RNA interference. In addition, we showed that activation of p38 mitogen-activated protein
kinase and phosphatidylinositol 3-kinase by adenosine was necessary for the stimulatory effect of
adenosine on IL-10 production. In the periphery, adenosine had been shown to suppress the
proinflammatory responses of classically activated macrophages, which are induced by Th1 cytokines.
However, the role of adenosine in governing alternative macrophage activation, induced by the Th2
cytokines interleukin IL-4 and IL-13 had been unknown. We have discovered that AR activation
augments the IL-4 or IL-13-induced expression of alternative macrophage markers arginase-1, tissue
inhibitor of matrix metalloproteinase-1 and macrophage galactose-type C-type lectin-1. The stimulatory
effect of adenosine required primarily A2BARs. Of the transcription factors known to drive alternative
macrophage activation, CCAAT-enhancer-binding protein was required, while CREB and signal
transducer and activator of transcription 6 were dispensable in mediating the effect of adenosine.
Collectively, our results establish that A2BARs not only augment IL-10 production by classically activated
murine microglia but also increase the alternative activation of macrophages.
5
2. Abbreviatons:
A1AR A1 adenosine receptor
A2AAR A2A adenosine receptor
A2BAR A2B adenosine receptor
A3AR A3 adenosine receptor
AD Alzheimer’s disease
AMP adenosine 5’-monophosphate
ADP adenosine 5’-diphosphate
ATP adenosine 5’-triphosphate
cAMP cyclic adenosine 5’-monophosphate
C/EBPβ CCAAT-enhancer-binding protein
ChIP chromatin immunoprecipitation
CNS central nervous system
CREB cAMP responsive element-binding protein
COPD chronic obstructive pulmonary disease
DC dendritic cell
DMEM Dulbecco’s Modified Eagle Medium
EAE experimental autoimmune encephalomyelitis
EC50 half maximal effective concentration
ELISA enzyme-linked immunosorbent assay
EPAC exchange protein directly activated by cAMP
ERK extracellular signal-regulated kinase
FBS fetal bovine serum
GPCR G protein coupled receptor
HRP horseradish peroxidase
IB-MECA N6-(3-iodobenzyl)-adenosine-5′-N-methylcarboxamide
IFN interferon
Ig immunoglobulin
iNOS inducible nitric oxide synthase
IL interleukin
JAK janus-activated kinase
JNK c-Jun N-terminal kinase
6
KO knockout
LPS lipopolysaccharide
MAPK mitogen-activated protein kinase
mgl-1 macrophage galactose-type C-type lectin
MIP macrophage inflammatory protein
MMP matrix metalloproteinase
NF-κB nuclear factor kappa B
NLR NOD-like receptor
NLRP3 NOD-like receptor P3
NO nitric oxide
NOD nucleotide-binding oligomerization domain
PAMP pathogen associated molecular pattern
PBS phosphate buffered saline
PCR polymerase chain reaction
PGN peptidoglycan
PI3K phosphatidylinositol 3-kinase
PKA protein kinase A
PLC phospholipase C
PRR pathogen recognition receptor
RELM-α resistin-like molecule-α
SEM standard error of the mean
shRNA small hairpin ribonucleic acid
STAT signal transducer and activator of transcription
TH T helper
TG thioglycollate
TIMP-1 tissue inhibitor of metalloproteinase
TLR toll-like receptor
TNF-α tumor necrosis factor alpha
VEGF vascular endothelial growth factor
WT wildtype
7
3. Introduction
3.1. Mononuclear phagocytes
The central components of the mononuclear phagocytic system, monocytes, macrophages
and dendritic cells (DCs) originate from hematopoietic stem cells in the bone marrow and the
yolk sac (Schulz et al., 2012). The hematopoietic stem cells give rise to myeloid precursors,
which is followed by the development of macrophage/DC progenitors, which in turn develop into
monocytes or common DC precursors (Geissmann et al., 2010). Monocytes circulate in the blood
and enter tissues to replenish the pool of resident macrophages and DCs in steady state or in
response to inflammation. A variety of cell surface molecules, including F4/80 (Dunkelberger et
al., 2012), CD11b and CD18 (together forming the macrophage-1 antigen which is also called
complement receptor 3) (Ehlers, 2000; Schulz et al., 2012) are often used as macrophage
markers.
Tissue resident macrophages constantly survey their surroundings for signs of tissue
damage or infections and maintain tissue homeostasis by removing dead cells and toxic
materials. In case of infections or tissue injury, macrophages phagocytose and kill bacteria,
present antigens to T lymphocytes and secrete inflammatory cytokines, free radicals,
antimicrobial peptides and angiogenic factors. Specialized tissue resident macrophages include
osteoclasts (bone), alveolar macrophages (lung), Kupffer cells (liver) and microglia (brain)
(Murray and Wynn, 2011b).
3.2. Microglia: mononuclear phagocytes of the brain
Microglia, which comprise 5 to 20 % of the total glial population of the central nervous
system (CNS), were first described by Nissl (Nissl, 1899). Microglia were further characterized
by Santiago Ramon y Cajal and Pio del Rio-Hortega (Ransohoff and Cardona, 2010) who
proposed the mesodermal origin of this cell type. The myeloid origin of microglia has been
confirmed using mice deficient in the myeloid-specific transcription factor PU.1, as microglia
were absent in the CNS of PU.1-/-
mice (McKercher et al., 1996). Myeloid progenitors of the yolk
sac enter the developing brain during early embryogenesis to establish the self-renewing
microglial population in the brain parenchyma (Ajami et al., 2007; Saijo and Glass, 2011). The
number of microglia increases in the CNS during pathophysiological conditions as a consequence
of in situ proliferation of resident cells. In addition, in certain disorders of CNS, the blood-brain
8
barrier becomes disrupted, which process allows blood monocytes to enter the brain and adopt
microglial-morphology therefore contributing to microgliosis (Flugel et al., 2001).
Microglia can be found in the CNS in three morphological states, which are ramified,
activated and amoeboid. In healthy brain, microglia exhibit a ramified phenotype consisting of a
small soma with extensively branched processes, which continuously monitor their surroundings
(Ransohoff and Perry, 2009). Once activated by invading pathogens or danger signals, microglia
adopt a macrophage-like morphology consisting of enlarged soma and shortened processes
(Ransohoff and Cardona, 2010). Activated microglia secrete proinflammatory cytokines and
chemokines, have an enhanced ability to phagocytose cells and debris, and increase their antigen
presentation capacity. Activated microglia contribute to inflammatory processes during
neurodegenerative diseases, such as multiple sclerosis (Gandhi et al., 2010), Alzheimer’s disease
(AD) (Amor et al., 2010; Combs, 2009) and Parkinson’s disease (Badoer, 2010; Collins et al.,
2012). Microglia with amoeboid morphology are rounded, phagocytic cells with sparse
processes, and produce neurotrophic factors (Saijo and Glass, 2011) and participate in synapse
remodeling (Polazzi and Monti, 2010). Additionally, amoeboid microglia have an important role
in removal of cell debris and in the reduction of the number of neurons during the development
of the CNS (Neumann et al., 2009).
Microglia, similar to other mononuclear phagocytes, recognize molecules that are
associated with invading pathogens or endogenous danger signals through pathogen recognition
receptors (PRRs). The unique molecular structures that are recognized by PRRs are called
pathogen-associated molecular patterns (PAMPs) when they are derived from pathogens and
damage-associated molecular patterns when they originate endogenously in the tissues. For
example, microglia express retinoic acid-inducible gene I-like receptors, which recognize
negative sense RNA viruses, such as vesicular stomatitis virus or Sendai virus (Furr et al., 2008).
Microglia also express various members of the nucleotide-binding oligomerization domain
(NOD)-like receptor (NLR) family including NOD2 and NOD-like receptor P3 (NLRP3). It has
been shown that both intact Streptococcus pneumoniae and the bacterial cell wall product
muramyl dipeptid activate microglia through NOD2 (Chauhan et al., 2009; Liu et al., 2010).
NLRP3 expressed by microglia recognizes the AD associated protein amyloid β, which results in
the production of IL-1β (Halle et al., 2008). Members of the Toll like receptor (TLR) family are
also expressed by microglia (Carty and Bowie, 2011). There are 10 functional TLRs in humans
and 12 in mice. TLR activation induces inflammatory responses, which is characterized by, in
part, the secretion of proinflammatory cytokines and reactive oxygen species. TLR2 recognizes
cell wall products of Gram-positive bacteria, such as peptidoglycan (PGN) or lipoteichoic acid,
9
while the most important ligand of TLR4 is the lipopolysaccharide (LPS) of Gram-negative
bacteria (Akira and Takeda, 2004).
3.3. Cytokine production by microglia
Upon activation through PRRs, microglia produce a wide range of proinflammatory
cytokines. Stimulation of both TLR2 and TLR4 induces tumor necrosis factor (TNF)-α,
interleukin (IL)-6, IL-12 and IL-1β secretion (Halle et al., 2008; Kielian et al., 2002; Lehnardt et
al., 2002; Lehnardt et al., 2003; Lin et al., 2010; Liu et al., 2010; Olson and Miller, 2004). TNF-α
and IL-6 production is also induced by NOD2 stimulation (Chauhan et al., 2009), while NRLP3
activation results in IL-1β release (Halle et al., 2008).
IL-6 is considered as a proinflammatory cytokine, although it has become clear recently
that it also has anti-inflammatory effects in both the CNS and periphery. IL-6 is a major player in
neuroinflammation which accompanies or induces a wide range of brain disorders and
neurodegenerative disorders such as traumatic brain injury, infections, multiple sclerosis or AD
(Amor et al., 2010). It has been proposed that IL-6 can exert both neuroprotective and neurotoxic
effects, which depend on the concentrations of IL-6 that are present in the various inflammatory
situations. In lower concentrations, IL-6 produced by microglia or astrocytes increased the
viability of neurons (Li et al., 2007). In contrast, IL-6 at higher concentrations attenuated neural
survival in LPS-induced inflammation (Li et al., 2007; Li et al., 2009b). In traumatic brain injury,
IL-6 has been described to be beneficial since mice overexpressing IL-6 showed accelerated
healing while IL-6 deficient mice recovered slower than wild-type littermates after brain damage
(Penkowa et al., 2003; Swartz et al., 2001). IL-6 levels are elevated in stroke patients and IL-6
appears to contribute to both injury and repair processes after cerebral ischemia (Suzuki et al.,
2009).
A crucial role for IL-6 has been described in brain disorders featuring chronic
inflammation. A number of studies have shown that genetic IL-6 deficiency or treatment with
anti-IL-6 antibody is protective in experimental autoimmune encephalomyelitis (EAE), which is
an animal model multiple sclerosis, an inflammatory demyelinating disease of the CNS (Eugster
et al., 1998; Mendel et al., 1998; Serada et al., 2008). IL-6 has also been implicated in another
neurodegerative disorder, AD, as this condition is accompanied by elevated IL-6 expression in
the brain (Ershler and Keller, 2000; Tha et al., 2000; Ye and Johnson, 1999), and IL-6-
overexpressing mice display neurodegeneration and cognitive impairment (Heyser et al., 1997).
10
Similarly to IL-6, TNF-α has homeostatic physiological roles besides its proinflammatory
effects (Clark et al., 2010). TNF-α is present in the healthy, developing brain, and plays an
important role in reducing the excessive density of neurons, axons and neuronal connections that
are present in the prenatal brain to normal post-natal levels (Nikolaev et al., 2009; Yamasu et al.,
1989). However, TNF-α concentrations exceeding the normal physiological levels have been
described in various CNS disorders, including meningitis (Barichello et al., 2009; Moller et al.,
2005), cerebral malaria (John et al., 2008) and Parkinson’s disease (Mogi et al., 1994), where
they contribute to neurodegenaration. TNF-α also plays important roles in the pathophysiology of
brain trauma, as its concentrations are elevated in patients with brain injury (Hayakata et al.,
2004) and TNF-α inhibition has been found to be protective in this condition (Ates et al., 2007;
Shohami et al., 1997). TNF-α is also appreciated as a major player in the pathogenesis of AD, as
its levels are elevated in the brains of AD patients (Tarkowski et al., 2003) and it contributes to
neuronal death (Janelsins et al., 2008). In addition, the inhibition of TNF-α has been described to
be beneficial in mouse AD models providing further evidence for its key role in
neurodegeneration (McAlpine et al., 2009; Tweedie et al., 2007).
Since prolonged inflammatory responses in the brain contribute to the pathology of a
variety of brain disorders, and the regenerative ability of neural tissue is limited, the tight
regulation of inflammation in the CNS is crucial (Lehnardt, 2010). IL-10 was originally
described as a T helper 2 (TH2)-type cytokine that inhibits TH1 responses (Fiorentino et al.,
1989). However, it is now clear that IL-10 is a widely expressed anti-inflammatory cytokine that
is also produced by regulatory T cells and by various innate immune cell types, such as
microglia, macrophages, and dendritic cells (Saraiva and O'Garra, 2010). IL-10 influences
monocyte and macrophage functions by suppressing their inflammatory cytokine production,
antigen presentation and phagocytosis (Sabat et al., 2010). IL-10 is produced by microglia,
astrocytes and infiltrating T cells in the brain (Jander et al., 1998; Strle et al., 2001). IL-10 plays
neuroprotective roles in animal models of numerous CNS disorders, including multiple sclerosis
(Dai et al., 2012), traumatic brain injury (Knoblach and Faden, 1998), AD (Koronyo-Hamaoui et
al., 2009), and Parkinson’s disease (Arimoto et al., 2007). In particular, IL-10 exerts its
protective functions by influencing different cell types in the brain. First, IL-10 influences
neurons directly by protecting them from glutamate-, nitric oxide (NO)- or hypoxia-induced cell
death via blocking caspase-3 activity, enhancing the expression of the antiapoptotic proteins, Bcl-
2 and Bcl-xL, and by inhibiting the release of Ca2+
from internal stores to the cytosol (Bachis et
al., 2001; Silva et al., 2012; Turovskaya et al., 2012; Zhou et al., 2009). Secondly, IL-10 protects
11
brain endothelial cells from bacteremia-induced apoptosis (Londono et al., 2011). Thirdly, IL-10
exerts neuroprotective effects by inhibiting the inflammatory responses of the brain.
It has been shown that IL-10 inhibits TNF-α expression by microglia after brain injury,
the consequence of which is the inhibition of astrocyte reactivity (Balasingam and Yong, 1996).
IL-10 expressed by microglia also inhibits the expression of proinflammatory mediators and
neurodegeneration in LPS-injected rat cerebral cortex (Park et al., 2007). Finally, similar to the
results of in vivo experiments, IL-10 inhibits the LPS-induced release of proinflammatory
cytokines in microglial cell cultures (Heyen et al., 2000; Kremlev and Palmer, 2005).
In conclusion, the beneficial or detrimental outcome of neuroinflammation depends on
the balance of proinflammatory and anti-inflammatory cytokines in the CNS.
3.4. Alternative activation of macrophages
Macrophages can be activated not only by PAMPs but also by different cytokines. The
TH1 cytokine interferon (IFN)-γ, similar to PAMPs, induces a proinflammatory phenotype in
macrophages. This population is called classically activated or M1 macrophages. Classically
activated macrophages produce reactive nitrogen and oxygen species (NO, peroxynitrite,
hydrogen peroxide, superoxide) and proinflammatory cytokines, such as TNF- IL-6, and IL-12,
and they participate in the defense against microbial infections.
In contrast, alternative macrophage activation occurs in a TH2 cytokine environment,
arising for example during parasitic disease or wound healing, which imparts immunomodulatory
and anti-inflammatory rather than proinflammatory properties on macrophages. The term
“alternatively activated macrophage” is often more broadly used and includes various anti-
inflammatory macrophage phenotypes induced by various stimuli, including immune complexes,
IL-10, glucocorticoids, and apoptotic cells, which are collectively denoted M2 (Goerdt and
Orfanos, 1999; Gough et al., 2001). The most important TH2 cytokines that induce the
alternatively activated phenotype of macrophages are IL-4 and IL-13. IL-4 and IL-13 are
recognized by two types of cell surface receptors. Type I receptors, which are mostly expressed
on hematopoietic cells, recognize only IL-4 and are composed of IL-4Rα and common cytokine γ
chain. Type II receptors, which can be activated by both IL-4 and IL-13, are heterodimers of the
IL-4Rα and IL-13Rα1 chains, and are present also on non-hematopoietic cells (Gordon and
Martinez, 2010; Sica and Mantovani, 2012). The intracellular signaling pathways emanating
from these receptors are incompletely characterized and involve members of the Janus-activated
12
kinase (JAK) and signal transducer and activator of transcription (STAT) family, especially
STAT6 (Nelms et al., 1999), as well as a number of further transcription factors, which include
CCAAT enhancer binding protein (C/EBP (Stutz et al., 2003), peroxisome proliferator-
activated receptor γ (Szanto et al., 2010), interferon regulatory factor 4 (El Chartouni et al.,
2010), Krüppel-like factor 4 (Liao et al., 2011), and c-Myc (Pello et al., 2012).
IL-4 and IL-13 induce a unique, partly overlapping gene expression signature in
macrophages. One of the hallmark genes induced by IL-4 or IL-13 in macrophages is arginase-1
(Corraliza et al., 1995; Murray and Wynn, 2011a). Arginase-1 is an enzyme that hydrolyzes L-
arginine to L-ornithine and urea. L-ornithine is a precursor for the formation of proline, which is
an important constituent of collagen; therefore, arginase-1 is important for extracellular matrix
deposition and fibrosis (Albina et al., 1990). Arginase-1 in alternatively activated macrophages
thus contributes to wound healing by facilitating the deposition of extracellular matrix. Arginase-
1 also competes with inducible nitric oxide synthase (iNOS) for the common substrate L-arginine
and therefore, it is able to regulate IFN-γ-induced NO secretion (Munder, 2009; Munder et al.,
1998).
Alternatively activated macrophages upregulate a number of further genes that are
involved in extracellular matrix turnover, and these genes include tissue inhibitor of
metalloproteinase (TIMP)-1 and several matrix metalloproteinases. In addition to its effects on
extracellular matrix turnover, TIMP-1 has complex effects on cell growth and mutations in the
matrix metalloproteinases-inhibitory domain of TIMP-1 fail to abrogate the effects of TIMP-1 on
cell growth and survival (Moore and Crocker, 2012; Moore et al., 2011).
Macrophage galactose-type C-type lectin (mgl)-1 is a member of the family of C-type
lectin receptors and is expressed on immature dendritic cells and macrophages (van Vliet et al.,
2008). The mgl-1 binds glycoproteins expressed by helminthes but it is also able to recognize
tumor glycoproteins (Aarnoudse et al., 2006). Recent findings showing that mgl-1 expression on
macrophages is induced in vivo by parasitic infection and in vitro by IL-4/IL-13, implicated mgl-
1 as a marker of alternative activation (Raes et al., 2005).
Resistin-like molecule-α (RELM-α) belongs to a cysteine-rich secreted protein family and
it is secreted by macrophages in response to IL-4 or IL-13 (Raes et al., 2002a; Raes et al.,
2002b). RELM-α expression is elevated in lung inflammation induced by bleomycin (Liu et al.,
2004) or helminth infection (Nair et al., 2009) and it exerts negative regulatory effects on TH2-
type inflammation.
13
Additional proteins that are appreciated as markers of alternative activation are the
chitinase-like proteins Ym1 and Ym2 (Chang et al., 2001), which are upregulated in
macrophages and epithelial cells in response to IL-4 or the chitin of invading parasites (Gordon,
2003; Raes et al., 2002a).
3.5. Adenosine is an extracellular signaling molecule
Adenosine is a purine nucleoside, which is an essential component of intracellular
metabolic processes and is a precursor of both nucleic acid and adenosine 5’-triphosphate (ATP)
synthesis. Adenosine can be released into the extracellular space in response to both metabolic
disturbances and other types of insults, which include inflammation, physical damage, and
apoptosis (Hasko and Pacher, 2012). Drury and Szent-Györgyi discovered that extracellularly
released adenosine is a signaling molecule that regulates heart rate, coronary vascular tone, and
intestinal physiology (Drury, 1929). Since the discovery of the signaling role of adenosine, it has
become clear that extracellular adenosine has wide-ranging regulatory effects in all organs and
tissues (Hasko and Cronstein, 2004).
The release of adenosine can occur via two mechanisms: (a) via direct release through
cell membrane integral adenosine/nucleoside transporters and (b) as constituent of adenine
nucleotides, such as ATP and ADP, which can be externalized by a variety of mechanisms,
including membrane damage, through connexin/pannexin and other channels, and via protein or
hormone-transporting vesicles (Hasko and Pacher, 2012). Once ATP and ADP are released, the
phosphate groups of extracellular ATP and ADP are sequentially cleaved off, first by nucleoside
triphosphate diphosphorylases (NTPDases, including CD39) and then by 5’-ectonucleotidase
(Ecto5’Ntase, CD73) (Bours et al., 2006; Deaglio and Robson, 2011). In addition to host cells,
pathogens such as Staphylococcus aureus (Thammavongsa et al., 2009), enteropathogenic
Escherichia coli (Crane et al., 2002), and Trichomonas vaginalis (Tasca et al., 2003) are
equipped with ectonucleotidases, and excessive adenosine generation by these ectonucleotidases
contributes to the subversion of the host immune system and propagation of the pathogens
(Hasko and Pacher, 2012). Adenosine has a short half-life in the extracellular space because it is
either rapidly degraded extracellularly to inosine by adenosine deaminase or is rephosphorylated
to AMP by adenosine kinase following its reuptake into the cell (Bours et al., 2006).
14
3.6. Adenosine receptors (ARs)
The cellular effects of adenosine are mediated by ARs, which are members of the G
protein-coupled family of receptors. The four subtypes of ARs are the A1, A2A, A2B and A3AR
(Fredholm et al., 2001). The A1AR and A3AR are coupled to Gi proteins, which inhibit the
enzyme adenylyl cyclase thereby decreasing intracellular cyclic AMP (cAMP) concentrations.
However, they activate other intracellular signal transducers, such as protein kinase C,
phosphoinositide kinase (PI3K), Akt, and a member of the mitogen activated protein kinase
(MAPK) family, extracellular signal regulated kinase (ERK) 1/2 (also called p42/44) (Schulte
and Fredholm, 2003b). Additionally, A3AR is also able to signal through the phospholipase C
(PLC) pathway and intracellular Ca2+
via Gq proteins (Gessi et al., 2008). The A2AAR and
A2BAR couple to Gs proteins which activate adenylyl cyclase followed by the increase of
intracellular cAMP concentration (Fredholm et al., 2001). Increased cAMP levels activate the
protein kinase A (PKA) pathway and consequently the transcription factor cAMP responsive
element binding protein (CREB). cAMP signals also through exchange proteins directly activated
by cAMP (EPAC) (Breckler et al., 2011). Additionally, A2AAR has been described to activate G
protein-independent pathways, which involve G protein-coupled receptor kinases and β-arrestins
(Zezula and Freissmuth, 2008). The A2BAR can also couple to Gq, as well as other pathways such
as MAPKs and PI3K (Schulte and Fredholm, 2003b).
3.7. Immunomodulatory effects of adenosine
The concept of adenosine as an immunomodulatory signaling molecule was first
established with the discovery of the inhibitory effect of adenosine on superoxide generation by
neutrophils (Cronstein et al., 1983). It has become clear since then that adenosine influences a
wide range of immune functions of a variety of cell types, including mononuclear phagocytes,
lymphocytes, natural killer cells, and mast cells (Bours et al., 2006; Hasko et al., 2008).
Microglial functions regulated by ARs include proliferation, migration and secretion of
proinflammatory mediators and neurotrophic factors. In particular, adenosine can both inhibit
and induce proliferation in microglia depending on factors such as AR subtype expression, the
activation state of the microglia, and the environment. Adenosine also regulates the production of
proinflammatory mediators by microglia, and there are reports of both positive and negative
regulatory effects. The stimulation of microglial A2AARs has been shown to inhibit LPS-induced
secretion of TNF-α and IL-12 (van der Putten et al., 2009), but induces the expression of
15
cyclooxygenase-2 and the release of NO (Fiebich et al., 1996; Saura et al., 2005). Another study
identified the A3AR in mediating the inhibiting effect of adenosine on LPS-induced TNF-α
production (Lee et al., 2006). Thus, a substantial amount of data suggests that adenosine exerts
complex regulatory functions on microglia.
Adenosine also decreases the expression of proinflammatory cytokines, such TNF-α and
IL-12 by classically activated peripheral monocytes and macrophages (Hasko et al., 2000; Hasko
et al., 1996). The inhibitory effect of adenosine on TNF-α production is mediated primarily by
A2AARs (Buenestado et al., 2010; Kreckler et al., 2006; Ryzhov et al., 2008b; Zhang et al.,
2005); however, recently published data show that A2BARs can also contribute to the effect
(Belikoff et al., 2011; Chen et al., 2009). Adenosine also inhibits the LPS-induced production of
the chemokine, macrophage inflammatory protein-1α by macrophages, which occurs through the
A3AR (Szabo et al., 1998). LPS-induced NO production, IFN-γ-induced iNOS expression, and
the release of reactive oxygen species are negatively regulated by adenosine (Barnholt et al.,
2009; Hasko et al., 1996) through A3ARs (Broussas et al., 1999; Leonard et al., 1987; Thiele et
al., 2004). In addition to the inhibition of proinflammatory functions of macrophages, adenosine
augments the production of IL-10. The effect is mediated by A2AAR in peritoneal macrophages
activated by heat killed bacteria (Csoka et al., 2007) and by A2BAR in RAW 264.7 macrophages
activated with LPS (Nemeth et al., 2005). Adenosine has also been shown to be involved in the
regulation of angiogenesis by macrophages (Adair, 2005). Particularly, A2AAR stimulation in
macrophages augments the production of vascular endothelial growth factor (VEGF) which is an
important component of angiogenesis and wound healing (Ernens et al., 2010; Leibovich et al.,
2002; Pinhal-Enfield et al., 2003).
Thus, adenosine regulates virtually all important functions of mononuclear phagocytes
which makes the ARs possible targets for the therapy of various pathological conditions affecting
the immune system (Hasko et al., 2008).
3.8. Aims of the study
The last 2 to 3 decades have seen a dramatic increase in our understanding of the role of
ARs in regulating the function of mononuclear phagocytes. However, several gaps remained. For
example, while the role of ARs in regulating proinflammatory cytokine production by microglia
had been addressed prior to our studies, the effect of adenosine on IL-10 production by microglia
had not been studied. In addition, prior to our studies, the effect of adenosine had only been
studied in conjunction with classically activated macrophages and the role of adenosine in
16
regulating alternative macrophage activation had not been explored. To begin to fill these gaps,
we sought to address the following aims:
1. Determine the effect of adenosine on IL-10 production by microglia activated with TLR
ligands. Compare the effect of adenosine on IL-10 production with its effect on IL-6, IL-12
and TNF-α production.
2. Identify the AR subtype mediating the effect of adenosine on IL-10 production by
microglia
3. Examine the intracellular signaling pathways that mediate the effect of adenosine on IL-
10 production by microglia
4. Delineate the effect of adenosine on IL-4 or IL-13-induced alternative macrophage
activation
5. Elucidate the AR subtypes responsible for the effect of adenosine on alternative
macrophage activation
6. Determine the intracellular signaling pathways that mediate the effect of adenosine on
alternative macrophage activation
17
4. Materials and methods
4.1. Drugs and reagents
Adenosine, the selective A1AR agonist 2-chloro-N6-cyclopentyladenosine (CCPA), A2AAR
agonist 4-[2-[[6-amino-9-(N-ethyl-β-D-ribofuranuronamidosyl)-9H-purin-2-yl]amino]ethyl]
benzenepropanoic acid (CGS21680), A3AR agonists 1-deoxy-1-[6-[[(3-
iodophenyl)methyl]amino]-9H-purin-9-yl]-N-methyl-β-D-ribofuranuronamide (IB-MECA) and
1-[2-Chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-
ribofuranuronamide (Cl-IB-MECA), nonselective AR agonist 1-(6-Amino-9H-purin-9-yl)-1-
deoxy-N-ethyl-β-D-ribofuranuronamide (NECA), the selective A1AR antagonist 8-cyclopentyl-
1,3-dipropylxanthine (DPCPX), A2AAR antagonist 4-(2-[7-amino-2-(2-furyl)[1.2.4]triazolo[2.3-
a][1.3.5]-triazin-5-ylamino] ethyl) phenol (ZM241385), A2BAR antagonist N-(4-cyanophenyl)-2-
[4-(2,3,6,7-tetrahydro-2,6-dioxo-1,3-dipropyl-1H-purin-8-yl)phenoxy]-acetamide (MRS1754),
A2BAR antagonist 8-[4-[4-(4-chlorobenzyl)piperazide-1-sulfonyl)phenyl]]-1-propylxanthine
(PSB0778), A3AR antagonist 3-propyl-6-ethyl-5-[(ethylthio) carbonyl]-2 phenyl-4-propyl-3-
pyridine carboxylate (MRS1523), β-adrenoceptor agonist isoproterenol, and prostaglandin E2
(PGE2) were purchased from Tocris Cookson (Ellisville, MO). The p38 MAPK pathway inhibitor
SB203580 and p42/44 MAPK pathway inhibitor PD98059 were purchased from Calbiochem
(San Diego, CA). The c-Jun N-terminal kinase (JNK) inhibitor anthra[1-9-cd]pyrazol-6(2H)-one
(SP600125), the PKA inhibitor N-[2-[[3-(4-bromophenyl)-2-propenyl]amino]ethyl]-5-
isoquinolinesulfonamide dihydrochloride (H89), PI3K inhibitor 2-(4-morpholinyl)-8-phenyl-4H-
1-benzopyran-4-one hydrochloride (LY294002) and PLC inhibitor 1-[6-[[(17β)-3-methoxyestra-
1,3,5(10)-trien-17-yl]amino]hexyl]-1H-pyrrole-2,5-dione (U73122) were purchased from Tocris.
PGN and LPS were purchased from Sigma-Aldrich (St. Louis, MO). Stock solutions of the
various agonists and protein kinase inhibitors were prepared using dimethylsulphoxide. Murine
recombinant IL-4 and IL-13 were from PeproTech (Rocky Hill, NJ, USA). Stock solutions of
recombinant cytokines were prepared using sterile water.
18
4.2. Experimental animals
Male C57BL/6 mice and male TLR4 KO (C57BL/10ScNJ) and WT (C57BL/10ScSnJ)
mice were purchased from Charles River Laboratories (Isaszeg, Hungary) or from the Jackson
Laboratory (Bar Harbor, ME, USA). All mice were maintained in accordance with the
recommendations of the "Guide for the Care and Use of Laboratory Animals", and the
experiments were approved by the Animal Care Committee of the Hungarian Academy of
Sciences and New Jersey Medical School Animal Care Committee. A2B receptor KO mice on the
C57BL/6J genetic background were acquired from Deltagen (San Mateo, CA, USA) and were
bred as described previously (Csoka et al., 2010; Csoka et al., 2007). A2A receptor KO mice on
the C57BL/6J genetic background were kindly provided by Dr. Joel Linden (La Jolla Institute for
Allergy and Immunology, La Jolla, CA, USA).
4.3. Cell cultures
BV-2 is a murine microglial cell line immortalized by retroviral transduction with v-raf/v-
myc genes (Blasi et al., 1990). BV-2 cells were grown in Dulbecco’s Modified Eagle Medium
(DMEM) (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) (Sigma-
Aldrich), 50 U/mL penicillin, and 50 g/mL streptomycin (Invitrogen) in a humidified atmosphere
of 95% air and 5% CO2. C/EBP-deficient and control immortalized macrophages (kind gifts
from Dr. Jorge A. Albina, Rhode Island Hospital and Brown Medical School, Providence, RI,
USA) (Albina et al., 2005; Gorgoni et al., 2002) and RAW 264.7 macrophages (ATCC,
Manassas, VA, USA) were grown in DMEM supplemented with 10% FBS, 50 U/ml penicillin,
50 µg/ml streptomycin, and 1.5 mg/ml sodium bicarbonate in a humidified atmosphere of 95%
air and 5% CO2.
Primary microglia were obtained from 1- to 3-day-old C57BL/6J mice. Cerebral cortices
were dissected, carefully stripped of their meninges, and digested with 0.05% trypsin (Sigma-
Aldrich) and 0.6 mg/ml DNase (Sigma-Aldrich) dissolved in 2 ml of phosphate buffered saline
(PBS) for 10 min. Trypsinization was stopped by adding an equal volume of DMEM. The cells
were then placed in cell culture flasks previously treated with poly-lysine (Sigma-Aldrich) and
after an overnight incubation, non-adherent cells were removed by washing with culture medium.
The remaining adherent mixed astrocyte-microglia culture was then incubated at 37°C in a
humidified atmosphere of 95% air and 5% CO2, and the medium replaced every 3 d until the
19
cells reached confluence (14-16 d). Confluent cultures were trypsinized and microglia were
separated using CD11b MicroBeads from Miltenyi Biotec (Auburn, CA).
To obtain peritoneal macrophages, mice were injected intraperitoneally with 3 ml of
sterile thioglycollate (TG) broth (4% w/v). After 4 d, the mice were sacrificed and peritoneal
exudate cells were harvested using 10 ml of DMEM. Cells were centrifuged at 300 x g for 10
min at 4°C, washed twice with DMEM, and re-suspended in DMEM containing 10 % FBS, 50
U/ml penicillin, 50 g/ml streptomycin, and 1.5 mg/ml sodium bicarbonate. Cells were seeded
into tissue culture plates and incubated at 37°C in a humidified incubator for 5 h, to allow the
cells to adhere. Non-adherent cells were then removed by washing with serum-free DMEM, and
the cells were re-fed with DMEM containing 10 % FBS. After 18 h of incubation, various test
compounds were added to the macrophages.
4.4. Enzyme-linked immunosorbent assay (ELISA) for determining cytokine production
BV-2 cells, primary microglial cells, RAW 264.7 macrophages or peritoneal
macrophages were placed in the wells of 96-well plates (105 cells/well). After an overnight
incubation, supernatants were replaced with serum-free cell culture medium and the cells were
incubated for 2 h. The cells were then treated with adenosine or various AR agonists, PGN, LPS,
IL-4 or IL-13 for 2, 4, 8, 12 or 24 hours after which periods the supernatants were frozen and
stored. AR antagonists or protein kinase inhibitors were administered 30 min prior to treatment
with adenosine or NECA. IL-10, TNF-α, IL-6, IL-12 and TIMP-1 levels in cell culture
supernatants were determined using ELISA Duoset kits (R&D Systems, Minneapolis, MN).
4.5. RNA extraction, cDNA synthesis, and real-time polymerase chain reaction (PCR)
Total RNA was prepared from peritoneal macrophages, BV-2 or RAW 264.7 cells using
Trizol reagent according to the manufacturer’s protocol (Invitrogen) or from primary microglia
using RNeasy Mini Kit according the manufacturer’s protocol (Qiagen, Valencia, Ca), and
reverse-transcribed using High Capacity cDNA Reverse Transcription kit (Applied Biosystems,
Foster City, CA). For detection of IL-10, AR, arginase-1, TIMP-1, and mgl-1 mRNA, a real-time
PCR commercial kit (Applied Biosystems) was used, and all data were normalized to constitutive
rRNA values (18S). The primers used are listed in Table 1. The Applied Biosystems 7700
20
sequence detector was used for amplification of cDNA, and quantitation of differences between
treatment groups was performed using the comparative threshold cycle (CT) method.
4.6. Transient transfection of BV-2 cells with IL-10 promoter-luciferase and pCRE
luciferase constructs and luciferase assay
BV-2 cells were transiently transfected using Polyfect transfection reagent (Qiagen). For
transfection, cells were plated at 2.5 x 105 per ml density overnight, and at plating, each well of a
24-well plate contained 0.5 ml of cell suspension. The following day, the cells were transfected
with 0.4 μg per well of IL-10 reporter plasmids (kind gifts from Stephen T. Smale, University of
California, Los Angeles, School of Medicine, Los Angeles, CA) and CREB reporter plasmid
(pCRE) (Stratagene, La Jolla, CA). All transfections were performed at 37°C overnight, after
which procedure the cells were washed with DMEM and treated with 10 μM NECA and/or 20
μg/ml PGN for 8 h. For reporter assays, whole-cell extracts were prepared using 80 μl of 1x
Table 1: Oligonucleotide sequences for real-time PCR
A1AR: forward: 5’-GTGATTTGGGCTGTGAAGGT-3’
reverse: 5’-CAAGGGAGAGAATCCAGCAG-3’
A2AAR: forward: 5’-AGCAGTTGATGATGTGCAGG-3’
reverse: 5’-CACGCAGAGTTCCATCTTCA-3’
A2BAR: forward: 5’-TGGCGCTGGAGCTGGTTA-3’
reverse: 5’-GCAAAGGGGATGGCGAAG-3’
A3AR: forward: 5’-GACTGGCTTCAGAGAGACGC-3’
reverse: 5’-AGGGTTCATCATGGAGTTCG-3’
IL-10: forward: 5’-AAGGAGTTGTTTCCGTTA-3’
reverse: 5’-AAGGGTTACTTGGGTTGC-3’
arginase-1: forward: 5’-CAGAAGAATGGAAGAGTCAG-3’
reverse: 5’ CAGATATGCAGGGAGTCACC-3’
TIMP-1: forward: 5’- TCCTCTTGTTGCTATCACTGATAGCTT-3’
reverse: 5’- CGCTGGTATAAGGTGGTCTCGTT-3’
mgl-1: forward:5’ - CCTCCAGAACTCAAGGATGC - 3’
reverse: 5’- GATCCAATCACGGAGACGAC - 3’
18S: forward: 5’-GTAACCCGTTGAACCCCATT-3’
reverse: 5’-CCATCCAATCGGTAGTAGCG-3’
21
passive lysis buffer from each well (Promega, Madison, WI). Luciferase activity was determined
using 20 μl of cell extract with Dual-Luciferase Reporter Assay System (Promega).
4.7. Transient transfection of RAW 264.7 cells with arginase-1 promoter-luciferase
construct, C/EBP luciferase construct, and luciferase assay
RAW 264.7 cells were transiently transfected using FUGENE 6.0 transfection reagent
(Roche, Indianapolis, IN, USA). For transfection, 5 x 105 per ml cells were seeded in a 24-well
plate. The next day, the cells were transfected with a mixture of arginase-1 or C/EBP reporter
plasmid (Stratagene, Santa Clara, CA, USA) and FUGENE reagent, where the final concentration
of the plasmids was 2 μg per ml and that of FUGENE was 10 μl per ml. The arginase-1 luciferase
reporter construct was created by cloning -3810/-31 (relative to the transcription start site)
promoter fragment into the pGL3-basic vector (Promega, Madison, WI, USA) (Pauleau et al.,
2004). All transfections were performed at 37°C overnight, and the following day the cells were
washed with medium and treated with IL-4 and adenosine for 4 or 8 h. For reporter assays,
whole-cell extracts were prepared using 80 µl of 1x passive lysis buffer (Promega, Madison, WI,
USA). Luciferase activity was determined using 20 µl of cell extract.
4.8. Whole cell protein isolation and Western blotting
Peritoneal macrophages, BV-2 cells or RAW 264.7 cells placed in wells of 6-well plates
were treated with adenosine or NECA and/or PGN or IL-4. Cells were washed with PBS and
pelleted at 800 x g for 5 min at 4°C. The pellet was resuspended in radioimmunprecipitation
assay lysis buffer (0.05 M TRIS-HCl pH 6.8, 0.25% Na-deoxycholate, 0.15 M NaCl, 1 mM
EDTA pH 7.4, 1 mM Na3VO4, 1 mM NaF, 1% NP-40, 1 mM PMSF, 100x diluted Proteinase
inhibitor cocktail mix) and incubated on ice for 15 min. The lysates were centrifuged at 15,000 x
g for 15 min at 4°C, and the supernatant was recovered. Protein concentrations were determined
using Bio-Rad protein assay (Bio-Rad, Hercules, CA). Whole cell lysates containing 30 g of
protein were separated on a 10% Tris-glycine gel (Invitrogen). After electrophoresis, the gel was
electroblotted in 1X Transfer buffer (Invitrogen) containing 20% methanol onto a nitrocellulose
membrane (Invitrogen). The membranes were probed with monoclonal rabbit anti-mouse
primary antibodies raised against p38, phospho-p38, p42/44, phospho-p42/44, phospho-JNK,
Akt, phospho-Akt, CREB, phospho-janus kinase (JAK) 1 and 3, phospho-Shc (Cell Signaling
22
Technology, Danvers, MA), arginase-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or
phospho-STAT-6 (Abcam, Cambridge, MA, USA). Thereafter, the membranes were incubated
with a secondary horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibody (Santa Cruz
Biotechnology, Santa Cruz, CA). HRP-conjugated polyclonal goat anti--actin antibody to assess
equal loading was used from Santa Cruz Biotechnology. Bands were detected using
Chemiluminescent HRP Detection Reagent (Denville Scientific, South Plainfield, NJ). X-ray
films were exposed for 1-15 min.
4.9. Silencing CREB using lentivirally-delivered shRNA
BV-2 or RAW 264.7 cells, placed in 12-well plates (5 X 104 cells/well), were transduced
with Mission Lentiviral particles containing CREB-specific shRNA or non-targeting shRNA
(Sigma-Aldrich) in the presence of 8 μg/ml hexadimethrine bromide. The sequences of the
shRNA oligos are shown in Table 2. The multiplicity of infection was 4 for each transduction.
After overnight incubation, the supernatants were replaced with complete cell culture medium
and the cells were incubated for a further 48 h. Then, to select the transduced cells, 2 μg/ml
puromycin was added to the cultures. The cells were cultured in the presence of puromycin for an
additional 48 h. The surviving cells considered as stable shRNA expressing cell lines were
transferred to a cell culture flask and cultured in the presence of puromycin as described above.
The efficiency of silencing was tested by Western blotting using CREB specific monoclonal
antibodies from Cell Signaling.
Table 2: shRNA sequences for CREB down-regulation
#32 ( Region: coding sequence):
5’-CCGGAGCAAGAGAATGTCGTAGAAACTCGAGTTTCTACGACATTCTCTTGCTTTTTTG-3’
#33 ( Region: coding sequence):
5’-CCGGACTGATGGACAGCAGATTCTACTCGAGTAGAATCTGCTGTCCATCAGTTTTTTG-3’
Non-targeting sequence:
5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT-3’
23
4.10. Chromatin immunoprecipitation (ChIP)
ChIP was performed using a ChIP assay kit from Millipore (Billerica, MA) according to
the manufacturer’s protocol. Phospho-CREB-specific monoclonal antibody and normal
immunoglobulin G (IgG) antibody provided with the kit for control were used. PCR reaction was
performed using DNA purified from ChIP samples using primers specific for the region between
-376 and -158 relative to the transcription start site of the of IL-10 gene. Primers were designed
by using Primer3 software and synthesized by the Molecular Research Facility of UMDNJ. The
sequences of the primers used were: AGCCCATTTATCCACGTCAT – pIL10 forward;
TTGTATTTCCTGAGGCAGACAG – pIL10 reverse. The PCR was performed using Taq PCR
Polymerase kit from Qiagen.
4.11. Determination of arginase activity from macrophage cell extracts
RAW 264.7 cells, murine peritoneal macrophages or C/EBP-deficient and control
immortalized macrophages in 96-well plates (2 x 106 per ml) were treated with PSB0778 or
SB203580 and then either with adenosine or various AR agonists followed by the addition of IL-
4 or IL-13. At the end of the incubation period, cell extracts were prepared from 2 x 105 cells in
50 l of 10 mM Tris-HCl (pH 7.4) containing 0.4% Triton X-100. After centrifugation at 2,500 x
g for 30 min, arginase activity in the supernatants of cell extracts was determined using a
commercially available arginase assay kit (QuantiChromTM
Arginase assay Kit; Bioassay
Systems, Hayward, CA, USA). The measured arginase activity was normalized to 2 x 105 cells.
4.12. Statistical analysis
Values in the figures are expressed as mean plus or minus the standard error of the mean
(SEM) of the indicated number of observations. Statistical analyses of the data were performed
using Student t test or one-way analysis of variance followed by Dunnett’s test, as appropriate.
24
5. Results
5.1. Adenosine augments IL-10 and inhibits IL-6, TNF-α and IL-12 production by
activated microglia
To examine the effect of adenosine on pro- and anti-inflammatory cytokine production by
activated microglial cells, we first treated primary microglia with adenosine and PGN. We then
determined IL-10, IL-6, and TNF-α concentrations in the supernatants after 24 h of treatment.
The results show that PGN enhanced dramatically IL-10, IL-6 and TNF-α production by primary
microglia (Figure 1). Adenosine treatment augmented the PGN-induced secretion of IL-10
(Figure 1A) and inhibited the PGN-induced secretion of IL-6 and TNF-α (Figure 1B and C).
Next, we investigated the effect of adenosine on cytokine production by BV-2 cells
stimulated with PGN or LPS. The combination of adenosine and PGN synergistically induced IL-
10 production, while neither adenosine nor PGN alone was able to elicit IL-10 release by BV-2
cells (Figure 2A). We found that adenosine synergistically induced IL-10 production in LPS-
activated BV-2 cells, as well (Figure 2A). PGN or LPS induced IL-6 (Figure 2B and C), TNF-
Figure 2D), and IL-12 (Figure 2E) production by BV-2 cells. Adenosine inhibited the PGN- or
LPS-induced production of all three cytokines (Figures 2B-E).
Figure 1: Adenosine augments IL-10 and inhibits IL-6 and TNF-α production by PGN-treated
microglia. Cells were treated with 100 μM adenosine immediately followed by treatment with 20
μg/ml PGN for 24 h. Cytokine concentrations were determined from supernatants using ELISA.
Data are shown as mean ± SEM; ***p<0.001 vs. no PGN, ###p<0.001 vs. PGN.
25
5.2. The effect of adenosine on IL-10 production by BV-2 cells is A2BAR-dependent
To determine which AR is responsible for the IL-10-increasing effect of adenosine, we
first treated BV-2 cells with increasing concentration of various AR agonists immediately
followed by treatment with PGN or LPS for 24 hours. Our results showed that NECA was the
most potent IL-10 enhancer in BV-2 cells (Figure 3). These results suggest the primary role of
A2BAR in mediating the IL-10 enhancing effect of adenosine, because if NECA is the most
potent agonist in a system, it indicates a predominant role for A2B receptors (Feoktistov and
Biaggioni, 1993; Feoktistov and Biaggioni, 1998).
Figure 2: Adenosine augments IL-10 and inhibits IL-6, TNF-α and IL-12 production by BV-2
cells. Cells were treated with 100 μM adenosine immediately followed by treatment with 20 μg/ml
PGN or 10 μg/ml LPS for 24 h. Cytokine concentrations were determined from supernatants using
ELISA. Results are representative of 3 independent experiments. Data are shown as mean ± SEM
(n=4); ***p<0.001 vs. LPS, ###p<0.001 vs. PGN.
26
In the next step, we tested which antagonist could reverse the increasing effect of NECA.
We found that MRS1754 inhibited the stimulatory effect of NECA on IL-10 production by PGN-
(Figure 4A) or LPS-treated (Figure 4B) cells. However, DPCPX, ZM241385, and MRS1523
failed to reverse the effect of NECA. Thus, these data confirm that adenosine augments IL-10
production by PGN or LPS-treated BV-2 cells through an A2BAR-mediated process.
Figure 3. NECA is the most potent AR agonist in enhancing IL-10 production by PGN- or
LPS-treated BV-2 cells. Cells were treated with increasing concentrations of CCPA, CGS21680,
NECA or IB-MECA followed by treatment with 20 μg/ml PGN (A) or 10 μg/ml LPS (B) for 24 h.
IL-10 concentrations were determined from supernatants using ELISA. Results are representative of
3 independent experiments. Data are mean ± SEM (n=4); *p<0.05 vs. PGN, **p<0.01 vs. PGN,
***p<0.001 vs. PGN (A) or LPS (B).
Figure 4. The A2BAR antagonist MRS1754 inhibits IL-10 production by NECA and PGN or
LPS-treated cells. BV-2 cells were treated with various AR antagonists 30 min before treatment
with 10 μM NECA and 20 μg/ml PGN (A) or 10 μg/ml LPS (B). IL-10 concentrations were
determined from supernatants using ELISA. Results are representative of 3 independent
experiments. Data are shown as % of NECA+PGN (A) or NECA+LPS treatment (B) (mean ± SEM;
n=4); ***p<0.001 vs. vehicle (NECA+PGN (A) or LPS (B)).
27
We next studied the level of expression of AR mRNA in unstimulated BV-2 cells and
primary microglia using real-time PCR. We found that the levels of A2BAR and A3AR were
highest in BV-2 cells, whereas low levels of A1AR and A2AAR were detected (Figure 5A). In
primary microglia, the A2BAR was the dominantly expressed receptor, and lower levels of A1AR,
A3AR, and A2AAR were detected (Figure 5B). We then investigated the effect of PGN and LPS
on AR mRNA expression. In BV-2 cells, LPS augmented the mRNA level of all ARs with the
exception of the A3AR. In contrast, PGN augmented A2BAR mRNA levels and decreased the
levels of the A3AR (Figure 5A). In primary microglia, both PGN and LPS treatment increased
the level of A2BAR mRNA (Figure 5B).
5.3. AR activation augments IL-10 mRNA accumulation in a CREB-dependent manner
To determine whether the stimulatory effect of AR activation on IL-10 production is
transcriptional, we measured IL-10 mRNA levels following treatment with NECA and/or PGN.
Our results showed that NECA augmented IL-10 mRNA levels in BV-2 cells exposed to PGN
(Figure 6). This effect was completely abolished in cells pre-treated with the transcription
inhibitor actinomycin D (Figure 6). These data suggest that NECA and PGN augment IL-10
production by a transcriptional mechanism.
Figure 5. Expression of AR mRNA in microglia. BV-2 cells (A) or primary microglia (B) were
treated with 20 μg/ml PGN or 10 μg/ml LPS for 4 h and then RNA was isolated from the cells. AR
mRNA levels were determined using real-time PCR with primers specific for the particular ARs.
Results were normalized to 18S mRNA levels and are representative of 3 independent experiments.
Data are shown as mean ± SEM (n=4); ***p<0.001 vs. A1 vehicle. &&p<0.01 vs. A2A vehicle,
###p<0.001 vs. A2B vehicle, $$p<0.01 vs. A3 vehicle.
28
To further characterize the mechanism by which NECA increased IL-10 mRNA
expression, we assessed the effect of NECA on IL-10 promoter activity using luciferase reporter
plasmids in which luciferase expression was driven by the IL-10 promoter. In addition, we used
promoter mutants, which contained successive deletions from the 5’ end of the IL-10 promoter
(Brightbill et al., 2000). BV-2 cells transfected with the reporter plasmids were then treated with
NECA and/or PGN and promoter activity was indicated by luciferase activity in cell lysates.
NECA augmented luciferase activity in cells transfected with the full promoter (-1538/+64
relative to the transcription start site), which indicated that NECA increases IL-10 transcription
by upregulating IL-10 promoter activity. Next, we attempted to pinpoint the cis-regulatory region
of the IL-10 promoter that mediated the effect of NECA. We found that NECA augmented
luciferase activity in cells transfected with mutant promoter constructs containing deletions
between -1538 and -376 bp relative to the transcription start site (Figure 7A); however, NECA
failed to augment luciferase activity in cells transfected with constructs with deletions between -
346 and -78 bp (Figure 7A). Using the Searching Transcription Factor Binding Sites tool
(http://www.cbrc.jp/research/db/TFSEARCH.html), we found binding site for the transcription
factor CREB in this region (Figure 7B). We then transfected cells with a CREB-reporter
construct in which luciferase activity was driven by tandem CREB-binding sequences (pCRE).
NECA augmented luciferase activity in cells transfected with pCRE but failed to do so in cells
Figure 6. NECA augments IL-10 mRNA levels in PGN-treated cells. BV-2 cells were treated
with 5 μg/ml actinomycin D or its vehicle 2 hours before treating with 10 μM NECA and/or 20
μg/ml PGN for a further 6 h. Total RNA was isolated from the cells and reverse transcribed to
cDNA. IL-10 mRNA levels were determined by real-time PCR using primers specific for IL-10.
Results were normalized to 18S mRNA levels and are shown as fold increase relative to untreated
samples. Data are shown as mean ± SEM (n=4); ***p<0.001 vs. PGN, ###p<0.001 vs. NECA+PGN.
29
transfected with a control plasmid (Figure 7C) indicating that NECA can upregulate CREB-
dependent transcription.
We next used ChIP assay to further analyze the role of CREB in mediating the
stimulatory effect of NECA on IL-10 production. Immunoprecipitation with antibodies against
phosphorylated CREB followed by PCR with primers specific for the region between -376 and -
158 of the IL-10 promoter showed that CREB phosphorylation occurs at this site after combined
treatment with NECA and PGN (Figure 8A).
Figure 7. NECA augments IL-10 promoter activity. (A) BV-2 cells were transfected with IL-10
promoter-luciferase constructs containing successive deletions. Transfected cells were treated with
10 μM NECA and 20 μg/ml PGN for 8 h and luciferase activity was determined from the cell
lysates. (B) Representation of the sequence of the region between -376 and -158 bp relative to the
transcription start site of the IL-10 gene, which contains a CREB-binding site. (C) Cells were
transfected with a reporter plasmid in which luciferase activity is driven by CREB-binding sites
(pCRE) or control vector (pCIS). Transfected cells were treated with 10 μM NECA and/or 20 μg/ml
PGN for 8 h and luciferase activity was determined from cell lysates. Luciferase values were
normalized to protein concentration. Results are representative of 3 independent experiments. Data
are mean ± SEM (n=4); *p<0.05, **p<0.01 vs. vehicle+PGN.
30
We then used a gene silencing approach to determine whether CREB was required for the
stimulatory effect of NECA on IL-10 production. We transduced BV-2 cells with lentiviral
particles containing non-targeting shRNA or shRNA specific for CREB. Transducing the cells
with CREB-specific shRNA resulted in a strong downregulation of CREB expression, as
confirmed using Western blotting (Figure 8B). Then, we treated non-targeting or CREB-specific
shRNA-expressing BV-2 cells with NECA and/or PGN and determined IL-10 production. The
results showed that the stimulatory effect of NECA on PGN-induced IL-10 production was
dramatically diminished in cells expressing CREB-specific shRNA as compared to cells
Figure 8. The stimulatory effect of NECA on IL-10 production is CREB-dependent. (A) BV-2
cells were treated with 10 μM NECA and/or 20 μg/ml PGN for 30 min and ChIP assay was performed
on cell extracts using phospho-CREB–specific and control Abs. PCR reaction was then performed
using the DNA purified from ChIP samples using primers specific for the IL-10 promoter. PCR
products were separated on a 3% agarose gel stained with ethidium bromide and visualized under UV
light. (B) BV-2 cells were transduced with lentiviral vectors containing CREB-specific or
nontargeting (NT) shRNA. Protein was then isolated from transduced and untransduced BV-2 cells,
and CREB expression was tested by Western blotting using Abs specific for CREB or for actin as
loading control. (C) BV-2 cells transduced with NT or CREB-specific shRNA were treated with 10
μM NECA and 20 μg/ml PGN and incubated for 24 h. IL-10 concentrations were determined from the
supernatants that were taken at the end of the incubation period using ELISA. Data are expressed as
percent of vehicle (treated with vehicle for NECA+PGN). ***p<0.001 vs. vehicle+PGN, ###p<0.001
vs. NECA+PGN/NT shRNA-transfected group. (D) BV-2 cells were treated with 0.1 μM
isoproterenol or PGE2 and 20 μg/ml PGN for 24 h, and IL-10 concentrations were determined from
the supernatants. Results (mean ± SEM) shown are representative of 3 separate experiments (n = 4 in
each experiment). ###p< 0.001 vs. PGN.
31
expressing non-targeting shRNA (Figure 8C). In addition, other known cAMP-CREB-inducing
agents, such as the β-adrenoceptor agonist isoproterenol or PGE2, also augmented IL-10
production by PGN-treated BV-2 cells providing further evidence for the role of CREB in
contributing to IL-10 production by microglia (Figure 8D).
Next, we continued to characterize the signaling pathways contributing to the stimulatory
effect of NECA on PGN-induced IL-10 production. First, we explored the role of MAPKs.
Using Western detection of the phosphorylated, active forms of MAPKs p38, p42/44 and
JNK, we found that PGN induced the activation of p38 (Figure 9A), p42/44 and JNK (Figure
10A, C). In addition, NECA augmented the PGN-induced activation of p38 (Figure 9A), but it
failed to increase the activation of p42/44 (Figure 10A) and JNK (Figure 10C). In addition,
treatment with the p38 inhibitor SB203580 reversed, in a dose-dependent manner, the NECA
augmentation of IL-10 production (Figure 9B). However, the p42/44 inhibitor PD98059 (Figure
10B), and the JNK inhibitor Sp600125 failed to block the effect of NECA (Figure 10D).
Figure 9. The stimulatory effect of NECA on IL-10 is p38-dependent. (A) BV-2 cells were
treated with 10 μM NECA and 20 μg/ml PGN and 15 min later protein was isolated from the cells.
Western blotting was performed using antibodies specific for p38 and phospho-p38. (B) BV-2 cells
were pretreated with increasing concentrations of SB203580 30 min prior to treatment with 10 μM
NECA and 20 μg/ml PGN for 24 h. IL-10 concentrations were determined from supernatants using
ELISA. Data are shown as percentage of group treated with vehicle for inhibitor, NECA and PGN.
***p<0.001 vs. vehicle. Results (mean ± SEM) are representative of 3 independent experiments
(n=4/experiment).
32
Finally, we explored the role of the PI3K/Akt pathway. We found that NECA and PGN
together induced the phosphorylation/activation of Akt (Figure 11A) and preventing PI3K/Akt
activation with LY294002 reversed the stimulatory effect of NECA and PGN on IL-10
production (Figure 11B).
Figure 10. p42/44 and JNK do not contribute to the augmenting effect of NECA on PGN-induced
IL-10 production. BV-2 cells were treated with 10 μM NECA and 20 μg/ml PGN for 15 min, and then
protein was extracted from the cells. Western blotting was performed using antibodies specific for
p42/44 and phospho–p42/44 (A) and phospho-JNK or actin (C). BV-2 cells were pretreated with
increasing concentrations of PD98059 (B) or SP600125 (C) 30 min prior to treatment with 10 μM
NECA and 20 μg/ml PGN for 24 h. IL-10 concentrations were determined from supernatants using
ELISA. Data are shown as percentage of group treated with vehicle for inhibitor, NECA and PGN.
***p<0.001 vs. vehicle. Results (mean ± SEM) are representative of 3 independent experiments
(n=4/experiment).
33
In conclusion, A2BAR stimulation augments IL-10 production by TLR-activated
microglia through a CREB-mediated transcriptional mechanism, which is dependent on the p38
and PI3K/Akt pathways.
5.4. Adenosine augments IL-4- and IL-13-induced alternative macrophage activation by a
TLR4-independent mechanism
We next studied whether adenosine signaling plays a regulatory role in alternatively
activated macrophages. To begin to examine the effect of adenosine on alternative macrophage
activation, RAW 264.7 macrophages were treated with adenosine immediately prior to treatment
with IL-4. Figure 12 shows that adenosine augmented arginase activity (Figure 12A) as well as
mRNA and protein levels of arginase-1 (Figure 12B and C) in IL-4-treated macrophages, but not
in control cells.
Figure 11. The effect of NECA/PGN is PI3K/Akt dependent. (A) BV-2 cells were treated with 10
μM NECA and 20 μg/ml PGN and 15 min later protein was isolated from the cells. Western blotting
was then performed using antibodies specific for Akt and phospho-Akt. (B) BV-2 cells were pre-
treated with LY294002 30 min prior to treatment with 10 μM NECA and 20 μg/ml PGN for 24 h.
IL-10 concentrations were determined from supernatants using ELISA. Data are shown as
percentage of group treated with vehicle for inhibitor, NECA and PGN. ***p<0.001 vs. vehicle.
Results (mean ± SEM) are representative of 3 independent experiments (n=4/experiment).
34
To explore the effect of adenosine on alternatively activated primary macrophages, TG-
elicited peritoneal macrophages from C57BL/6J mice were treated with adenosine and IL-4.
Similar to RAW 264.7 macrophages, adenosine increased both IL-4-induced arginase activity
(Figure 13A) and mRNA expression (Figure 13B) in peritoneal macrophages.
Figure 12. Adenosine treatment augments arginase activity and expression in IL-4 treated
macrophages. (A) RAW 264.7 macrophages were treated with 100 µM adenosine and at the same time
stimulated with 5 ng/ml IL-4 for an additional 8 h, and then arginase activity was measured from the
cell lysates. (B) RAW 264.7 macrophages were treated with 100 µM adenosine and 5 ng/ml IL-4, and
arginase-1 mRNA levels were measured by real-time PCR using RNA isolated 3 h after stimulating
with adenosine and IL-4. ***p<0.001 vs. control (con) group, ##p<0.01 vs. IL-4. Results (mean ±
SEM) shown are representative of at least 3 experiments with n=6 in each experiment. (C) RAW 264.7
cells were challenged with IL-4 in the presence or absence of adenosine or NECA for 8 h and arginase-
1 protein level was determined from cell extracts using Western blotting with antibodies raised against
arginase-1. -actin was utilized as internal control. The figure is representative of 3 separate
experiments.
Figure 13. Adenosine augments arginase activity and arginase-1 expression in primary
macrophages. (A) Mouse peritoneal macrophages were treated with 100 µM adenosine and 5 ng/ml
IL-4 for 24 h, and then arginase activity was measured from the cell lysates. Results (mean ± SEM)
shown are representative of at least 3 experiments with n=6 in each experiment. ***p<0.001 vs. con,
##p<0.01 vs. IL-4. (B) Peritoneal macrophages were obtained from male C57BL/6J mice, and were
treated with 100 µM adenosine and 5 ng/ml IL-4. After 4, 8, 12, or 24 h of incubation, arginase-1
mRNA abundance was measured using real-time PCR. Results (mean ± SEM) shown are representative
of at least 3 experiments with n=6 in each experiment. *p<0.05 vs. IL-4.
35
We next studied the effect of AR activation on TIMP-1 production. We found that IL-4
induced both TIMP-1 release into the medium and TIMP-1 mRNA accumulation in peritoneal
macrophages. In addition, adenosine increased both IL-4-induced TIMP-1 release and mRNA
accumulation (Figure 14A and B).
The effect of IL-4 or adenosine/IL-4 did not require TLR4, because IL-4 induced, and
adenosine enhanced IL-4-induced TIMP-1 release by both wild-type (WT) and TLR4 knockout
(KO) macrophages (Figure 14C). Additionally, adenosine or NECA augmented mgl-1 mRNA
accumulation in IL-4-challenged macrophages (Figure 15A and B).
Figure 14. Adenosine augments TIMP-1 production by alternatively activated macrophages. (A)
Peritoneal macrophages were treated with 100 µM adenosine and 5 ng/ml IL-4 for the indicated times
and then TIMP-1 was measured from the supernatants using ELISA. Results (mean ± SEM) shown are
representative of at least 3 experiments with n=4 in each experiment. **p<0.01 and ***p<0.001 vs. IL-
4. (B) Peritoneal macrophages were stimulated with 100 µM adenosine and 5 ng/ml IL-4, and TIMP-1
mRNA levels were measured by real-time PCR using RNA isolated 8 h after adenosine/IL-4. Results
(mean ± SEM) shown are representative of at least 3 experiments with n=6 in each experiment.
**p<0.01 vs. con, ##p<0.01 vs. IL-4. (C) Peritoneal macrophages were obtained from TLR4 KO and
WT mice and treated with IL-4 or adenosine and IL-4 for 24 h, after which period TIMP-1 production
was determined from the supernatants. Results (mean ± SEM) shown are representative of at least 2
experiments with n=4 in each experiment. ***p<0.001 and ###p<0.001 vs. corresponding IL-4-treated
groups.
36
To confirm the stimulatory effect of adenosine on alternative macrophage activation, we
studied the effect of adenosine on IL-13-induced arginase-1 mRNA accumulation and arginase
activity in RAW264.7 macrophages, as well as on IL-13-stimulated TIMP-1 expression in
peritoneal macrophages. We found that adenosine upregulated IL-13-induced arginase activity
and arginase-1 mRNA expression (Figure 16A and B) as well as TIMP-1 production (Figure
16C).
Figure 15. AR activation augments IL-4-stimulated mgl-1 mRNA accumulation in RAW 264.7
cells. RAW 264.7 macrophages were treated with 100 µM adenosine (A) or 3 µM NECA (B) and 5
ng/ml IL-4, and mgl-1 mRNA levels were measured by real-time PCR using RNA isolated 3 h after
stimulating with adenosine or NECA and IL-4. Results (mean ± SEM) shown are representative of at
least 3 experiments with n=4 in each experiment. ***p<0.001 or **p<0.01 vs. con, #p<0.05 or
##p<0.01 vs. IL-4.
Figure 16. Adenosine augments arginase activity and expression and TIMP-1 release in IL-13
stimulated macrophages. (A) RAW 264.7 macrophages were treated with 100 µM adenosine and
challenged with 5 ng/ml IL-13 for 8 h, and then arginase activity was measured from the cell lysate.
***p<0.001 vs. control (con), ##p<0.01 vs. IL-13. Results (mean ± SEM) shown are representative of 3
experiments with n=6 in each experiment. (B) RAW 264.7 macrophages were treated with 100 µM
adenosine and challenged with 5 ng/ml IL-13 for 8 h, and mRNA abundance was measured using real-
time PCR. Results (mean ± SEM) shown are representative of at least 3 experiments with n=6 in each
experiment. **p<0.01 vs. control , and #p<0.05 vs. IL-13. (C) Peritoneal macrophages were treated
with 100 µM adenosine and challenged with 5 ng/ml IL-13 for 24 h and then TIMP-1 levels were
measured from the supernatants using ELISA. Results (mean ± SEM) shown are representative of at
least 3 experiments with n=6 in each experiment. **p<0.01 vs. control, and ##p<0.01 vs. IL-13.
37
Because adenosine was more efficacious in increasing arginase activity and failed to
upregulate TIMP-1 release (data not shown) in RAW 264.7 macrophages, in the following
experiments we used RAW 264.7 and peritoneal macrophages, to study the mechanism of the
adenosine-induced upregulation of arginase-1 and TIMP-1, respectively.
5.5. Role of A2A and A2B ARs in mediating the stimulatory effect of adenosine on
alternative macrophage activation
To investigate which ARs are responsible for mediating the stimulatory effect of
adenosine on IL-4-induced arginase activity and TIMP-1 production, we pretreated macrophages
with specific AR agonists before IL-4 stimulation. We found that NECA increased both arginase
activity (EC50=261.8nM) and TIMP-1 production (EC50=80.67nM) by IL-4-stimulated
macrophages (Figure 17A and B). Furthermore, NECA increased IL-4-induced arginase-1
protein expression (Figure 12C). The EC50 values of NECA were indicative of a role for A2BARs
(Feoktistov and Biaggioni, 1993; Feoktistov and Biaggioni, 1998). In contrast, relevant
concentrations of CCPA or 2-Cl-IB-MECA failed to mimic the stimulatory effect of adenosine,
and CGS21680 was marginally effective at increasing TIMP-1 release but not arginase activity
(Figure 17A and B).
Figure 17. Effect of AR agonists on arginase activity and TIMP-1 production. (A) RAW 264.7
macrophages were treated with AR agonists and stimulated with IL-4 for 8 h, and then arginase activity
was measured from the cell lysate. Results (mean ± SEM) shown are representative of at least 3
experiments with n=6 in each experiment. ***p<0.001 vs. vehicle. (B) Peritoneal macrophages were
treated with AR agonists and stimulated with IL-4 for 24 h, and TIMP-1 concentrations were
determined in the supernatants. Results (mean ± SEM) shown are representative of at least 3
experiments with n=6 in each experiment. *p<0.05 vs. vehicle; ***p<0.001 vs. vehicle.
38
To further investigate the role of A2BARs, we also employed A2BAR KO mice. The
results confirmed that the A2BAR is important for the stimulatory effect of adenosine on IL-4-
induced TIMP-1 production, because both adenosine and NECA were incapable of upregulating
TIMP-1 production by macrophages isolated from A2BAR KO mice (Figures 18A and B). Similar
to genetic blockade of A2BARs, pharmacological antagonism by 100 nM PSB0778 inhibited both
the NECA enhancement of arginase activity and TIMP-1 production (Figure 19A and B). The
effect of PSB0778 was independent of A2AARs, because PSB0778 prevented the NECA
augmentation of TIMP-1 release also in A2AAR KO macrophages (Figure 19B).
PSB0778 prevented the NECA enhancement of TIMP-1 release in WT cells (Figure
19B), which could be construed as pointing to an exclusive role for the A2BAR in mediating the
effect of adenosine. However, because PSB0778 has not been pharmacologically characterized in
murine systems in detail and because A2AARs have been widely implicated in regulating
macrophage function (Hasko et al., 2007), we further studied the role of A2AARs by employing
A2AAR KO mice. Our results indicated that the A2AAR contributed, although to a lesser degree,
to the upregulation of TIMP-1 production, as both adenosine and NECA were less efficacious in
upregulating TIMP-1 production by macrophages obtained from A2AAR KO mice than from their
WT littermates (Figure 18A and B).
Figure 18. Effect of AR stimulation on alternative macrophage activation of WT, A2AAR KO or
A2BAR KO macrophages. Peritoneal macrophages isolated from A2AAR KO, A2BAR KO and WT
mice were treated with adenosine and stimulated with 5 ng/ml IL-4 (A) or NECA (B) for 24 h, and then
TIMP-1 levels were measured from the supernatants using ELISA. Results (mean ± SEM) shown are
representative of at least 3 experiments with n=6 in each experiment.*p<0.05 vs. IL-4; **p<0.01 vs. IL-
4.
39
5.6. C/EBP is required but CREB and STAT-6 are dispensable for the stimulatory effect
of adenosine on arginase-1 expression in IL-4-stimulated macrophages
Since the mechanisms of the IL-4 activation of arginase-1 transcription have been
investigated in detail (Gray et al., 2005; Pauleau et al., 2004; Ruffell et al., 2009), and because
nothing is known about how IL-4 affects TIMP-1 transcription, we studied the mechanism of
action of adenosine in enhancing arginase-1 transcription. Using a previously described arginase-
1 promoter luciferase construct (Pauleau et al., 2004), we showed that either adenosine or NECA
enhanced IL-4-induced arginase-1 promoter activity (Figure 20A). We then focused our effort on
3 transcription factors that have been implicated in regulating alternative macrophage activation,
C/EBP, CREB and STAT-6 (Gray et al., 2005; Pauleau et al., 2004; Ruffell et al., 2009). Since
we recently demonstrated that adenosine upregulates bacteria-induced C/EBP activation (Csoka
et al., 2007), we first examined the role of C/EBP. We found that either adenosine or IL-4 alone
was unable to increase C/EBP transcriptional activity; however, adenosine and IL-4 together
synergistically induced C/EBP transcriptional activity (Figure 20B). To provide further insight
into the role of C/EBP in regulating arginase-1 expression, C/EBP WT and KO immortalized
Figure 19. PSB0778 blocks the stimulatory effect of NECA on alternative activation of
macrophages. (A) RAW 264.7 macrophages were pretreated with 10-1000 nM PSB0778 30 min prior
to treatment with NECA and IL-4 for 8 h, and then cell lysates were prepared for arginase
measurements. Results (mean ± SEM) shown are representative of at least 3 experiments with n=6 in
each experiment. **p<0.01 vs. IL-4; #p<0.05 vs. IL-4/NECA and ##p<0.01 vs. IL-4/NECA. (B) WT
and A2AAR KO peritoneal macrophages were pretreated with 100 nM PSB0778 30 min prior to
treatment with NECA and IL-4 for 24 h. TIMP-1 levels were measured from the supernatants using ELISA. Results (mean ± SEM) shown are representative of at least 3 experiments with n=6 in each
experiment. ***p<0.001 vs. vehicle; ###p<0.001 vs. IL-4; $$$p<0.001 vs. IL-4/NECA.
40
macrophage cell lines (Albina et al., 2005; Gorgoni et al., 2002) were stimulated with adenosine
and IL-4, and then arginase activity was measured. As Figure 20C shows, IL-4 increased
arginase activity in both WT and KO macrophages, and adenosine upregulated this activity by
approximately 2-fold in WT but not KO macrophages.
It is noteworthy that similar to the results of a previous study (Albina et al., 2005), IL-4
induced a more pronounced increase in arginase activity in C/EBP KO than WT cells, which
may be a consequence of compensatory upregulation of other C/EBP factors. These data together
identify C/EBP as a major transcription factor mediating the stimulatory effect of adenosine on
arginase-1 expression in IL-4-activated macrophages.
A recent study documented that CREB-mediated C/EBP induction is required for the
upregulation of alternative activation-specific genes, including arginase-1 (Ruffell et al., 2009).
Furthermore, adenosine activates CREB in macrophages (Nemeth et al., 2003). Therefore,
Figure 20. The stimulatory effect of adenosine on arginase-1 transcription is mediated by
C/EBPβ. (A) RAW 264.7 cells were transiently transfected with promoter-luciferase reporter
constructs containing -3810/-31 fragment of the arginase-1 promoter in a pGL3 basic vector. Cells were
treated with adenosine or NECA and IL-4 for 8 h. Luciferase reporter activities were normalized to
control treatment. Results (mean ± SEM) shown are representative of at least 3 experiments with n=5 in
each experiment. **p<0.01 vs. control, #p<0.05 and ##p<0.01 vs. IL-4. (B) RAW 264.7 macrophages
were transfected with a luciferase reporter vector driven by C/EBP (pC/EBP-luc). Cells were treated
with adenosine (ado; 100 M) and IL-4 for 4 h, and luciferase activity was determined from cell
lysates. Luciferase reporter activities were normalized to protein concentration. Results (mean ± SEM)
shown are representative of at least 3 experiments with n=4 in each experiment. **p<0.01 vs. IL-4 or
ado. (C) C/EBP WT and KO macrophages were activated with IL-4 or adenosine plus IL-4, and
arginase activity was determined from the cell lysate following an 8-h stimulation. Results (mean ±
SEM) shown are representative of at least 3 experiments with n=6 in each experiment. ***p<0.001 vs.
control (con), and ###p<0.001 vs. IL-4 in C/EBP KO cells.
41
utilizing lentivirally-delivered shRNA to downregulate CREB expression, we assessed whether
CREB is required for the stimulatory effect of adenosine on IL-4-induced arginase expression.
We first confirmed using Western blotting that RAW 264.7 cells that were stably transduced with
lentivirally-delivered CREB shRNA expressed negligible levels of CREB protein when
compared to cells transduced with a control vector expressing non-targeting (NT) sequences
(Figure 21A).
We, then, stimulated macrophages with IL-4 or adenosine plus IL-4 and measured
arginase activity. As Figure 21B shows, arginase activity was induced by IL-4 and was further
upregulated by adenosine in both NT shRNA- and CREB shRNA-expressing macrophages.
These results indicate that CREB is not necessary for the stimulatory effect of adenosine on
arginase expression.
Additionally, we excluded a role for STAT-6 in mediating the augmenting effect of
adenosine on arginase activity, as we found that IL-4-induced STAT-6 activation was not
increased but actually decreased by adenosine (Figure 22).
Figure 21. The stimulatory effect of adenosine on arginase activity is independent of CREB.
RAW 264.7 cells were transduced with lentivirus particles containing either CREB-specific shRNA or
non-targeting (NT) shRNA. CREB-silenced or NT-transduced cells were selected in the presence of
puromycin. (A) CREB protein levels were evaluated by Western blotting using protein extract isolated
from NT shRNA- and CREB shRNA-transduced RAW 264.7 macrophages. Results shown are
representative of at least 3 experiments. (B) CREB-silenced or NT-transduced macrophages were
stimulated with adenosine and IL-4, and arginase activities were measured from the cell extracts.
Results (mean ± SEM) shown are representative of at least 3 experiments with n=6 in each experiment.
***p<0.001 vs. control (con); ###p<0.001 vs. IL-4.
42
5.7. Role of intracellular kinases in mediating the effect of adenosine on alternative
macrophage activation
Previous studies have shown that both IL-4 and adenosine can activate various
intracellular kinases, including JAK 1 and 3, Shc, PI3K, Akt, as well as p38, p42/44, and JNK
MAPKs. To dissect the role of these kinases in mediating the stimulatory effect of adenosine on
alternative macrophages activation, we first sought to detect using Western blot analysis the
active, phosphorylated forms of these kinases. We found that both adenosine and IL-4, both
alone and in combination, failed to induce JAK 1/3, Shc, PI3K, Akt, p42/44, and JNK activation
(data not shown), but adenosine alone and in combination with IL-4, but not IL-4 alone,
upregulated p38 activation (Figure 23A). We then pretreated macrophages with SB203580, a
selective p38 pathway inhibitor, 30 minutes prior to adenosine and IL-4 exposure to examine the
role of p38. SB203580 prevented the increasing effect of adenosine on both arginase activity
(Figure 23B) and TIMP-1 release (Figure 23C), confirming that p38 mediates the stimulatory
effect of adenosine on alternative macrophage activation.
Figure 22. Adenosine inhibits IL-4-induced STAT-6 activation. Peritoneal macrophages were
challenged with 5 ng/ml IL-4 in the presence or absence of adenosine (100 M) for the indicated times
and STAT-6 phosphorylation, which is indicative of activation, was determined from cell extracts taken
at the end of the incubation periods using Western blotting with antibodies raised against active,
phosphorylated STAT-6. -actin was employed as an internal control. The figure is representative of 3
separate experiments.
43
Figure 23. p38 activation is required for the stimulatory effect of adenosine on alternatively
activated macrophages. (A) Macrophages were treated with IL-4 in the presence or absence of
adenosine for 20 minutes. p38 activation was determined from cell extracts using immunoblotting with
antibodies raised against the active, doubly-phosphorylated form of p38. -actin was used as internal
control. This figure is representative of 3 separate experiments. (B) RAW 264.7 macrophages were
pretreated for 30 min with SB203580 before adding 100 M adenosine and 5 ng/ml IL-4. After 8 h of
incubation, arginase activities were assessed. Results (mean ± SEM) shown are representative of at
least 3 experiments with n=6 in each experiment. ***p<0.001 vs. IL-4, ##p<0.01 vs. adenosine/IL-4.
(C) Peritoneal macrophages were pretreated for 30 min with SB203580 before adding adenosine and
IL-4. 24 h later, supernatants were collected. TIMP-1 levels were assessed from the supernatants using
ELISA. Results (mean ± SEM) shown are representative of at least 3 experiments with n=6 in each
experiment. ***p<0.001 vs. IL-4 alone, #p<0.05 and ##p<0.01 vs. adenosine plus IL-4.
44
6. Discussion
6.1. Stimulatory effect of AR activation on IL-10 production by microglia
Here we have provided evidence that adenosine in conjunction with TLR ligands
augments the release of IL-10 by murine microglial cells. Using AR agonists and antagonist, we
have demonstrated that the A2BAR is primarily responsible for the stimulatory effect of
adenosine on IL-10 production. Specifically, we found that the order of potency of agonists was
NECA>IB-MECA>CCPA≥CGS21680, which indicates a predominant role for A2BARs in
triggering IL-10 production (Feoktistov and Biaggioni, 1997). In addition, the fact that the
A2BAR antagonist MRS1754 but not antagonists of the other ARs reversed the stimulatory effect
of both adenosine and NECA on IL-10 production, lends further credence to the proposal that
A2BARs are the most important ARs in augmenting IL-10 production by activated microglia. In
agreement with a primary role for A2BARs, mRNA levels of A2BARs were highest after PGN-
and LPS-treatment of BV-2 cells. Interestingly, while we found that the expression level of
A2BAR and A3AR mRNAs was comparable in unstimulated BV-2 cells, a previous study by
Haselkorn et al. showed that the expression of A2BAR mRNA was highest of all the ARs in
unstimulated BV-2 cells (Haselkorn et al., 2010). Nevertheless our results in primary microglia
showed a similar pattern of AR expression because the amount of A2BAR mRNA was largest in
either unstimulated or TLR-stimulated cells.
We have also confirmed the previously described inhibitory effect of adenosine on the
LPS-induced production of TNF-α and IL-12 by microglia (Lee et al., 2006; van der Putten et al.,
2009). In addition, we showed for the first time, that adenosine also diminishes IL-6 production
by microglial cells activated with different TLR agonists. Although we did not investigate the
role of the various ARs in suppressing the production of proinflammatory cytokines in the
current study, it appears that different ARs regulate the production of pro- vs. anti-inflammatory
cytokines by microglia. That is because while the inhibitory effect of adenosine on IL-12 and
TNF-α has been found to be A2AAR- or A3AR-dependent (Lee et al., 2006; van der Putten et al.,
2009), our data show that A2B receptors mediate the stimulatory effect of adenosine on IL-10
production.
Our data revealed that A2BAR stimulation increased IL-10 mRNA levels in BV-2 cells via
a transcriptional mechanism, as this effect could be completely prevented when transcription was
blocked using actinomycin D. This result was unexpected in microglia, because we previously
showed that A2BAR stimulation augmented IL-10 production by a translational mechanism in
45
TLR-activated macrophages (Nemeth et al., 2005). These observations indicate that A2BAR
activation differentially regulates IL-10 production by microglia vs. macrophages. Using a
number of approaches, we have pinpointed CREB as the transcription factor that mediates the
stimulatory effect of AR stimulation on IL-10 transcription. First, employing mutant IL-10
promoter constructs, we showed that a CREB-harboring region of the IL-10 promoter was
necessary for the stimulatory effect of AR stimulation. Secondly, we showed that CREB
phosphorylation occurs at the IL-10 promoter in response to AR stimulation in BV-2 cells.
Thirdly, we demonstrated that silencing CREB prevents the effect of AR stimulation on IL-10
release. Previous studies have linked the induction of IL-10 transcription to CREB in different
cell types, such as macrophages treated with adiponectin (Park et al., 2008) or LPS (Avni et al.,
2010), and in dendritic cells stimulated with the fungal cell wall product zymosan or IFN-β
(Alvarez et al., 2009; Wang et al., 2011). However, our study is the first one to show that IL-10
induction relies on CREB in microglia.
We have previously noted that AR stimulation enhances CREB phosphorylation and
transcriptional activity through a p38-dependent manner in macrophages (Nemeth et al., 2003).
The results of the present study with microglia also suggest a role of p38 in stimulating both
CREB activation and IL-10 release, as AR signaling augmented p38 phosphorylation, and
pharmacological inhibition of p38 blocked both the CREB and the IL-10 responses to AR
activation. Although p42/44 had also been linked to CREB activation and IL-10 transcription
(Park et al., 2008), we found that AR stimulation failed to induce the phosphorylation of p42/44
and pharmacological inhibition of p42/44 failed to prevent the stimulatory effect of AR
activation on IL-10 production of microglia. Thus, p42/44 is not required for the stimulatory
effect of AR activation on IL-10 production by microglia.
The participation of the PI3K/Akt pathway in AR signaling has been proposed by several
previous studies (Kuno et al., 2008; Schulte and Fredholm, 2003a; Solenkova et al., 2006; Wang
et al., 2011). Our results show that AR activation augments IL-10 production by activating the
PI3K/Akt pathway, but this pathway is independent of CREB. Our findings, thus, extend
previous observations, which showed that PI3K/Akt activation augments IL-10 production in
macrophages and dendritic cells (Lee et al., 2009; Polumuri et al., 2007; Saegusa et al., 2007).
Adenosine has been described to play regulatory roles in several CNS conditions, and the
role of the various AR subtypes varies. It has been shown that A1AR KO mice develop worsened
demyelination and axonal injury after EAE compared to WT littermates (Tsutsui et al., 2004),
indicating A1AR -mediated protection. The concentrations of IL-10 were lower in the spinal cord
of A1AR deficient mice with EAE compared to WT animals, but there was no difference in the
46
levels of TNF-α (Tsutsui et al., 2004). These results suggest that in addition to A2BARs, the
A1ARs may also contribute to the regulation of IL-10 expression in the brain. It is noteworthy
that the source of IL-10 was not identified in this study. Also implicating A1ARs in CNS
protection is the observation that stimulating the A1AR has been shown to be neuroprotective
after traumatic brain injury, as well, an effect which was associated with a decreased microglial
inflammatory response (Haselkorn et al., 2010). In contrast, Dai and coworkers showed that
A2AAR stimulation mediates the protective effects of adenosine in traumatic brain injury by
decreasing TNF-α and IL-1β expression, albeit interestingly only in case of low glutamate
concentrations. Stimulation of A2AAR by CGS21680 at a time when glutamate concentration was
high augmented TNF-α expression in the brain and aggravated brain damage caused by traumatic
injury (Dai et al., 2010). Duan and coworkers provided further evidence for the neuroprotective
role of A2AAR showing that cerebral IL-6 and TNF-α levels were higher and brain damage was
more severe in A2AAR KO mice with chronic cerebral hypoperfusion relative to WT mice (Duan
et al., 2009). It is noteworthy that A2ARs sometimes have proinflammatory effects in CNS
ischemic/inflammatory diseases (Chen et al., 1999; Li et al., 2009a; Rebola et al., 2011), and the
protective vs. injurious effects are dependent on various factors, such as the type of insult and the
ambient glutamate concentrations. Finally, stimulation of the A3AR decreased ischemic injury in
the brain and inhibited the migration of microglia to the inflammation site, as well as the release
of TNF-α and IL-1β (Choi et al., 2011). Thus, A1ARs, A2AARs and A3ARs have been described
to play important protective roles in different brain disorders, and some of these protective
effects are mediated by ARs expressed on microglia. Since the inflammatory response of
microglia is an important contributor to the pathophysiology of virtually all ischemic,
inflammatory, and neurodegenerative diseases (Polazzi and Monti, 2010), our data showing that
A2BAR activation augments IL-10 production by microglia point to an anti-inflammatory and
protective role of A2BAR activation in the brain. We propose that targeting A2BARs may be a
new approach for the treatment of neuroinflammatory diseases.
47
6.2. Adenosine enhances the alternative activation of macrophages
Macrophages can respond to endogenously released mediators that are generated during
infectious or injurious stimuli. Adenosine has been shown to be a broad inhibitor of the
proinflammatory consequences of classical macrophage activation. For example, adenosine
suppresses the LPS-induced production of proinflammatory cytokines, such as TNF-α and IL-12
(Hasko et al., 2000), the chemokine macrophage inflammatory protein-1 (Szabo et al., 1998), and
the release of proinflammatory mediators such as NO (Hasko et al., 1996). The stimulatory effect
of adenosine on IL-10 production also contributes to the control of the proinflammatory
responses of classically activated macrophages.
Our results with IL-4- and IL-13-stimulated macrophages show, for the first time, that
adenosine enhances alternative macrophage activation. The effects of adenosine in promoting
alternative macrophage activation are less broad than the wide-ranging inhibitory effects of
adenosine on classical macrophage activation, as adenosine increased the expression of key
alternative markers arginase-1, TIMP-1, and mgl-1, but not that of Ym1 and Fizz1 (data not
shown).
The current consensus is that the regulatory effects of adenosine on classically activated
macrophages are mediated primarily by A2AAR and secondarily by A2BAR. One of the best
characterized effects of adenosine on macrophages is its capacity to suppress the production of
TNF-α. The dominant role of the A2AAR in the inhibition of TNF-α production has been
confirmed in macrophages and monocytes of both human (Buenestado et al., 2010; Zhang et al.,
2005) and mouse origin (Kreckler et al., 2006; Ryzhov et al., 2008b). However, recent data show
that A2BAR stimulation can also decrease TNF-α production by mouse macrophages (Chen et al.,
2009; Kreckler et al., 2006). The augmenting effect of adenosine on IL-10 is also mediated by
both A2AAR and A2BAR. E.coli-induced IL-10 production in peritoneal macrophages has been
found to be enhanced by A2AAR stimulation (Csoka et al., 2007). However, the stimulatory effect
of adenosine on the IL-10 expression in LPS-induced RAW 264.7 macrophages was mediated by
the A2BAR (Nemeth et al., 2005).
The stimulatory effects of adenosine on alternative macrophage activation are mediated
predominantly by A2BAR, which contrasts with the preeminent role of A2AAR in regulating
classical macrophage activation (Hasko et al., 2007). This preeminent role of A2BAR was
confirmed by the observations that the stimulatory effects of adenosine and NECA on arginase
expression and TIMP-1 release were completely prevented by both A2BAR KO and
pharmacological A2BAR antagonism. In addition, NECA was by far the most potent agonist of all
48
the AR agonists tested, which further incriminates the A2BAR (Feoktistov and Biaggioni, 1997).
A lesser involvement of A2AAR is underlined by our results showing that both adenosine and
NECA were less efficacious in increasing TIMP-1 production by macrophages isolated from
A2AAR KO mice as compared to their WT counterparts. It is noteworthy that although
CGS21680 had a marginal, albeit significant, increasing effect on TIMP-1 production, it failed to
augment arginase activity. Thus, A2AAR and A2BAR differentially regulate distinct features of
alternative macrophage activation.
We found that AR stimulation upregulated IL-4-induced mRNA and protein
accumulation of both arginase-1 and TIMP-1. In addition, similar to its stimulatory effect on
arginase-1 mRNA accumulation (Figures 12B and 13B), AR stimulation enhanced IL-4-induced
arginase-1 promoter activity. Previous studies have proposed that arginase-1 promoter activity in
macrophages is regulated by STAT-6 and C/EBP (El Kasmi et al., 2008; Gray et al., 2005;
Pauleau et al., 2004; Qualls et al., 2010). Since AR stimulation decreased IL-4-induced STAT-6
activation (Figure 22), we concluded that STAT-6 activation does not mediate the upregulation
of arginase-1 following AR stimulation. In contrast, because IL-4-induced C/EBP-deficient
macrophages failed to upregulate arginase activity following AR stimulation, we conclude that
C/EBP mediates the stimulatory effect of AR stimulation on arginase-1 expression. This notion
is supported by our data that AR stimulation synergizes with IL-4 to upregulate C/EBP
transcriptional activity. This conclusion, together with previous observations of our research
group that C/EBP is required for the enhancing effect of adenosine on Eschericia coli-induced
IL-10 production (Csoka et al., 2007) is consistent with the idea that C/EBP represents an
important focal point, which orchestrates the effects of adenosine in macrophages (Hasko et al.,
2008).
It was reported recently that binding of CREB to C/EBP promoter elements is critical
for the activation of C/EBP-induced arginase-1 transcription in infiltrating macrophages
following muscle injury (Ruffell et al., 2009). The ability of ARs to stimulate CREB in
macrophages had been described previously (Nemeth et al., 2003) and was confirmed in our
studies on microglia discussed above. Based on these observations and previous data showing
that cAMP can upregulate arginase-1 expression (Erdely et al., 2006), we hypothesized that
adenosine should upregulate IL-4-induced arginase activity via CREB activation. However, we
excluded a role for CREB in this upregulation, as shRNA-mediated CREB silencing in
macrophages failed to reverse the adenosine increase of arginase activity in IL-4-induced
macrophages. Nevertheless, it is possible that cAMP contributed to the effect of adenosine in
49
enhancing alternative macrophage activation in a CREB-independent fashion. Further studies are
needed to determine the role of cAMP in mediating the stimulatory effect of AR activation on
alternative macrophage activation.
MAPKs are important for transmitting extracellular stressful signals toward the nucleus.
IL-4 has been shown to induce p42/44 and JNK activation in certain cell types, including
monocytes (Deszo et al., 2004), airway epithelial cells (Kim et al., 2009) and neutrophils (Ratthe
et al., 2007). Additionally, adenosine stimulates p42/44 and JNK activation in various immune
and non-immune cell types (Hasko et al., 2008; Jacobson and Gao, 2006). However, we found
that either IL-4 or adenosine failed to activate p42/44 and JNK in macrophages. IL-4 also
activates p38 MAPK signaling in a cell type-dependent manner; IL-4 increased p38 activation in
a murine macrophage cell line, but failed to influence p38 activation in B and T cell lines (Hunt
et al., 2002). In addition, both A2AAR and A2BAR can activate MAPK signaling and adenosine
has been reported to be capable of activating p38 in macrophages (Csoka et al., 2007; Feoktistov
et al., 1999; Nemeth et al., 2003). We found that although IL-4 had no effect on p38 activation,
adenosine alone or in combination with IL-4 increased p38 activation (Figure 23A). In addition,
inhibiting the p38 pathway prevented the stimulatory effect of adenosine on IL-4-induced
arginase activity and TIMP-1 release (Figures 23B and C). Since p38 was also essential for the
stimulatory effect of adenosine on IL-10 production by bacteria- and LPS-stimulated
macrophages (Csoka et al., 2007; Nemeth et al., 2005) and in PGN-stimulated microglia, we
propose that p38 is another central factor in mediating the regulatory effects of adenosine on both
classical and alternative macrophage activation.
As noted in the results section, due to the fact that adenosine failed to upregulate TIMP-1
secretion by RAW 264.7 macrophages, we did not study in a detailed manner the intracellular
mechanisms of how AR activation augments TIMP-1 release. It is plausible that distinct
intracellular pathways mediate the augmenting effect of adenosine on TIMP-1 production vs.
arginase-1 expression. Further studies are warranted to delineate the intracellular signaling
pathways leading to the stimulatory effect of adenosine on TIMP-1 release by alternatively
activated macrophages.
Alternatively activated macrophages are important for defense against extracellular
parasites (Noel et al., 2004). In this regard, our data that A2B receptors augment alternative
macrophage activation are in agreement with our unpublished observations that A2B receptors are
crucial for protection against mouse intestinal nematode parasite, Heligmosomoides polygyrus
(W.C. Gause, B. Koscsó, G. Haskó, B. Csóka, and N. Patel, unpublished data). This A2BAR-
50
mediated protection correlated with the degree of alternative macrophage activation in the
infected mice (W.C. Gause, B. Koscsó, G. Haskó, B. Csóka, and N. Patel, unpublished data).
In certain disease situations, however, alternatively activated macrophages can contribute
to the progression of disease. For example, it has been proposed that macrophages activated by
IL-4 and IL-13 during asthma and chronic obstructive pulmonary disease (COPD) contribute to
airway remodeling and lung fibrosis leading to lung dysfunction (Gordon, 2003; Noel et al.,
2004; Van Ginderachter et al., 2006). There is substantial evidence that adenosine can induce
bronchoconstriction in patients with asthma or COPD but not in healthy individuals, and that
adenosine levels are elevated in the bronchoalveolar lavage fluid and exhaled breath condensate
of patients with asthma (Cushley et al., 1983; Driver et al., 1993; Huszar et al., 2002). Adenosine
augments proinflammatory cytokine and chemokine release from bronchial smooth muscle
(Zhong et al., 2004) and epithelial cells (Zhong et al., 2006) and induces IL-4, IL-13 and IL-8
secretion by mast cells (Feoktistov and Biaggioni, 1995; Ryzhov et al., 2004), all of which are
mediated through A2BARs. Pharmacological blockade of A2BARs ameliorates the pulmonary
inflammation and fibrosis in adenosine deaminase KO mice, providing further evidence for the
deleterious role of A2BAR stimulation in chronic airway inflammation (Sun et al., 2006). In
addition, allergen-induced chronic pulmonary inflammation is attenuated in A2BAR KO mice
compared to WT littermates (Zaynagetdinov et al., 2010). Theophylline is a non-selective AR
antagonist that is widely used in asthma therapy, because of its inhibitory effect on
bronchoconstriction. It is believed that theophylline exerts its effects by blocking A2BARs on
mast cells (Caruso et al., 2009; Feoktistov et al., 1998; Polosa and Blackburn, 2009). Based on
our results we propose that the inhibition of alternative activation of macrophages may be
another mechanism by which theophylline ameliorates the symptoms of asthma.
It is now becoming increasingly clear that alternatively activated macrophages are
hijacked by tumor cells to function as suppressors of anti-tumor T cell responses and stimulators
of tumor angiogenesis (Mantovani et al., 2004; Van Ginderachter et al., 2006). Recently
published results show that A2BAR contribute to tumor progression. A2BAR stimulation on DCs
leads to aberrant differentiation and generation of a proangiogenic and tolerogenic phenotype.
Injection of DCs with this phenotype to tumors results in growth promotion (Novitskiy et al.,
2008). A2BAR KO mice exhibit attenuated tumor growth and longer survival after inoculation
with lung carcinoma cells compared to WT littermates (Ryzhov et al., 2008a). In addition,
pharmacological blockade of A2BAR inhibits breast tumor growth by enhancing DC activation
and antitumor responses (Cekic et al., 2012). Tumor progression is strongly regulated by
myeloid-derived suppressor cells and tumor-associated macrophages (Laoui et al., 2011;
51
Ostrand-Rosenberg and Sinha, 2009). The phenotype of both populations shows similarities to
alternatively activated macrophages; for example, both show increased arginase-1 expression
(Rodriguez and Ochoa, 2008). Thus, the stimulatory effect of A2BAR stimulation on the
alternative activation of macrophages may contribute to tumor progression, further highlighting
the therapeutic potential of inhibiting this AR subtype in the treatment of cancer.
Finally, it is well established that alternatively activated macrophages also participate in
wound healing (Murray and Wynn, 2011b). In addition, adenosine has been implicated as a
contributor to wound healing, in part because it augments the release of the crucial angiogenic
factor VEGF by macrophages (Ernens et al., 2010; Leibovich et al., 2002). The effect of
adenosine on VEGF involves both A2AARs and A2BARs (Gessi et al., 2010). Similar to VEGF,
we found that in alternatively activated macrophages, A2BARs mediate the augmenting effect of
adenosine on TIMP-1 expression and A2AARs also contribute the process. As TIMP-1 is an
important regulator of tissue remodeling, our data provide further insights into the actions of
adenosine in wound healing and suggest that stimulating either A2AARs or A2BARs may be used
for the therapeutic management of patients with impaired wound healing.
In conclusion, we have shown that the A2BAR regulates the function of both classically
activated microglia and alternatively activated macrophages. A2BAR stimulation upregulates IL-
10 production by microglia activated with TLR ligands. A2BARs augment arginase-1 expression
and activity in alternatively activated macrophages. A2BARs, and to a lesser extent A2AARs, also
increase IL-4-induced TIMP-1 production. As the A2BAR exerts a regulatory role in wide range
of macrophage populations with different activation profiles, targeting this receptor has a
widespread therapeutic potential in neuroinflammatory and neurodegenerative diseases and
conditions involving inappropriate TH2 responses and dysfunctional alternatively activated
macrophages.
52
7. References
Aarnoudse, C.A., J.J. Garcia Vallejo, E. Saeland, and Y. van Kooyk. 2006. Recognition of tumor
glycans by antigen-presenting cells. Curr Opin Immunol 18:105-111.
Adair, T.H. 2005. Growth regulation of the vascular system: an emerging role for adenosine. Am
J Physiol Regul Integr Comp Physiol 289:R283-R296.
Ajami, B., J.L. Bennett, C. Krieger, W. Tetzlaff, and F.M. Rossi. 2007. Local self-renewal can
sustain CNS microglia maintenance and function throughout adult life. Nature
neuroscience 10:1538-1543.
Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nature reviews. Immunology 4:499-
511.
Albina, J.E., E.J. Mahoney, J.M. Daley, D.E. Wesche, S.M. Morris, Jr., and J.S. Reichner. 2005.
Macrophage arginase regulation by CCAAT/enhancer-binding protein beta. Shock
23:168-172.
Albina, J.E., C.D. Mills, W.L. Henry, Jr., and M.D. Caldwell. 1990. Temporal expression of
different pathways of 1-arginine metabolism in healing wounds. Journal of Immunology
144:3877-3880.
Alvarez, Y., C. Municio, S. Alonso, M. Sanchez Crespo, and N. Fernandez. 2009. The induction
of IL-10 by zymosan in dendritic cells depends on CREB activation by the coactivators
CREB-binding protein and TORC2 and autocrine PGE2. J Immunol 183:1471-1479.
Amor, S., F. Puentes, D. Baker, and P. van der Valk. 2010. Inflammation in neurodegenerative
diseases. Immunology 129:154-169.
Arimoto, T., D.Y. Choi, X. Lu, M. Liu, X.V. Nguyen, N. Zheng, C.A. Stewart, H.C. Kim, and G.
Bing. 2007. Interleukin-10 protects against inflammation-mediated degeneration of
dopaminergic neurons in substantia nigra. Neurobiol Aging 28:894-906.
Ates, O., S. Cayli, E. Altinoz, I. Gurses, N. Yucel, M. Sener, A. Kocak, and S. Yologlu. 2007.
Neuroprotection by resveratrol against traumatic brain injury in rats. Mol Cell Biochem
294:137-144.
Avni, D., O. Ernst, A. Philosoph, and T. Zor. 2010. Role of CREB in modulation of TNFalpha
and IL-10 expression in LPS-stimulated RAW264.7 macrophages. Mol Immunol
47:1396-1403.
Bachis, A., A.M. Colangelo, S. Vicini, P.P. Doe, M.A. De Bernardi, G. Brooker, and I.
Mocchetti. 2001. Interleukin-10 prevents glutamate-mediated cerebellar granule cell
53
death by blocking caspase-3-like activity. The Journal of neuroscience : the official
journal of the Society for Neuroscience 21:3104-3112.
Badoer, E. 2010. Microglia: activation in acute and chronic inflammatory states and in response
to cardiovascular dysfunction. Int J Biochem Cell Biol 42:1580-1585.
Balasingam, V., and V.W. Yong. 1996. Attenuation of astroglial reactivity by interleukin-10. The
Journal of neuroscience : the official journal of the Society for Neuroscience 16:2945-
2955.
Barichello, T., I. dos Santos, G.D. Savi, A.F. Florentino, C. Silvestre, C.M. Comim, G. Feier, D.
Sachs, M.M. Teixeira, A.L. Teixeira, and J. Quevedo. 2009. Tumor necrosis factor alpha
(TNF-alpha) levels in the brain and cerebrospinal fluid after meningitis induced by
Streptococcus pneumoniae. Neuroscience Letters 467:217-219.
Barnholt, K.E., R.S. Kota, H.H. Aung, and J.C. Rutledge. 2009. Adenosine Blocks IFN-γ-
Induced Phosphorylation of STAT1 on Serine 727 to Reduce Macrophage Activation.
The Journal of Immunology 183:6767-6777.
Belikoff, B.G., S. Hatfield, P. Georgiev, A. Ohta, D. Lukashev, J.A. Buras, D.G. Remick, and M.
Sitkovsky. 2011. A2B adenosine receptor blockade enhances macrophage-mediated
bacterial phagocytosis and improves polymicrobial sepsis survival in mice. Journal of
Immunology 186:2444-2453.
Blasi, E., R. Barluzzi, V. Bocchini, R. Mazzolla, and F. Bistoni. 1990. Immortalization of murine
microglial cells by a v-raf/v-myc carrying retrovirus. J Neuroimmunol 27:229-237.
Bours, M.J.L., E.L.R. Swennen, F. Di Virgilio, B.N. Cronstein, and P.C. Dagnelie. 2006.
Adenosine 5'-triphosphate and adenosine as endogenous signaling molecules in immunity
and inflammation. Pharmacology & Therapeutics 112:358-404.
Breckler, M., M. Berthouze, A.C. Laurent, B. Crozatier, E. Morel, and F. Lezoualc'h. 2011. Rap-
linked cAMP signaling Epac proteins: compartmentation, functioning and disease
implications. Cellular Signalling 23:1257-1266.
Brightbill, H.D., S.E. Plevy, R.L. Modlin, and S.T. Smale. 2000. A prominent role for Sp1 during
lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages. J Immunol
164:1940-1951.
Broussas, M., P. Cornillet-Lefebvre, G. Potron, and P. Nguyen. 1999. Inhibition of fMLP-
triggered respiratory burst of human monocytes by adenosine: involvement of A3
adenosine receptor. J Leukoc Biol 66:495-501.
Buenestado, A., S. Grassin Delyle, I. Arnould, F. Besnard, E. Naline, S. Blouquit-Laye, A.
Chapelier, J.F. Bellamy, and P. Devillier. 2010. The role of adenosine receptors in
54
regulating production of tumour necrosis factor-alpha and chemokines by human lung
macrophages. Br J Pharmacol 159:1304-1311.
Carty, M., and A.G. Bowie. 2011. Evaluating the role of Toll-like receptors in diseases of the
central nervous system. Biochem Pharmacol 81:825-837.
Caruso, M., K. Varani, G. Tringali, and R. Polosa. 2009. Adenosine and adenosine receptors:
their contribution to airway inflammation and therapeutic potential in asthma. Current
medicinal chemistry 16:3875-3885.
Cekic, C., D. Sag, Y. Li, D. Theodorescu, R.M. Strieter, and J. Linden. 2012. Adenosine A2B
receptor blockade slows growth of bladder and breast tumors. Journal of Immunology
188:198-205.
Chang, N.C., S.I. Hung, K.Y. Hwa, I. Kato, J.E. Chen, C.H. Liu, and A.C. Chang. 2001. A
macrophage protein, Ym1, transiently expressed during inflammation is a novel
mammalian lectin. The Journal of biological chemistry 276:17497-17506.
Chauhan, V.S., D.G. Sterka, Jr., S.R. Furr, A.B. Young, and I. Marriott. 2009. NOD2 plays an
important role in the inflammatory responses of microglia and astrocytes to bacterial CNS
pathogens. Glia 57:414-423.
Chen, H., D. Yang, S.H. Carroll, H.K. Eltzschig, and K. Ravid. 2009. Activation of the
macrophage A2b adenosine receptor regulates tumor necrosis factor-alpha levels
following vascular injury. Exp Hematol 37:533-538.
Chen, J.F., Z. Huang, J. Ma, J. Zhu, R. Moratalla, D. Standaert, M.A. Moskowitz, J.S. Fink, and
M.A. Schwarzschild. 1999. A(2A) adenosine receptor deficiency attenuates brain injury
induced by transient focal ischemia in mice. The Journal of neuroscience : the official
journal of the Society for Neuroscience 19:9192-9200.
Choi, I.Y., J.C. Lee, C. Ju, S. Hwang, G.S. Cho, H.W. Lee, W.J. Choi, L.S. Jeong, and W.K.
Kim. 2011. A3 adenosine receptor agonist reduces brain ischemic injury and inhibits
inflammatory cell migration in rats. The American journal of pathology 179:2042-2052.
Clark, I.A., L.M. Alleva, and B. Vissel. 2010. The roles of TNF in brain dysfunction and disease.
Pharmacology & Therapeutics 128:519-548.
Collins, L.M., A. Toulouse, T.J. Connor, and Y.M. Nolan. 2012. Contributions of central and
systemic inflammation to the pathophysiology of Parkinson's disease.
Neuropharmacology
Combs, C.K. 2009. Inflammation and microglia actions in Alzheimer's disease. J Neuroimmune
Pharmacol 4:380-388.
55
Corraliza, I.M., G. Soler, K. Eichmann, and M. Modolell. 1995. Arginase induction by
suppressors of nitric oxide synthesis (IL-4, IL-10 and PGE2) in murine bone-marrow-
derived macrophages. Biochemical and Biophysical Research Communications 206:667-
673.
Crane, J.K., R.A. Olson, H.M. Jones, and M.E. Duffey. 2002. Release of ATP during host cell
killing by enteropathogenic E. coli and its role as a secretory mediator. American journal
of physiology. Gastrointestinal and liver physiology 283:G74-86.
Cronstein, B.N., S.B. Kramer, G. Weissmann, and R. Hirschhorn. 1983. Adenosine: a
physiological modulator of superoxide anion generation by human neutrophils. J Exp
Med 158:1160-1177.
Csoka, B., Z.H. Nemeth, P. Rosenberger, H.K. Eltzschig, Z. Spolarics, P. Pacher, Z. Selmeczy,
B. Koscso, L. Himer, E.S. Vizi, M.R. Blackburn, E.A. Deitch, and G. Hasko. 2010. A2B
adenosine receptors protect against sepsis-induced mortality by dampening excessive
inflammation. J Immunol 185:542-550.
Csoka, B., Z.H. Nemeth, L. Virag, P. Gergely, S.J. Leibovich, P. Pacher, C.X. Sun, M.R.
Blackburn, E.S. Vizi, E.A. Deitch, and G. Hasko. 2007. A2A adenosine receptors and
C/EBPbeta are crucially required for IL-10 production by macrophages exposed to
Escherichia coli. Blood 110:2685-2695.
Cushley, M.J., A.E. Tattersfield, and S.T. Holgate. 1983. Inhaled adenosine and guanosine on
airway resistance in normal and asthmatic subjects. Br J Clin Pharmacol 15:161-165.
Dai, H., B. Ciric, G.X. Zhang, and A. Rostami. 2012. Interleukin-10 plays a crucial role in
suppression of experimental autoimmune encephalomyelitis by Bowman-Birk inhibitor.
Journal of Neuroimmunology 245:1-7.
Dai, S.S., Y.G. Zhou, W. Li, J.H. An, P. Li, N. Yang, X.Y. Chen, R.P. Xiong, P. Liu, Y. Zhao,
H.Y. Shen, P.F. Zhu, and J.F. Chen. 2010. Local glutamate level dictates adenosine A2A
receptor regulation of neuroinflammation and traumatic brain injury. J Neurosci 30:5802-
5810.
Deaglio, S., and S.C. Robson. 2011. Ectonucleotidases as regulators of purinergic signaling in
thrombosis, inflammation, and immunity. Adv Pharmacol 61:301-332.
Deszo, E.L., D.K. Brake, K.W. Kelley, and G.G. Freund. 2004. IL-4-dependent CD86 expression
requires JAK/STAT6 activation and is negatively regulated by PKCdelta. Cellular
Signalling 16:271-280.
Driver, A.G., C.A. Kukoly, S. Ali, and S.J. Mustafa. 1993. Adenosine in Bronchoalveolar Lavage
Fluid in Asthma. American Review of Respiratory Disease 148:91-97.
56
Drury, A.S., A. 1929. The physiological activity of adenine compounds with especial reference
to their action upon the mammalian heart. Journal of Physiology 68:213-237.
Duan, W., L. Gui, Z. Zhou, Y. Liu, H. Tian, J.F. Chen, and J. Zheng. 2009. Adenosine A2A
receptor deficiency exacerbates white matter lesions and cognitive deficits induced by
chronic cerebral hypoperfusion in mice. J Neurol Sci 285:39-45.
Dunkelberger, J., L. Zhou, T. Miwa, and W.C. Song. 2012. C5aR Expression in a Novel GFP
Reporter Gene Knockin Mouse: Implications for the Mechanism of Action of C5aR
Signaling in T Cell Immunity. Journal of Immunology 188:4032-4042.
Ehlers, M.R. 2000. CR3: a general purpose adhesion-recognition receptor essential for innate
immunity. Microbes and infection / Institut Pasteur 2:289-294.
El Chartouni, C., L. Schwarzfischer, and M. Rehli. 2010. Interleukin-4 induced interferon
regulatory factor (Irf) 4 participates in the regulation of alternative macrophage priming.
Immunobiology 215:821-825.
El Kasmi, K.C., J.E. Qualls, J.T. Pesce, A.M. Smith, R.W. Thompson, M. Henao-Tamayo, R.J.
Basaraba, T. Konig, U. Schleicher, M.S. Koo, G. Kaplan, K.A. Fitzgerald, E.I.
Tuomanen, I.M. Orme, T.D. Kanneganti, C. Bogdan, T.A. Wynn, and P.J. Murray. 2008.
Toll-like receptor-induced arginase 1 in macrophages thwarts effective immunity against
intracellular pathogens. Nat Immunol 9:1399-1406.
Erdely, A., D. Kepka-Lenhart, M. Clark, P. Zeidler-Erdely, M. Poljakovic, W.J. Calhoun, and
S.M. Morris, Jr. 2006. Inhibition of phosphodiesterase 4 amplifies cytokine-dependent
induction of arginase in macrophages. American journal of physiology. Lung cellular and
molecular physiology 290:L534-539.
Ernens, I., F. Leonard, M. Vausort, M. Rolland-Turner, Y. Devaux, and D.R. Wagner. 2010.
Adenosine up-regulates vascular endothelial growth factor in human macrophages.
Biochemical and Biophysical Research Communications 392:351-356.
Ershler, W.B., and E.T. Keller. 2000. Age-associated increased interleukin-6 gene expression,
late-life diseases, and frailty. Annu Rev Med 51:245-270.
Eugster, H.P., K. Frei, M. Kopf, H. Lassmann, and A. Fontana. 1998. IL-6-deficient mice resist
myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis. European
journal of immunology 28:2178-2187.
Feoktistov, I., and I. Biaggioni. 1993. Characterization of adenosine receptors in human
erythroleukemia cells and platelets: further evidence for heterogeneity of adenosine A2
receptor subtypes. Molecular Pharmacology 43:909-914.
57
Feoktistov, I., and I. Biaggioni. 1995. Adenosine A2b receptors evoke interleukin-8 secretion in
human mast cells. An enprofylline-sensitive mechanism with implications for asthma. J
Clin Invest 96:1979-1986.
Feoktistov, I., and I. Biaggioni. 1997. Adenosine A2B receptors. Pharmacol Rev 49:381-402.
Feoktistov, I., and I. Biaggioni. 1998. Pharmacological characterization of adenosine A2B
receptors: studies in human mast cells co-expressing A2A and A2B adenosine receptor
subtypes. Biochemical Pharmacology 55:627-633.
Feoktistov, I., A.E. Goldstein, and I. Biaggioni. 1999. Role of p38 mitogen-activated protein
kinase and extracellular signal-regulated protein kinase kinase in adenosine A2B
receptor-mediated interleukin-8 production in human mast cells. Mol Pharmacol 55:726-
734.
Feoktistov, I., R. Polosa, S.T. Holgate, and I. Biaggioni. 1998. Adenosine A2B receptors: a novel
therapeutic target in asthma? Trends in pharmacological sciences 19:148-153.
Fiebich, B.L., K. Biber, K. Lieb, D. van Calker, M. Berger, J. Bauer, and P.J. Gebicke-Haerter.
1996. Cyclooxygenase-2 expression in rat microglia is induced by adenosine A2a-
receptors. Glia 18:152-160.
Fiorentino, D.F., M.W. Bond, and T.R. Mosmann. 1989. Two types of mouse T helper cell. IV.
Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exp Med
170:2081-2095.
Flugel, A., M. Bradl, G.W. Kreutzberg, and M.B. Graeber. 2001. Transformation of donor-
derived bone marrow precursors into host microglia during autoimmune CNS
inflammation and during the retrograde response to axotomy. Journal of neuroscience
research 66:74-82.
Fredholm, B.B., I.J. AP, K.A. Jacobson, K.N. Klotz, and J. Linden. 2001. International Union of
Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol
Rev 53:527-552.
Furr, S.R., V.S. Chauhan, D. Sterka, Jr., V. Grdzelishvili, and I. Marriott. 2008. Characterization
of retinoic acid-inducible gene-I expression in primary murine glia following exposure to
vesicular stomatitis virus. Journal of Neurovirology 14:503-513.
Gandhi, R., A. Laroni, and H.L. Weiner. 2010. Role of the innate immune system in the
pathogenesis of multiple sclerosis. J Neuroimmunol 221:7-14.
Geissmann, F., M.G. Manz, S. Jung, M.H. Sieweke, M. Merad, and K. Ley. 2010. Development
of monocytes, macrophages, and dendritic cells. Science 327:656-661.
58
Gessi, S., E. Fogli, V. Sacchetto, S. Merighi, K. Varani, D. Preti, E. Leung, S. Maclennan, and
P.A. Borea. 2010. Adenosine modulates HIF-1{alpha}, VEGF, IL-8, and foam cell
formation in a human model of hypoxic foam cells. Arterioscler Thromb Vasc Biol 30:90-
97.
Gessi, S., S. Merighi, K. Varani, E. Leung, S. Mac Lennan, and P.A. Borea. 2008. The A3
adenosine receptor: an enigmatic player in cell biology. Pharmacol Ther 117:123-140.
Goerdt, S., and C.E. Orfanos. 1999. Other functions, other genes: alternative activation of
antigen-presenting cells. Immunity 10:137-142.
Gordon, S. 2003. Alternative activation of macrophages. Nature reviews. Immunology 3:23-35.
Gordon, S., and F.O. Martinez. 2010. Alternative activation of macrophages: mechanism and
functions. Immunity 32:593-604.
Gorgoni, B., D. Maritano, P. Marthyn, M. Righi, and V. Poli. 2002. C/EBP beta gene inactivation
causes both impaired and enhanced gene expression and inverse regulation of IL-12 p40
and p35 mRNAs in macrophages. Journal of Immunology 168:4055-4062.
Gough, M.J., A.A. Melcher, A. Ahmed, M.R. Crittenden, D.S. Riddle, E. Linardakis, A.N.
Ruchatz, L.M. Emiliusen, and R.G. Vile. 2001. Macrophages orchestrate the immune
response to tumor cell death. Cancer Research 61:7240-7247.
Gray, M.J., M. Poljakovic, D. Kepka-Lenhart, and S.M. Morris, Jr. 2005. Induction of arginase I
transcription by IL-4 requires a composite DNA response element for STAT6 and
C/EBPbeta. Gene 353:98-106.
Halle, A., V. Hornung, G.C. Petzold, C.R. Stewart, B.G. Monks, T. Reinheckel, K.A. Fitzgerald,
E. Latz, K.J. Moore, and D.T. Golenbock. 2008. The NALP3 inflammasome is involved
in the innate immune response to amyloid-beta. Nat Immunol 9:857-865.
Haselkorn, M.L., D.K. Shellington, E.K. Jackson, V.A. Vagni, K. Janesko-Feldman, R.K. Dubey,
D.G. Gillespie, D. Cheng, M.J. Bell, L.W. Jenkins, G.E. Homanics, J. Schnermann, and
P.M. Kochanek. 2010. Adenosine A1 receptor activation as a brake on the microglial
response after experimental traumatic brain injury in mice. J Neurotrauma 27:901-910.
Hasko, G., and B.N. Cronstein. 2004. Adenosine: an endogenous regulator of innate immunity.
Trends Immunol 25:33-39.
Hasko, G., D.G. Kuhel, J.F. Chen, M.A. Schwarzschild, E.A. Deitch, J.G. Mabley, A. Marton,
and C. Szabo. 2000. Adenosine inhibits IL-12 and TNF-[alpha] production via adenosine
A2a receptor-dependent and independent mechanisms. Faseb J 14:2065-2074.
Hasko, G., J. Linden, B. Cronstein, and P. Pacher. 2008. Adenosine receptors: therapeutic aspects
for inflammatory and immune diseases. Nat Rev Drug Discov 7:759-770.
59
Hasko, G., and P. Pacher. 2012. Regulation of macrophage function by adenosine.
Arteriosclerosis, thrombosis, and vascular biology 32:865-869.
Hasko, G., P. Pacher, E.A. Deitch, and E.S. Vizi. 2007. Shaping of monocyte and macrophage
function by adenosine receptors. Pharmacol Ther 113:264-275.
Hasko, G., C. Szabo, Z.H. Nemeth, V. Kvetan, S.M. Pastores, and E.S. Vizi. 1996. Adenosine
receptor agonists differentially regulate IL-10, TNF-alpha, and nitric oxide production in
RAW 264.7 macrophages and in endotoxemic mice. J Immunol 157:4634-4640.
Hayakata, T., T. Shiozaki, O. Tasaki, H. Ikegawa, Y. Inoue, F. Toshiyuki, H. Hosotubo, F.
Kieko, T. Yamashita, H. Tanaka, T. Shimazu, and H. Sugimoto. 2004. Changes in CSF
S100B and cytokine concentrations in early-phase severe traumatic brain injury. Shock
22:102-107.
Heyen, J.R., S. Ye, B.N. Finck, and R.W. Johnson. 2000. Interleukin (IL)-10 inhibits IL-6
production in microglia by preventing activation of NF-kappaB. Brain Res Mol Brain Res
77:138-147.
Heyser, C.J., E. Masliah, A. Samimi, I.L. Campbell, and L.H. Gold. 1997. Progressive decline in
avoidance learning paralleled by inflammatory neurodegeneration in transgenic mice
expressing interleukin 6 in the brain. Proceedings of the National Academy of Sciences of
the United States of America 94:1500-1505.
Hunt, A.E., L.M. Williams, F.V. Lali, and B.M. Foxwell. 2002. IL-4 regulation of p38 MAPK
signalling is dependent on cell type. Cytokine 18:295-303.
Huszar, E., G. Vass, E. Vizi, Z. Csoma, E. Barat, G. Molnar Vilagos, I. Herjavecz, and I.
Horvath. 2002. Adenosine in exhaled breath condensate in healthy volunteers and in
patients with asthma. Eur Respir J 20:1393-1398.
Jacobson, K.A., and Z.G. Gao. 2006. Adenosine receptors as therapeutic targets. Nat Rev Drug
Discov 5:247-264.
Jander, S., J. Pohl, D. D'Urso, C. Gillen, and G. Stoll. 1998. Time course and cellular localization
of interleukin-10 mRNA and protein expression in autoimmune inflammation of the rat
central nervous system. The American journal of pathology 152:975-982.
Janelsins, M.C., M.A. Mastrangelo, K.M. Park, K.L. Sudol, W.C. Narrow, S. Oddo, F.M.
LaFerla, L.M. Callahan, H.J. Federoff, and W.J. Bowers. 2008. Chronic neuron-specific
tumor necrosis factor-alpha expression enhances the local inflammatory environment
ultimately leading to neuronal death in 3xTg-AD mice. The American journal of
pathology 173:1768-1782.
60
John, C.C., A. Panoskaltsis-Mortari, R.O. Opoka, G.S. Park, P.J. Orchard, A.M. Jurek, R. Idro, J.
Byarugaba, and M.J. Boivin. 2008. Cerebrospinal fluid cytokine levels and cognitive
impairment in cerebral malaria. Am J Trop Med Hyg 78:198-205.
Kielian, T., P. Mayes, and M. Kielian. 2002. Characterization of microglial responses to
Staphylococcus aureus: effects on cytokine, costimulatory molecule, and Toll-like
receptor expression. J Neuroimmunol 130:86-99.
Kim, C.H., K.E. Kim, J.H. Yoon, and K.S. Song. 2009. Upregulation of MUC5AC gene
expression by IL-4 through CREB in human airway epithelial cells. J Cell Biochem
108:974-981.
Knoblach, S.M., and A.I. Faden. 1998. Interleukin-10 improves outcome and alters
proinflammatory cytokine expression after experimental traumatic brain injury. Exp
Neurol 153:143-151.
Koronyo-Hamaoui, M., M.K. Ko, Y. Koronyo, D. Azoulay, A. Seksenyan, G. Kunis, M. Pham, J.
Bakhsheshian, P. Rogeri, K.L. Black, D.L. Farkas, and M. Schwartz. 2009. Attenuation of
AD-like neuropathology by harnessing peripheral immune cells: local elevation of IL-10
and MMP-9. Journal of neurochemistry 111:1409-1424.
Kreckler, L.M., T.C. Wan, Z.D. Ge, and J.A. Auchampach. 2006. Adenosine inhibits tumor
necrosis factor-alpha release from mouse peritoneal macrophages via A2A and A2B but
not the A3 adenosine receptor. J Pharmacol Exp Ther 317:172-180.
Kremlev, S.G., and C. Palmer. 2005. Interleukin-10 inhibits endotoxin-induced pro-inflammatory
cytokines in microglial cell cultures. J Neuroimmunol 162:71-80.
Kuno, A., N.V. Solenkova, V. Solodushko, T. Dost, Y. Liu, X.M. Yang, M.V. Cohen, and J.M.
Downey. 2008. Infarct limitation by a protein kinase G activator at reperfusion in rabbit
hearts is dependent on sensitizing the heart to A2b agonists by protein kinase C. Am J
Physiol Heart Circ Physiol 295:H1288-H1295.
Laoui, D., E. Van Overmeire, K. Movahedi, J. Van den Bossche, E. Schouppe, C. Mommer, A.
Nikolaou, Y. Morias, P. De Baetselier, and J.A. Van Ginderachter. 2011. Mononuclear
phagocyte heterogeneity in cancer: different subsets and activation states reaching out at
the tumor site. Immunobiology 216:1192-1202.
Lee, J.Y., B.S. Jhun, Y.T. Oh, J.H. Lee, W. Choe, H.H. Baik, J. Ha, K.-S. Yoon, S.S. Kim, and I.
Kang. 2006. Activation of adenosine A3 receptor suppresses lipopolysaccharide-induced
TNF-[alpha] production through inhibition of PI 3-kinase/Akt and NF-[kappa]B
activation in murine BV2 microglial cells. Neuroscience Letters 396:1-6.
61
Lee, T.-P., S.-J.J. Leu, J.C. Huang, Y.-C. Song, R.-S. Jhou, S.-J. Tang, and K.-H. Sun. 2009.
Anti-ribosomal phosphoprotein autoantibody triggers interleukin-10 overproduction via
phosphatidylinositol 3-kinase-dependent signalling pathways in lipopolysaccharide-
activated macrophages. Immunology 127:91-102.
Lehnardt, S. 2010. Innate immunity and neuroinflammation in the CNS: the role of microglia in
Toll-like receptor-mediated neuronal injury. Glia 58:253-263.
Lehnardt, S., C. Lachance, S. Patrizi, S. Lefebvre, P.L. Follett, F.E. Jensen, P.A. Rosenberg, J.J.
Volpe, and T. Vartanian. 2002. The toll-like receptor TLR4 is necessary for
lipopolysaccharide-induced oligodendrocyte injury in the CNS. J Neurosci 22:2478-2486.
Lehnardt, S., L. Massillon, P. Follett, F.E. Jensen, R. Ratan, P.A. Rosenberg, J.J. Volpe, and T.
Vartanian. 2003. Activation of innate immunity in the CNS triggers neurodegeneration
through a Toll-like receptor 4-dependent pathway. Proc Natl Acad Sci U S A 100:8514-
8519.
Leibovich, S.J., J.F. Chen, G. Pinhal-Enfield, P.C. Belem, G. Elson, A. Rosania, M. Ramanathan,
C. Montesinos, M. Jacobson, M.A. Schwarzschild, J.S. Fink, and B. Cronstein. 2002.
Synergistic up-regulation of vascular endothelial growth factor expression in murine
macrophages by adenosine A(2A) receptor agonists and endotoxin. Am J Pathol
160:2231-2244.
Leonard, E.J., A. Shenai, and A. Skeel. 1987. Dynamics of chemotactic peptide-induced
superoxide generation by human monocytes. Inflammation 11:229-240.
Li, L., J. Lu, S.S. Tay, S.M. Moochhala, and B.P. He. 2007. The function of microglia, either
neuroprotection or neurotoxicity, is determined by the equilibrium among factors released
from activated microglia in vitro. Brain research 1159:8-17.
Li, W., S. Dai, J. An, R. Xiong, P. Li, X. Chen, Y. Zhao, P. Liu, H. Wang, P. Zhu, J. Chen, and
Y. Zhou. 2009a. Genetic inactivation of adenosine A2A receptors attenuates acute
traumatic brain injury in the mouse cortical impact model. Exp Neurol 215:69-76.
Li, X.Z., L.M. Bai, Y.P. Yang, W.F. Luo, W.D. Hu, J.P. Chen, C.J. Mao, and C.F. Liu. 2009b.
Effects of IL-6 secreted from astrocytes on the survival of dopaminergic neurons in
lipopolysaccharide-induced inflammation. Neurosci Res 65:252-258.
Liao, X., N. Sharma, F. Kapadia, G. Zhou, Y. Lu, H. Hong, K. Paruchuri, G.H. Mahabeleshwar,
E. Dalmas, N. Venteclef, C.A. Flask, J. Kim, B.W. Doreian, K.Q. Lu, K.H. Kaestner, A.
Hamik, K. Clement, and M.K. Jain. 2011. Kruppel-like factor 4 regulates macrophage
polarization. The Journal of clinical investigation 121:2736-2749.
62
Lin, H.Y., C.H. Tang, Y.H. Chen, I.H. Wei, J.H. Chen, C.H. Lai, and D.Y. Lu. 2010.
Peptidoglycan enhances proinflammatory cytokine expression through the TLR2
receptor, MyD88, phosphatidylinositol 3-kinase/AKT and NF-kappaB pathways in BV-2
microglia. Int Immunopharmacol 10:883-891.
Liu, T., H. Jin, M. Ullenbruch, B. Hu, N. Hashimoto, B. Moore, A. McKenzie, N.W. Lukacs, and
S.H. Phan. 2004. Regulation of found in inflammatory zone 1 expression in bleomycin-
induced lung fibrosis: role of IL-4/IL-13 and mediation via STAT-6. Journal of
Immunology 173:3425-3431.
Liu, X., V.S. Chauhan, A.B. Young, and I. Marriott. 2010. NOD2 mediates inflammatory
responses of primary murine glia to Streptococcus pneumoniae. Glia 58:839-847.
Londono, D., J. Carvajal, K. Strle, K.S. Kim, and D. Cadavid. 2011. IL-10 Prevents apoptosis of
brain endothelium during bacteremia. Journal of Immunology 186:7176-7186.
Mantovani, A., A. Sica, S. Sozzani, P. Allavena, A. Vecchi, and M. Locati. 2004. The chemokine
system in diverse forms of macrophage activation and polarization. Trends in
immunology 25:677-686.
McAlpine, F.E., J.K. Lee, A.S. Harms, K.A. Ruhn, M. Blurton-Jones, J. Hong, P. Das, T.E.
Golde, F.M. LaFerla, S. Oddo, A. Blesch, and M.G. Tansey. 2009. Inhibition of soluble
TNF signaling in a mouse model of Alzheimer's disease prevents pre-plaque amyloid-
associated neuropathology. Neurobiol Dis 34:163-177.
McKercher, S.R., B.E. Torbett, K.L. Anderson, G.W. Henkel, D.J. Vestal, H. Baribault, M.
Klemsz, A.J. Feeney, G.E. Wu, C.J. Paige, and R.A. Maki. 1996. Targeted disruption of
the PU.1 gene results in multiple hematopoietic abnormalities. Embo J 15:5647-5658.
Mendel, I., A. Katz, N. Kozak, A. Ben-Nun, and M. Revel. 1998. Interleukin-6 functions in
autoimmune encephalomyelitis: a study in gene-targeted mice. European journal of
immunology 28:1727-1737.
Mogi, M., M. Harada, P. Riederer, H. Narabayashi, K. Fujita, and T. Nagatsu. 1994. Tumor
necrosis factor-alpha (TNF-alpha) increases both in the brain and in the cerebrospinal
fluid from parkinsonian patients. Neuroscience Letters 165:208-210.
Moller, K., F. Tofteng, T. Qvist, C. Sahl, S. Sonderkaer, and B.K. Pedersen. 2005. Cerebral
output of cytokines in patients with pneumococcal meningitis. Critical care medicine
33:979-983.
Moore, C.S., and S.J. Crocker. 2012. An alternate perspective on the roles of TIMPs and MMPs
in pathology. The American journal of pathology 180:12-16.
63
Moore, L., D. Fan, R. Basu, V. Kandalam, and Z. Kassiri. 2011. Tissue inhibitor of
metalloproteinases (TIMPs) in heart failure. Heart Fail Rev
Munder, M. 2009. Arginase: an emerging key player in the mammalian immune system. British
Journal of Pharmacology 158:638-651.
Munder, M., K. Eichmann, and M. Modolell. 1998. Alternative metabolic states in murine
macrophages reflected by the nitric oxide synthase/arginase balance: competitive
regulation by CD4+ T cells correlates with Th1/Th2 phenotype. Journal of Immunology
160:5347-5354.
Murray, P.J., and T.A. Wynn. 2011a. Obstacles and opportunities for understanding macrophage
polarization. Journal of leukocyte biology 89:557-563.
Murray, P.J., and T.A. Wynn. 2011b. Protective and pathogenic functions of macrophage
subsets. Nature reviews. Immunology 11:723-737.
Nair, M.G., Y. Du, J.G. Perrigoue, C. Zaph, J.J. Taylor, M. Goldschmidt, G.P. Swain, G.D.
Yancopoulos, D.M. Valenzuela, A. Murphy, M. Karow, S. Stevens, E.J. Pearce, and D.
Artis. 2009. Alternatively activated macrophage-derived RELM-{alpha} is a negative
regulator of type 2 inflammation in the lung. J Exp Med 206:937-952.
Nelms, K., A.D. Keegan, J. Zamorano, J.J. Ryan, and W.E. Paul. 1999. The IL-4 receptor:
signaling mechanisms and biologic functions. Annual review of immunology 17:701-738.
Nemeth, Z.H., S.J. Leibovich, E.A. Deitch, B. Sperlagh, L. Virag, E.S. Vizi, C. Szabo, and G.
Hasko. 2003. Adenosine stimulates CREB activation in macrophages via a p38 MAPK-
mediated mechanism. Biochem Biophys Res Commun 312:883-888.
Nemeth, Z.H., C.S. Lutz, B. Csoka, E.A. Deitch, S.J. Leibovich, W.C. Gause, M. Tone, P.
Pacher, E.S. Vizi, and G. Hasko. 2005. Adenosine augments IL-10 production by
macrophages through an A2B receptor-mediated posttranscriptional mechanism. J
Immunol 175:8260-8270.
Neumann, H., M.R. Kotter, and R.J. Franklin. 2009. Debris clearance by microglia: an essential
link between degeneration and regeneration. Brain 132:288-295.
Nikolaev, A., T. McLaughlin, D.D. O'Leary, and M. Tessier-Lavigne. 2009. APP binds DR6 to
trigger axon pruning and neuron death via distinct caspases. Nature 457:981-989.
Nissl, F. 1899. Ueber einige Beziehungen zwischen Nervenzellerkrankungen und gliosen
Erscheinungen bei verscheidenen Pschosen. Arch. Psychiatry 32:1-21.
Noel, W., G. Raes, G. Hassanzadeh Ghassabeh, P. De Baetselier, and A. Beschin. 2004.
Alternatively activated macrophages during parasite infections. Trends Parasitol 20:126-
133.
64
Novitskiy, S.V., S. Ryzhov, R. Zaynagetdinov, A.E. Goldstein, Y. Huang, O.Y. Tikhomirov,
M.R. Blackburn, I. Biaggioni, D.P. Carbone, I. Feoktistov, and M.M. Dikov. 2008.
Adenosine receptors in regulation of dendritic cell differentiation and function. Blood
112:1822-1831.
Olson, J.K., and S.D. Miller. 2004. Microglia initiate central nervous system innate and adaptive
immune responses through multiple TLRs. J Immunol 173:3916-3924.
Ostrand-Rosenberg, S., and P. Sinha. 2009. Myeloid-derived suppressor cells: linking
inflammation and cancer. Journal of Immunology 182:4499-4506.
Park, K.W., H.G. Lee, B.K. Jin, and Y.B. Lee. 2007. Interleukin-10 endogenously expressed in
microglia prevents lipopolysaccharide-induced neurodegeneration in the rat cerebral
cortex in vivo. Exp Mol Med 39:812-819.
Park, P.H., H. Huang, M.R. McMullen, K. Bryan, and L.E. Nagy. 2008. Activation of cyclic-
AMP response element binding protein contributes to adiponectin-stimulated interleukin-
10 expression in RAW 264.7 macrophages. J Leukoc Biol 83:1258-1266.
Pauleau, A.L., R. Rutschman, R. Lang, A. Pernis, S.S. Watowich, and P.J. Murray. 2004.
Enhancer-mediated control of macrophage-specific arginase I expression. Journal of
Immunology 172:7565-7573.
Pello, O.M., M. De Pizzol, M. Mirolo, L. Soucek, L. Zammataro, A. Amabile, A. Doni, M.
Nebuloni, L.B. Swigart, G.I. Evan, A. Mantovani, and M. Locati. 2012. Role of c-MYC
in alternative activation of human macrophages and tumor-associated macrophage
biology. Blood 119:411-421.
Penkowa, M., M. Giralt, N. Lago, J. Camats, J. Carrasco, J. Hernandez, A. Molinero, I.L.
Campbell, and J. Hidalgo. 2003. Astrocyte-targeted expression of IL-6 protects the CNS
against a focal brain injury. Exp Neurol 181:130-148.
Pinhal-Enfield, G., M. Ramanathan, G. Hasko, S.N. Vogel, A.L. Salzman, G.J. Boons, and S.J.
Leibovich. 2003. An angiogenic switch in macrophages involving synergy between Toll-
like receptors 2, 4, 7, and 9 and adenosine A(2A) receptors. Am J Pathol 163:711-721.
Polazzi, E., and B. Monti. 2010. Microglia and neuroprotection: from in vitro studies to
therapeutic applications. Prog Neurobiol 92:293-315.
Polosa, R., and M.R. Blackburn. 2009. Adenosine receptors as targets for therapeutic
intervention in asthma and chronic obstructive pulmonary disease. Trends in
pharmacological sciences 30:528-535.
65
Polumuri, S.K., V.Y. Toshchakov, and S.N. Vogel. 2007. Role of phosphatidylinositol-3 kinase
in transcriptional regulation of TLR-induced IL-12 and IL-10 by Fc gamma receptor
ligation in murine macrophages. J Immunol 179:236-246.
Qualls, J.E., G. Neale, A.M. Smith, M.S. Koo, A.A. DeFreitas, H. Zhang, G. Kaplan, S.S.
Watowich, and P.J. Murray. 2010. Arginine usage in mycobacteria-infected macrophages
depends on autocrine-paracrine cytokine signaling. Sci Signal 3:ra62.
Raes, G., L. Brys, B.K. Dahal, J. Brandt, J. Grooten, F. Brombacher, G. Vanham, W. Noel, P.
Bogaert, T. Boonefaes, A. Kindt, R. Van den Bergh, P.J. Leenen, P. De Baetselier, and
G.H. Ghassabeh. 2005. Macrophage galactose-type C-type lectins as novel markers for
alternatively activated macrophages elicited by parasitic infections and allergic airway
inflammation. Journal of leukocyte biology 77:321-327.
Raes, G., P. De Baetselier, W. Noel, A. Beschin, F. Brombacher, and G. Hassanzadeh Gh. 2002a.
Differential expression of FIZZ1 and Ym1 in alternatively versus classically activated
macrophages. Journal of leukocyte biology 71:597-602.
Raes, G., W. Noel, A. Beschin, L. Brys, P. de Baetselier, and G.H. Hassanzadeh. 2002b. FIZZ1
and Ym as tools to discriminate between differentially activated macrophages. Dev
Immunol 9:151-159.
Ransohoff, R.M., and A.E. Cardona. 2010. The myeloid cells of the central nervous system
parenchyma. Nature 468:253-262.
Ransohoff, R.M., and V.H. Perry. 2009. Microglial physiology: unique stimuli, specialized
responses. Annu Rev Immunol 27:119-145.
Ratthe, C., M. Pelletier, S. Chiasson, and D. Girard. 2007. Molecular mechanisms involved in
interleukin-4-induced human neutrophils: expression and regulation of suppressor of
cytokine signaling. Journal of leukocyte biology 81:1287-1296.
Rebola, N., A.P. Simoes, P.M. Canas, A.R. Tome, G.M. Andrade, C.E. Barry, P.M. Agostinho,
M.A. Lynch, and R.A. Cunha. 2011. Adenosine A(2A) receptors control
neuroinflammation and consequent hippocampal neuronal dysfunction. J Neurochem
117:100-111.
Rodriguez, P.C., and A.C. Ochoa. 2008. Arginine regulation by myeloid derived suppressor cells
and tolerance in cancer: mechanisms and therapeutic perspectives. Immunological
Reviews 222:180-191.
Ruffell, D., F. Mourkioti, A. Gambardella, P. Kirstetter, R.G. Lopez, N. Rosenthal, and C.
Nerlov. 2009. A CREB-C/EBPbeta cascade induces M2 macrophage-specific gene
66
expression and promotes muscle injury repair. Proceedings of the National Academy of
Sciences of the United States of America 106:17475-17480.
Ryzhov, S., A.E. Goldstein, A. Matafonov, D. Zeng, I. Biaggioni, and I. Feoktistov. 2004.
Adenosine-activated mast cells induce IgE synthesis by B lymphocytes: an A2B-mediated
process involving Th2 cytokines IL-4 and IL-13 with implications for asthma. J Immunol
172:7726-7733.
Ryzhov, S., S.V. Novitskiy, R. Zaynagetdinov, A.E. Goldstein, D.P. Carbone, I. Biaggioni, M.M.
Dikov, and I. Feoktistov. 2008a. Host A(2B) adenosine receptors promote carcinoma
growth. Neoplasia 10:987-995.
Ryzhov, S., R. Zaynagetdinov, A.E. Goldstein, S.V. Novitskiy, M.R. Blackburn, I. Biaggioni,
and I. Feoktistov. 2008b. Effect of A2B adenosine receptor gene ablation on adenosine-
dependent regulation of proinflammatory cytokines. J Pharmacol Exp Ther 324:694-700.
Sabat, R., G. Grutz, K. Warszawska, S. Kirsch, E. Witte, K. Wolk, and J. Geginat. 2010. Biology
of interleukin-10. Cytokine Growth Factor Rev 21:331-344.
Saegusa, K., S. Yotsumoto, S. Kato, and Y. Aramaki. 2007. Phosphatidylinositol 3-kinase-
mediated regulation of IL-10 and IL-12 production in macrophages stimulated with CpG
oligodeoxynucleotide. Mol Immunol 44:1323-1330.
Saijo, K., and C.K. Glass. 2011. Microglial cell origin and phenotypes in health and disease.
Nature reviews. Immunology 11:775-787.
Saraiva, M., and A. O'Garra. 2010. The regulation of IL-10 production by immune cells. Nat Rev
Immunol 10:170-181.
Saura, J., E. Angulo, A. Ejarque, V. Casado, J.M. Tusell, R. Moratalla, J.F. Chen, M.A.
Schwarzschild, C. Lluis, R. Franco, and J. Serratosa. 2005. Adenosine A2A receptor
stimulation potentiates nitric oxide release by activated microglia. J Neurochem 95:919-
929.
Schulte, G., and B.B. Fredholm. 2003a. The G(s)-coupled adenosine A(2B) receptor recruits
divergent pathways to regulate ERK1/2 and p38. Exp Cell Res 290:168-176.
Schulte, G., and B.B. Fredholm. 2003b. Signalling from adenosine receptors to mitogen-activated
protein kinases. Cellular Signalling 15:813-827.
Schulz, C., E. Gomez Perdiguero, L. Chorro, H. Szabo-Rogers, N. Cagnard, K. Kierdorf, M.
Prinz, B. Wu, S.E. Jacobsen, J.W. Pollard, J. Frampton, K.J. Liu, and F. Geissmann.
2012. A lineage of myeloid cells independent of Myb and hematopoietic stem cells.
Science 336:86-90.
67
Serada, S., M. Fujimoto, M. Mihara, N. Koike, Y. Ohsugi, S. Nomura, H. Yoshida, T.
Nishikawa, F. Terabe, T. Ohkawara, T. Takahashi, B. Ripley, A. Kimura, T. Kishimoto,
and T. Naka. 2008. IL-6 blockade inhibits the induction of myelin antigen-specific Th17
cells and Th1 cells in experimental autoimmune encephalomyelitis. Proceedings of the
National Academy of Sciences of the United States of America 105:9041-9046.
Shohami, E., R. Gallily, R. Mechoulam, R. Bass, and T. Ben-Hur. 1997. Cytokine production in
the brain following closed head injury: dexanabinol (HU-211) is a novel TNF-alpha
inhibitor and an effective neuroprotectant. Journal of Neuroimmunology 72:169-177.
Sica, A., and A. Mantovani. 2012. Macrophage plasticity and polarization: in vivo veritas. The
Journal of clinical investigation 122:787-795.
Silva, S.L., A.R. Vaz, M.J. Diogenes, N. van Rooijen, A.M. Sebastiao, A. Fernandes, R.F. Silva,
and D. Brites. 2012. Neuritic growth impairment and cell death by unconjugated bilirubin
is mediated by NO and glutamate, modulated by microglia, and prevented by
glycoursodeoxycholic acid and interleukin-10. Neuropharmacology 62:2397-2407.
Solenkova, N.V., V. Solodushko, M.V. Cohen, and J.M. Downey. 2006. Endogenous adenosine
protects preconditioned heart during early minutes of reperfusion by activating Akt. Am J
Physiol Heart Circ Physiol 290:H441-449.
Strle, K., J.H. Zhou, W.H. Shen, S.R. Broussard, R.W. Johnson, G.G. Freund, R. Dantzer, and
K.W. Kelley. 2001. Interleukin-10 in the brain. Crit Rev Immunol 21:427-449.
Stutz, A.M., L.A. Pickart, A. Trifilieff, T. Baumruker, E. Prieschl-Strassmayr, and M.
Woisetschlager. 2003. The Th2 cell cytokines IL-4 and IL-13 regulate found in
inflammatory zone 1/resistin-like molecule alpha gene expression by a STAT6 and
CCAAT/enhancer-binding protein-dependent mechanism. Journal of Immunology
170:1789-1796.
Sun, C.X., H. Zhong, A. Mohsenin, E. Morschl, J.L. Chunn, J.G. Molina, L. Belardinelli, D.
Zeng, and M.R. Blackburn. 2006. Role of A2B adenosine receptor signaling in
adenosine-dependent pulmonary inflammation and injury. J Clin Invest 116:2173-2182.
Suzuki, S., K. Tanaka, and N. Suzuki. 2009. Ambivalent aspects of interleukin-6 in cerebral
ischemia: inflammatory versus neurotrophic aspects. Journal of cerebral blood flow and
metabolism : official journal of the International Society of Cerebral Blood Flow and
Metabolism 29:464-479.
Swartz, K.R., F. Liu, D. Sewell, T. Schochet, I. Campbell, M. Sandor, and Z. Fabry. 2001.
Interleukin-6 promotes post-traumatic healing in the central nervous system. Brain
research 896:86-95.
68
Szabo, C., G.S. Scott, L. Virag, G. Egnaczyk, A.L. Salzman, T.P. Shanley, and G. Hasko. 1998.
Suppression of macrophage inflammatory protein (MIP)-1alpha production and collagen-
induced arthritis by adenosine receptor agonists. Br J Pharmacol 125:379-387.
Szanto, A., B.L. Balint, Z.S. Nagy, E. Barta, B. Dezso, A. Pap, L. Szeles, S. Poliska, M. Oros,
R.M. Evans, Y. Barak, J. Schwabe, and L. Nagy. 2010. STAT6 transcription factor is a
facilitator of the nuclear receptor PPARgamma-regulated gene expression in
macrophages and dendritic cells. Immunity 33:699-712.
Tarkowski, E., N. Andreasen, A. Tarkowski, and K. Blennow. 2003. Intrathecal inflammation
precedes development of Alzheimer's disease. J Neurol Neurosurg Psychiatry 74:1200-
1205.
Tasca, T., C.D. Bonan, G.A. Carli, A.M. Battastini, and J.J. Sarkis. 2003. Characterization of an
ecto-5'-nucleotidase (EC 3.1.3.5) activity in intact cells of Trichomonas vaginalis. Exp
Parasitol 105:167-173.
Tha, K.K., Y. Okuma, H. Miyazaki, T. Murayama, T. Uehara, R. Hatakeyama, Y. Hayashi, and
Y. Nomura. 2000. Changes in expressions of proinflammatory cytokines IL-1beta, TNF-
alpha and IL-6 in the brain of senescence accelerated mouse (SAM) P8. Brain research
885:25-31.
Thammavongsa, V., J.W. Kern, D.M. Missiakas, and O. Schneewind. 2009. Staphylococcus
aureus synthesizes adenosine to escape host immune responses. J Exp Med 206:2417-
2427.
Thiele, A., R. Kronstein, A. Wetzel, A. Gerth, K. Nieber, and S. Hauschildt. 2004. Regulation of
adenosine receptor subtypes during cultivation of human monocytes: role of receptors in
preventing lipopolysaccharide-triggered respiratory burst. Infect Immun 72:1349-1357.
Tsutsui, S., J. Schnermann, F. Noorbakhsh, S. Henry, V.W. Yong, B.W. Winston, K. Warren,
and C. Power. 2004. A1 adenosine receptor upregulation and activation attenuates
neuroinflammation and demyelination in a model of multiple sclerosis. J Neurosci
24:1521-1529.
Turovskaya, M.V., E.A. Turovsky, V.P. Zinchenko, S.G. Levin, and O.V. Godukhin. 2012.
Interleukin-10 modulates [Ca(2+)](i) response induced by repeated NMDA receptor
activation with brief hypoxia through inhibition of InsP(3)-sensitive internal stores in
hippocampal neurons. Neuroscience Letters
Tweedie, D., K. Sambamurti, and N.H. Greig. 2007. TNF-alpha inhibition as a treatment strategy
for neurodegenerative disorders: new drug candidates and targets. Curr Alzheimer Res
4:378-385.
69
van der Putten, C., E.A. Zuiderwijk-Sick, L. van Straalen, E.D. de Geus, L.A. Boven, I.
Kondova, A.P. IJzerman, and J.J. Bajramovic. 2009. Differential Expression of
Adenosine A(3) Receptors Controls Adenosine A(2A) Receptor-Mediated Inhibition of
TLR Responses in Microglia. Journal of Immunology 182:7603-7612.
Van Ginderachter, J.A., K. Movahedi, G. Hassanzadeh Ghassabeh, S. Meerschaut, A. Beschin,
G. Raes, and P. De Baetselier. 2006. Classical and alternative activation of mononuclear
phagocytes: picking the best of both worlds for tumor promotion. Immunobiology
211:487-501.
van Vliet, S.J., E. Saeland, and Y. van Kooyk. 2008. Sweet preferences of MGL: carbohydrate
specificity and function. Trends in immunology 29:83-90.
Wang, H., J. Brown, C.A. Garcia, Y. Tang, M.R. Benakanakere, T. Greenway, P. Alard, D.F.
Kinane, and M. Martin. 2011. The role of glycogen synthase kinase 3 in regulating IFN-
beta-mediated IL-10 production. J Immunol 186:675-684.
Yamasu, K., H. Onoe, G. Soma, H. Oshima, and D. Mizuno. 1989. Secretion of tumor necrosis
factor during fetal and neonatal development of the mouse: ontogenic inflammation. J
Biol Response Mod 8:644-655.
Ye, S.M., and R.W. Johnson. 1999. Increased interleukin-6 expression by microglia from brain
of aged mice. Journal of Neuroimmunology 93:139-148.
Zaynagetdinov, R., S. Ryzhov, A.E. Goldstein, H. Yin, S.V. Novitskiy, K. Goleniewska, V.V.
Polosukhin, D.C. Newcomb, D. Mitchell, E. Morschl, Y. Zhou, M.R. Blackburn, R.S.
Peebles, Jr., I. Biaggioni, and I. Feoktistov. 2010. Attenuation of chronic pulmonary
inflammation in A2B adenosine receptor knockout mice. American Journal of
Respiratory Cell and Molecular Biology 42:564-571.
Zezula, J., and M. Freissmuth. 2008. The A(2A)-adenosine receptor: a GPCR with unique
features? British Journal of Pharmacology 153 Suppl 1:S184-190.
Zhang, J.G., L. Hepburn, G. Cruz, R.A. Borman, and K.L. Clark. 2005. The role of adenosine
A2A and A2B receptors in the regulation of TNF-alpha production by human monocytes.
Biochemical Pharmacology 69:883-889.
Zhong, H., L. Belardinelli, T. Maa, I. Feoktistov, I. Biaggioni, and D. Zeng. 2004. A(2B)
adenosine receptors increase cytokine release by bronchial smooth muscle cells. Am J
Respir Cell Mol Biol 30:118-125.
Zhong, H., Y. Wu, L. Belardinelli, and D. Zeng. 2006. A2B adenosine receptors induce IL-19
from bronchial epithelial cells, resulting in TNF-alpha increase. Am J Respir Cell Mol
Biol 35:587-592.
70
Zhou, Z., X. Peng, R. Insolera, D.J. Fink, and M. Mata. 2009. Interleukin-10 provides direct
trophic support to neurons. Journal of neurochemistry 110:1617-1627.
71
8. List of publications:
This dissertation is based on the following publications:
Koscsó B, Csóka B, Selmeczy Z, Himer L, Pacher P, Virág L and Haskó G: Adenosine augments
IL-10 production by microglial cells through an A2B adenosine receptor-mediated process.
Journal of Immunol. 2012 Jan 1;188(1):445-53. IF: 5.745
Csóka B, Selmeczy Z, Koscsó B, Németh ZH, Pacher P, Murray PJ, Kepka-Lenhart D, Morris
SM Jr, Gause WC, Leibovich SJ and Haskó G: Adenosine promotes alternative macrophage
activation via A2A and A2B adenosine receptors. FASEB Journal. 2012 Jan; 26(1):376-86. IF:
6.515
Other publications:
Csóka B, Németh ZH, Selmeczy Zs, Koscsó B, Pacher P, Vizi ES, Deitch EA and Haskó G: Role
of A2A adenosine receptors in regulation of opsonized E. coli induced macrophage function.
Purinergic Signalling. 2007. 3(4):447-452.
Himer L, Csóka B, Selmeczy Z, Koscsó B, Pócza T, Pacher P, Németh ZH, Deitch EA, Vizi ES,
Cronstein BN, Haskó G: Adenosine A2A receptor activation protects CD4+ T lymphocytes
against activation-induced cell death. FASEB Journal. 2010 Aug;24(8):2631-40. IF: 6.515
Csóka B, Németh ZH, Rosenberger P, Eltzschig HK, Spolarics Z, Pacher P, Selmeczy Z, Koscsó
B, Himer L, Vizi ES, Blackburn MR, Deitch EA, Haskó G: A2B adenosine receptors protect
against sepsis-induced mortality by dampening excessive inflammation. Journal of Immunology.
2010 Jul 1;185(1):542-50. IF: 5.745
Koscsó B, Csóka B, Pacher P and Haskó G: Investigational A3 adenosine receptor targeting
agents. Expert Opinion on Investigational Drugs. 2011 Jun; 20(6):757-68. IF: 4.337
Haskó G, Csóka B, Koscsó B, Chandra R, Pacher P, Thompson LF, Deitch EA, Spolarics Z,
Virág L, Gergely P, Rolandelli RH and Németh ZH: Ecto-5'-nucleotidase (CD73) decreases
mortality and organ injury in sepsis. Journal of Immunology. 2011 Oct 15;187(8):4256-67. IF:
5.745
IF: 34.602
72
9. Acknowledgements
I am most grateful to many people who have helped me to complete this dissertation. First
of all, I would like to thank my mentor, Dr. György Haskó for giving me the opportunity to work
with him and learn from him. His guidance was essential for me to start developing an analytical
mentality indispensable for research. His helpful advice on everything from the methodological
design to the writing process was crucial during the course of the studies.
I am particularly obliged to Dr. Balázs Csóka, my coworker, for his conscientious and
untiring work in the lab and for precious discussions during the preparation of publications
documented in this dissertation.
I also wish to thank all the people I worked with on this project including Julianna Benkő,
Dr Zsolt Selmeczy, Dr Leonóra Himer, and Dr Zoltán Németh.
Finally, I am thankful to my family and my friends for their never-ending support.
73
10. Összefoglalás
A patogénhez asszociált molekuláris mintázatok által aktivált mikrogliák gyulladáskeltő
citokineket termelnek, például tumor nekrózis faktor (TNF)-α, interleukin (IL)-6 és IL-12, valamint
gyulladáscsökkentő citokineket szekretálnak, amelyek közül a legfontosabb az IL-10. Az adenozin egy
endogén purin nukleozid, amely négy, G proteinhez kapcsolt, sejtfelszíni receptorhoz (A1, A2A, A2B és
A3) kötődve fejti ki hatásait. Bár az adenozin receptorok TNF-α termelést csökkentő hatását már leírták
mikrogliákban, az IL-10 termelésre kifejtett hatását azonban ezidáig nem vizsgálták. Eredményeink
alapján az adenozin növeli a Toll-szerű receptorok (TLR) ligandumaival aktivált mikrogliák IL-10
termelését míg a gyulladáskeltő citokinek termelését gátolja. Farmakológiai kísérleteink igazolták, hogy
az adenozin IL-10 termelésre kifejtett hatása az A2B receptoron keresztül történik. A hatás mechanizmusát
vizsgálva kimutattuk, hogy az adenozin kezelés növeli az IL-10 mRNS mennyiségét egy cAMP
reszponzív elem kötő protein (CREB) transzkipciós faktortól függő folyamat során. A CREB szerepét
kromatin immunprecipitáció es RNS interferencia segítségével is megerősítettük. A továbbiakban
kimutattuk, hogy az adenozin kezelés a p38 mitogén-aktivált protein-kinázt és a foszfatidil inozitol 3-
kinázt (PI3K) is aktiválja. Az adenozinnak a klasszikus módon, TH1 típusú citokinek jelenlétében, aktivált
makrofágok gyulladáskeltő funkcióira kifejtett gátló hatása jól ismert az irodalomban. A makrofágok
azonban TH2 típusú citokinek (IL-4 és IL-13) jelenlétében a klasszikustól jelentősen eltérő, úgy nevezett
alternatívan aktivált fenotípust mutatnak. Az adenozin alternatívan aktivált makrofágokra kifejtett hatásai
eddig nem ismertek. Eredményeink során kimutattuk, hogy IL-4 illetve IL-13 által aktivált
makrofágokban adenozin kezelés hatására számos alternatív aktivációs marker kifejeződése nő, úgy mint
argináz-1, mátrix metalloproteináz szöveti inhibitor-1 (tissue inhibitor of matrix metalloproteinase-1,
TIMP-1) és makrofág galaktóz-típusú C-típusú lektin (macrophage galactose-type C-type lectin-1, mgl-1).
Mivel ezt a hatást teljes mértékben kiküszöbölte az A2B receptor hiánya illetve farmakológiai gátlása,
konklúziónk szerint az A2B receptor felelős az adenozin alternatív makrofág aktivációra kifejtett hatásáért.
Kísérleteink során kimutattuk, hogy az ismert, alternatív aktivációban szerepet játszó transzkipciós
faktorok közül egyedül a C/EBPβ (CCAAT-enhancer-binding protein ) volt nélkülözhetetlen az
adenozin hatásához, míg a CREB illetve STAT6 (signal transducer and activator of transcription 6) nem
játszott szerepet a folyamatban. Összefoglalva, eredményeink alapján az A2B adenozin receptor
stimulációja növeli a klasszikus módon aktivált mikrogliák IL-10 termelését. Az A2B adenozin receptor
stimulációja az IL-4 illetve IL-13 által indukált alternatív aktivációs markerek kifejeződését szintén
megnöveli makrofágokban.