![Page 1: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/1.jpg)
Fish cell lines and their potential uses in ecotoxicology: from cytotoxicity studies and mixture assessment to a co-culture
model and mechanistic analyses
Fabienne Roux
Master in Ecotoxicology
2014-2015
Department of Biological and Environmental Sciences
University of Gothenburg
Examiner: Thomas Backhaus
Supervisor: Joachim Sturve
![Page 2: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/2.jpg)
![Page 3: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/3.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
1
I. CONTENT
I. CONTENT 1
II. ABSTRACT 2
III. LIST OF ABBREVIATIONS 3
1 INTRODUCTION 4 1.1 TESTING AND ALTERNATIVE METHODS 4 1.2 PRIMARY CULTURES VS. CELL LINES 5 1.3 FISH CELL LINES 6 1.4 BIOMARKERS 7 1.5 CHALLENGES AND POSSIBLE SOLUTIONS 10 1.5 THESIS AIMS 12 2 MATERIALS AND METHODS 13 2.1 CHEMICALS AND CONSUMABLES 13 2.2 TEST SYSTEM 13 2.4 METHODS 16 3 RESULTS 21 3.1 MIXTURE TOXICITY ASSESSMENT (NICE) – CYTOTOXICITY 21 3.2 MECHANISTIC ANALYSES – SINGLE CELL AND CO-CULTURE SYSTEMS 25 4 DISCUSSION 31 4.1 MIXTURE TOXICITY ASSESSMENT (NICE) – CYTOTOXICITY 31 4.2 MECHANISTIC ANALYSES – SINGLE CELL AND CO-CULTURE SYSTEMS 33 5 CONCLUSION 38 6 ACKNOWLEDGEMENTS 39 7 REFERENCES 40
![Page 4: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/4.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
2
II. ABSTRACT
The environmental risk assessment of chemicals is mostly based on in vivo single
compound experiments. However, due to the increasingly high amount of chemicals,
metabolites and mixtures to be tested, optimization of this assessment is required. Interest
in in vitro methods has been growing greatly in the recent years for economical, practical
and ethical reasons, and the use of cell lines as alternatives to in vivo testing is being
seriously considered. This thesis focused on two different aspects of methods using fish
cell lines. The first was the use of quick and simple cytotoxicity assays as screening
method for assessment of mixture toxicity in the specific case of Swedish coastal waters.
Three compounds, copper (II) ions, metoprolol and tributylphosphate, were tested on
RTgill-W1, singularly and in combination based on their EC50 and environmental ratios.
Both the Concentration Addition and the Independent Action models were used to predict
mixture toxicity. The predictions were in a factor of 2 compared with the observed
EC50s. The assay itself showed variability but could be optimized for further mixture
testing. The second, more complex assay consisted of a co-culture model as an attempt to
improve basic cell line assays. Two different cell lines (RTgill-W1 and RTL-W1)
separated by a permeable insert mimic the direct exposure of the gill epithelium to
environmental toxicants and indirect exposure of the liver through uptake and
metabolism. The effects on gene expression level, EROD activity and glutathione content
of benzylbutylphthalate and bisphenol A were analyzed. The obtained results indicate
indirect exposure of RTL-W1. The properties of this co-culture model are promising but
need to be analyzed more in depth before this model can be used in toxicity tests. The
characterization of relevant biomarkers and pathways in these cell lines is needed, in
particular for endocrine disruption.
Keywords: cell lines, in vitro alternatives, RTgill-W1, RTL-W1, NICE, cytotoxicity,
mixture, concentration addition, independent action, co-culture, gene expression,
biomarkers, endocrine disruption
![Page 5: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/5.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
3
III. LIST OF ABBREVIATIONS
AB
BBP
BNF
BPA
CFDA-AM
Cu
CYP1A
CYP3A
Dio2
DMSO
EC50
EDC
EDTA
ER
ERα
ERRγ
EROD
FBS
GPx
GSH
GSSG
GST π
L-15
L-15/ex
Met
mRNA
Nrf-2
PBS
PEPCK
PPARγ
PS
REACH
RT-qPCR
SE
SULT
TBP
TER
tGSH
TTR
TRα/β
UGT
3R
AlamarBlue
benzylbutylphthalate
β-naphthoflavone
bisphenol A
5-carboxyfluorescein diacetate acetoxymethyl ester
copper (II)
cytochrome P450 1A
cytochrome P450 3A
deiodinase 2
dimethyl sulfoxide
effective concentration 50
endocrine disrupting chemical/compound
ethylenediaminetetraacetic acid
7-ethoxyresorufin
estrogen receptor α
estrogen related receptor γ
7-ethoxyresorufin-O-deethylase
fetal bovine serum
glutathione peroxidase
glutathione
oxidized glutathione
glutathione-S-transferase π
Leibovitz's L-15 medium
Leibovitz's L-15 medium/exposure
metoprolol
messenger ribonucleic acid
NF-E2-related factor 2
phosphate buffered saline
phosphoenolpyruvate carboxykinase
peroxisome proliferator-activated receptor γ
penicillin streptomycin
Registration, Evaluation and Authorisation of Chemicals
reverse transcriptase - quantitative polymerase chain reaction
standard error
sulfonyl transferase
tributylphosphate
transepithelial electric resistance
total glutathione
transthyretin
thyroid receptor α/β
UDP-glucuronosyltransferase
reduce, refine, replace
![Page 6: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/6.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
4
1 Introduction
Our society relies more and more on a
wide variety of chemicals present in
every action of our daily life. For
years, these chemicals have been put
on the market with an only limited
knowledge of their hazard to human
health and to the environment.
However, due to the very high amount
of chemicals produced and to their
ever increasing presence in the
environment, it has become of major
importance to determine the effects of
these compounds. In Europe, the
implementation of REACH in 2006,
the European legislation for the
Registration, Evaluation and
Authorization of Chemicals, is
supposed to increase the knowledge
about these chemicals by improving their risk assessment. From June to December 2008,
about 150 000 compounds were pre-registered [1] to be tested and evaluated. Even
though all of these chemicals are not expected to be registered and put on the market, the
amounts are still substantial.
Most of these chemicals, once entered into the environment, end up in the aquatic
compartments, through waste water treatment plant (WWTP) and industrial effluents,
agricultural run-offs, accidental spills etc. (see Figure 1). This forms unpredictable
cocktails of contaminants with effects that are impossible to grasp today. Development of
methods to assess mixture toxicity is greatly required but challenging due to the
complexity of the situation, meaning that regulatory testing does not allow proper
consideration of this issue. Projects such as NICE (Novel Instruments for effect-base
assessment of chemical pollution in Coastal Ecosystems, www.nice.gu.se) aim to develop
new methods to specifically assess mixture toxicity1.
1.1 Testing and alternative methods
Traditional toxicity testing is mostly based on in vivo testing of single compounds on
three aquatic species representing different trophic levels: algae, daphnia and fish.
REACH would lead to an infinite amount of work to test all chemicals as is required, not
even taking into account biotransformation or degradation products, as well as the
endless amount of possible mixtures. In vivo testing is extremely time-consuming and
costly, requiring much maintenance and a high number of animals, which is ethically
1 NICE is composed of exposure assessment of the Swedish west coast and toxicity testing in different
systems (fish, invertebrates, microbes), using traditional approaches with dose-response curves but also
omics and bioinformatics. A legal contribution to assess actual legislation and to implement environmental
quality standards and monitoring approaches taking into account mixture exposure is included.
Figure 1 Multiple stressor exposure of the aquatic
environment. Toxicants enter the aquatic
environment directly or indirectly, for example
through industrial and WWTP effluents, leachates
from landfills, agricultural run-offs, atmospheric
deposition, boating activities, accidental spills etc…
![Page 7: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/7.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
5
debated. Therefore REACH supports development of alternative methods. The EURL-
ECVAM, the European Union Reference Laboratory for alternatives to animal testing,
former European Center for Validation of Alternative Methods, is actively working on
their development, according to the 3R strategy, Reduce, Refine, Replace, concept which
was coined by Russel and Burch in 1959 [2].
An important alternative to in vivo methods are in vitro methods, literally meaning “in
glass”. Instead of living whole organisms, subsets of these are used for the experiments,
such as organs and tissues, primary cell cultures and cell lines. The justification behind
this comes from the fact that the first interaction of a toxicant with an organism happens
at the cellular level. The changes provoked in cells due to this interaction can then
possibly translate to higher levels of organization, finally impacting the whole organism
[3]. Many in vitro models have already been validated by the OECD (Organisation for
Economic Co-Operation and Development) for regulatory purposes as alternatives to in
vivo testing in the case of human health studies2. The use of in silico methods such as
QSARs and toxicokinetic models is also recognized for its provision of important
information, adding insights into the mechanistic dimension of chemical interaction and
allowing optimization of toxicity testing.
1.2 Primary cultures vs. cell lines
Primary cultures and cell lines are major
components of in vitro methods. Primary
cultures are cells, tissues or organs directly
obtained from the organism and maintained in
laboratory conditions for a certain number of
days (Figure 2). If these cells can be kept alive
through passaging, they become cell lines,
which in some cases can be maintained
indefinitely [3]. The use of these cell lines has
many advantages. It avoids the testing of
contaminants on living animals or even the
regular sampling of cells for primary cultures
since, if immortalized, they constitute an infinite
supply. Their maintenance is less demanding since the only requirements are cell medium
and an incubator at the right temperature and CO2 concentration (which is even
unnecessary in the case of piscine cell lines). The costs in money and time are thus
greatly diminished, and the testing in itself uses very limited amounts of the test
chemicals and creates little toxic waste (compared to, for example, a flow-through
aquarium system). Results present little variability since the cell lines are relatively
homogeneous and used in a very controlled environment, the complex interactions
happening in a whole organism being avoided [3-5]. They are also a very interesting
alternative if the species considered cannot be used for in vivo experiments, eg if it cannot
be kept in laboratory conditions; or to test and compare the sensitivities of many different
species on a wide scale when exposed in the exact same way [5].
2 http://www.oecd-ilibrary.org/environment/oecd-guidelines-for-the-testing-of-chemicals-section-4-health-
effects_20745788 (May 2015).
Figure 2 Primary culture. Isolation of
hepatocytes from a rainbow trout. Picture
taken by Fabienne Roux.
![Page 8: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/8.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
6
However, these strengths of cell lines are also their major limitation. Indeed, the system
being extremely simplified, the relevance of results obtained in vitro can be questioned.
Cells are grown in an artificial environment, often in monolayers and thus lacking their
normal 3D disposition. It is mostly only one cell type that is considered, thus all
interactions between different cell types, as would normally take place in any organism,
are lost. Immortalization often requires them to be isolated from cancerous tissue, or to
treat them with UV light and viruses [6], knowing that the behavior of these cells could
therefore be modified compared to cells in the normal tissue. Generally, cell lines are also
much less sensitive than whole organisms, which is a major drawback to their use as
alternatives to in vivo testing. Importantly, their differential status is low and they tend to
lose capacities (eg expression of certain receptors, metabolic enzymes, etc.) over time.
An in depth characterization is therefore necessary if they are to be used for mechanistic
studies.
One way to circumvent these problems is to use freshly isolated primary cultures. These
are more differentiated, contain different types of cells and are thus thought to respond
more similarly to a living animal, while at the same time reducing the amount of work
and animals required for in vivo testing. However, these preparations are quite
complicated and due to their increased complexity level compared to cell lines, the results
tend to show higher variability. They also require the organism of interest to be available,
maintainable in laboratory conditions and of sufficient size to allow primary culture
isolation [5].
1.3 Fish cell lines
In the context of aquatic ecotoxicology, fish are the most diverse group of vertebrates, as
they account for roughly 33 000 species3 distributed in all aquatic niches [5]. It is the
dominant vertebrate species for the regulatory evaluation of ecotoxicity [3], in particular
for the Fish Acute Lethality Test (OECD), and is granted the same legal protection as
mammals when it comes to laboratory testing. Interestingly, only two alternative methods
to in vivo testing have been validated up to date in this field: the Threshold Approach for
Acute Fish Toxicity Testing, using a tiered approach to reduce the number of fish used,
and the Fish Embryo Acute Toxicity Test. The development of methods using cell lines
are ongoing but have not been validated yet. This is in particular due to the lesser
sensitivity of these test systems [7].
The first interest in fish cell lines was mostly driven by fisheries and their economic
interest in fish viruses, but by the 1980s these cell lines started to be used for
toxicological studies as well [4, 8]. Today, more than 280 cell lines have been
established, 43 being commercialized [7].
Fish cell lines are considered as being better representatives for fish than the more
commonly used mammalian cell lines, since they express specific enzymes and proteins
and can be exposed at more relevant temperatures. They do not require specific
incubators supplemented with carbon dioxide and can be kept for extended periods at
4°C, avoiding unnecessary freezing and thawing steps. Interestingly, they also tend to
3 According to FishBase, http://www.fishbase.se/search.php, June 2015.
![Page 9: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/9.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
7
immortalize spontaneously, which means that they do not require to be taken from
cancerous tissue or manipulated after isolation [4, 5]. This seems to come from a
relatively high telomerase expression in fish tissue [9].
Fish cell lines are therefore extremely relevant and economically important when it
comes to fish research, in ecotoxicology or more general fish health studies. They are
already used to assess mixture toxicity of chemicals such as PAHs, pharmaceuticals and
personal care products [10-13], but also WWTP effluent samples [14]. Moreover, they
might even be interesting to use instead of mammalian cell lines for general toxicity
studies as fish cell lines are easier to maintain and handle than mammalian cell lines [4]
and as cytotoxicity results prove to be similar. The basal cytotoxicity concept coined by
Ekwall in 1983 [15], which states that acute death of a cell occurs through interference of
toxicants with its fundamental functions in the majority of cases, irrespective of the cell
type, has proven very efficient [16].
1.4 Biomarkers
Interest in fish cell lines is not limited to general toxicity. More in-depth mechanistic
analyses using biochemical assays are common if the pathway considered has been
shown to be functioning in the cell line of interest. The development of biomarkers is for
example an important field. In ecotoxicology, biomarkers are biochemical, physiological
or histological markers such as metabolites, enzymes etc. whose presence can be related
to exposure and often effect of xenobiotics [17].
General pathways which are typically considered are oxidative stress and metabolism.
More specific pathways are also analyzed depending on the type of chemicals that are
considered. Endocrine disrupting compounds (which will be used as model compounds in
one part of this thesis), by definition exogenous compounds with the potential to disturb
any hormonal regulation and the normal endocrine system, are of importance today due
to their widespread presence and potential effects at very low concentrations. They have
been shown to not only interact with the estrogen and androgen receptors (ER and/or AR)
but also with different hormone and nuclear receptors (thyroid, glucocorticoid and
estrogen-related receptors TR, GR and ERR), xenosensors (pregnane X, constitutive
androstane and aryl hydrocarbon receptors PXR, CAR and AhR) and peroxisome
proliferator-activated receptors (PPARs) [18, 19]. Markers related to these systems could
be interesting biomarkers. The pathways considered in this thesis are introduced below.
![Page 10: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/10.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
8
1.4.1 Oxidative stress
Oxidative stress (Figure 3) is an
imbalance between the production
of reactive oxygen species (ROS)
and antioxidant defenses. One major
antioxidant molecule is glutathione
(GSH), as it serves as reducing
agent by being oxidized to GSSG.
For example, glutathione peroxidase
(GPx) can catalyze its oxidation to
reduce hydrogen peroxide, a
byproduct of oxidative stress. GSSG
can then be recycled and returned to
the antioxidant pool through its
reduction by glutathione reductase
(GR). Glutathione synthetase (GS)
and glutamate-cysteine ligase
(GCL) are both involved in de novo
synthesis of GSH. Many of the genes
for oxidative stress, but also for phase II metabolism, are controlled by the transcription
factor Nrf-2. Total glutathione, GSSG:GSH ratio and the analysis of the gene expression,
amount and activity of the fore-mentioned proteins are all biomarkers for oxidative stress.
1.4.2 Xenobiotic metabolism
The metabolism of xenobiotics
is divided in different phases
(Figure 4). In phase I, the
xenobiotic is oxidized, reduced
or hydrolyzed to increase its
reactivity and hydrophilicity.
The enzymes from the CYP
superfamily are mainly
responsible for phase I
oxidative metabolism. CYP1A
is primarily responsible for the
metabolism of PAHs, dioxins
and PCBs and is induced by the
AhR. Its activity is a major
biomarker in the field of
ecotoxicology. CYP3A is the
most versatile CYP enzyme and
is responsible for the
metabolism of several types of
chemicals, such as
pharmaceuticals but also steroid hormones. Phase II consists of the conjugation of
Figure 3 Oxidative stress. A major constituent of the
antioxidant defense is GSH. Used as reduction unit by
GPx, oxidized glutathione, GSSG, is recycled by GR to
return to cellular pool of GSH. GS and GCL are
involved in de novo synthesis of GSH. Diagram by
Fabienne Roux.
Figure 4 The 3 phases of metabolism. Phase I is an activation
phase, allowing conjugation of hydrophilic molecules or groups to
the activated xenobiotic during phase II. The compound is
excreted during phase III. The expression of CYP1A, a major
phase I metabolic enzyme, is under transcriptional control of the
AhR receptor. Diagram by Fabienne Roux.
![Page 11: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/11.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
9
hydrophilic molecules to the xenobiotic to facilitate its excretion, such as glutathione
(GSH), sulfonic acid or glucuronic acid. The enzymes responsible for this are
glutathione-S-transferases (GST), sulfotransferases (SULT) and UDP-
glucuronosyltransferases (UGT). Finally, in phase III, the metabolized compound is
pumped out of the cells. Metabolism occurs mainly in the liver but has also been
observed in other organs such as the gills, intestine or kidneys [20].
1.4.3 Sugar metabolism
Glucocorticoids interact with the
glucocorticoid receptor (GR) in
response to physical and
emotional stresses, inducing
gluconeogenesis and oxidation of
fatty acids [18] (see Figure 5). A
key enzyme in hepatic
gluconeogenesis is the
phosphoenolpyruvate
carboxykinase (PEPCK) as it
controls its rate-limiting step
[21]. The estrogen-related
receptors (ERR), targets of
bisphenol A, have been shown to
regulate PEPCK [21, 22].
1.4.4 Thyroid system
The thyroid hormone (TH) plays an
important role in vertebrate
development, growth and reproduction
[23]. In fish, T4, the inactive form, is
secreted by the thyroid gland and then
transported to peripheral tissues, mostly
bound to transport proteins such as
transthyretin (TTR) [24], where it can be
activated to T3, its active form, which
can bind to the thyroid receptor (TR)
(Figure 6). This activation is performed
by iodothyronine deiodinases. In fish,
only two deiodinases can perform this,
type I and type II. T3 can be deactivated
by type I and type III deiodinases and by
UGT, an important phase II metabolic
enzyme. Thyroid disruption has been
observed at all levels in fish and fish
embryos when exposed to phthalates and
BPA [25-28].
Figure 6 The thyroid hormone pathway. The TH is
synthesized by the thyroid gland as T4, the inactive
form, through TSH stimulation. T4 is then activated
to T3, the hormone form which can bind to the TR, in
peripheral tissues such as the liver. Dio2 is enzyme
responsible for this activation in the liver. Diagram
by Fabienne Roux.
Figure 5 The glucocorticoid receptor pathway.
Glucocorticoids interact with the GR to induce transcription of
genes related to gluconeogenesis or oxidation of fatty acids.
PEPCK is under transcriptional control of the GR, but has also
been shown to be regulated by ERRγ. Diagram by Fabienne
Roux.
![Page 12: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/12.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
10
1.5 Challenges and possible solutions
The major challenge when it comes to in vitro methods is extrapolation. Indeed, results
obtained at the cellular level might not translate to any effect at the organism level, since
the level of complexity is much higher and compensation processes can occur [29]. In the
case of ecotoxicology, where extrapolation to the whole environment is required, this
challenge becomes very relevant.
The fact that cell lines prove to be much less sensitive to toxicants than whole organisms
has been shown to be due to a number of factors. The bioavailability of compounds in a
test system can be significantly reduced in the case of lipophilic (binding to the plastic,
serum proteins, etc.) and volatile compounds (evaporation), leading to overestimation of
exposure and thus underestimation of toxicity [3, 30]. Using serum free medium and
accounting for the bioavailable fraction are efficient improvements [3]. The dosing
procedure is also very important. Moreover, when toxicity is not only triggered by basal
cytotoxicity but by a specific pathway or at a specific target site, the test system must be
chosen accordingly [3, 8]. By keeping these limitations in mind, the sensitivity of the
assay can be greatly improved. Tanneberger et al [8] showed that by taking these factors
into account, it is possible to predict in vivo fish acute toxicity for up to 73% of the 35
organic chemicals tested on RTgill-W1 with less than a 5-fold difference, which is very
promising and supports the idea that in vitro cytotoxicity assays could eventually replace
the Fish Acute Lethality Test [7]. Unfortunately, when it comes to specific pathways,
better characterization of cell lines is required, especially since their differentiation status
is low. It is often not known if a cell line possesses the pathway of interest at all, or if it is
functioning. The use of recombinant cell lines is of true interest when it comes to the
study of mechanisms, but has the limitation that it is an artificial system.
Other attempts to render in vitro systems more realistic have been for example using 3D
cell structures such as hepatocyte spheroids to take into account 3D cell interactions. [31]
suggest indeed that rainbow trout hepatocyte spheroids retain a high biochemical,
morphological and functional status and that they could prove to be more realistic models
for toxicity testing than the traditional 2D monolayers.
Additional promising approaches are the co-culture
methods. In these methods, different cell types are grown
together [32], to account for their direct/indirect interactions.
This can be performed by growing the cell lines together,
but also on permeable inserts to keep them separated (see
Figure 7), which can be used to mimic for example uptake
of a toxicant and subsequent exposure of internal organs.
The in vitro epithelium can be exposed to two different
media on the basolateral and apical side, representing the
natural conditions it is usually exposed to. Full culture
medium supplemented with serum can be used to mimic the
physiological conditions on the basolateral side, whereas
more simple and serum free media, sometimes even
environmental samples, can be added on the apical side. Figure 7 Transwell inserts
from Greiner Bio-one.
Image from http://www.
greinerbioone.com/nl/belgiu
m/articles/news/42/ (May
2015)
![Page 13: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/13.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
11
This system should allow in vitro analysis of physiological barrier properties, such as ion
flow but also uptake, metabolism and excretion of toxicants, with their effects on the
second cell type.
The assembly of such in vitro epithelia has been successfully performed with primary
cultures of gill epithelium, which can be exposed to water on the apical side (reviewed in
[33]). The use of cell lines has also been considered. The capacity of RTgill-W1 to form
tight monolayers has been assessed by [34], who reported the presence of functional tight
junctions, suggesting that this cell line could be used to test physiological properties of
gills. However, they noted a few important drawbacks needing more investigation, such
as the low transepithelial resistance (TER), the lack of detection of the tight junction
proteins on Western Blot and the low expression of certain key epithelial proteins.
Drieschner [35] evaluated an intestinal barrier model composed of a rainbow trout
intestinal cell line, RTgutGC. Indications of the presence of tight junction proteins were
found and even though no differentiation of the cells was observed, the results are
promising and further research could lead to the development of the first piscine cell line
intestinal barrier model. The established culture protocol was also used by Catinot [36] to
analyze a co-culture model using RTL-W1 underneath the inserts. These studies indicate
a promising potential of these insert methods and encourage their further evaluation.
![Page 14: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/14.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
12
1.5 Thesis aims
The general aim of this thesis was to assess different uses of in vitro fish cell systems in
ecotoxicology, and was divided in two parts. During the first part, the use of RTgill-W1
for the screening of single compounds and mixture cytotoxicity was applied in the
context of the NICE project. The 3 chosen compounds were copper ions, metoprolol and
tributylphosphate (Figure 8), based on the results of an environmental exposure
assessment of the Swedish West Coast.
The aim of this first part was to assess whether this strategy was suitable for the analysis
of the toxicity of each compound and of mixtures, and thus whether it could be an
interesting tool to use for mixture assessment.
During the second part, a co-culture system of a gill cell line, RTgill-W1, and a liver cell
line, RTL-W1, was tested to analyze its use as tool for in depth mechanistic studies4
based on specific biomarker responses. The model compounds chosen were 2 endocrine
disrupting chemicals (EDCs), benzylbutylphthalate (BBP) and bisphenol A (BPA), due to
their high ecological relevance. The aim of this second part was to analyze the properties
of this system and its suitability for toxicity testing, in particular in the case of EDCs.
4 V3R application, Joachim Sturve.
Cu2+
Figure 8 The three compounds chosen for the mixture toxicity assessment on RTgill-W1 according to the
chemical monitoring on the Swedish west coast (NICE): from left to right, copper ions, metoprolol and
Tributylphosphate.
![Page 15: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/15.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
13
2 Materials and methods
2.1 Chemicals and consumables
Acetonitrile, AlamarBlue (AB), benzylbutylphthalate (BBP), betanaphthoflavone (BNF),
bisphenol A (BPA), 5-carboxyfluorescein diacetate acetoxymethyl ester (CFDA-AM),
copper sulfate (CuSO4), dimethyl sulfoxide (DMSO), 5,5'-dithio-bis-(2-nitrobenzoic
acid) (DTNB), 7-ethoxyresorufin (ER), ethylenediaminetetraacetic acid (EDTA),
fluorescamine, glutathione (GSH), glutathione reductase (GR), methanol, metoprolol
(MET), nicotinamide adenine dinucleotide phosphate (NADPH), 5-sulfosalicylic acid (5-
SSA), tributyl phosphate (TBP) were all purchased from Sigma-Aldrich (Stockholm,
Sweden). Fetal bovine serum (FBS), Leibovitz's L-15 medium (L-15), penicillin
streptomycin (PS) and trypsin were purchased from Gibco (Stockholm, Sweden). 6-well
plates Cellstar® and 6-well inserts ThinCerts TM were purchased from Greiner Bio-One
(Stockholm, Sweden). 48-well plates were from VWR (Stockholm, Sweden). 6-well
plates, 96-well plates and the culture flasks for RTgill-W1 were from Sarstedt
(Helsinborg, Sweden). Culture flasks for RTL-W1 were from Techno Plastic Products
AG (Trasadingen, Switzerland). RNeasy® Plus Minikit and QIAshredder were purchased
from Qiagen (Sollentuna, Sweden). Experion, iScript cDNA synthesis and SSOAdvanced
TM Universal SYBR® Green Supermix were from BioRad (Sundbyberg, Sweden).
Stock solutions of the used chemicals were prepared and stored as follows. In sterile
MilliQ water, 5 mg/mL Cu2+ (4°C) and 10 mM metoprolol (4°C). In DMSO, 400 mg/mL
TBP (4°C), 10 mM BNF (-20°C), 10 mM BBP (freshly prepared), 1 M BPA (freshly
prepared).
2.2 Test system
2.2.1 Rainbow trout as a model
Rainbow trout (Oncorhynchus mykiss) is the most commonly studied coldwater species
[37]. Easily farmed and maintained in laboratory conditions, it is a useful model and a
standard species for toxicity testing. It is considered as one of the most sensitive species
when it comes to acute toxicity (OECD5). One major advantage of the rainbow trout is
the great diversity of cell lines that have been established from this organism [5, 35]
(Figure 9). This gives the possibility to study a variety of endpoints using a combination
of different cell lines. The improvement of this concept could lead to the creation and use
of a “virtual fish” in ecotoxicology [35]. During this thesis, two different cell lines from
rainbow trout were used: RTgill-W1 for the gill, RTL-W1 for the liver.
5 https://books.google.se/books?id=I-PvBQAAQBAJ&lpg=PA72&ots=5WbCeZKn1W&dq=OECD%20
rainbow% 20trout&pg=PA119#v=onepage&q=OECD%20rainbow%20trout&f=true
![Page 16: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/16.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
14
The gill is an organ of vital importance for fish. Responsible for gas exchange,
osmoregulation, ionic diffusion, pH regulation, nitrogen balance [38], it is the primary
site of uptake of waterborne contaminants. This organ is also metabolically active. Due to
the pivotal role of gills, any damage can be expected to have severe consequences on the
health status of the organism and it is thus of great interest to ecotoxicology. The study of
gill has mainly been performed in vivo but primary cultures of gill epithelium have been
maintained on permeable inserts, allowing formation of confluent monolayers and tight
epithelium with physiological and morphological similarities to in vivo gill epithelium
[33, 39]. The use of RTgill-W1 instead of primary cultures is being considered [34]. A
second organ of major importance in the ecotoxicology of fish is the liver due to its high
metabolic capacities and crucial detoxification role. It is also very important for
vitellogenesis. A wide array of biomarkers related to this organ has been developed [20].
Freshly isolated hepatocytes are a common in vitro model and hepatic cell lines can be
found for a number of fish.
2.2.2 Cell lines
RTgill-W1 RTgill-W1 is an epithelial cell line
derived from gill explants of a normal
adult rainbow trout (Figure 10) [39,
40]. It has been shown to contain
pavement cells, mitochondria-rich cells
and goblet cells depending on the
culture conditions [39]. This cell line
can tolerate simple buffers without
serum, such as L-15/ex, and can even be
exposed directly to environmental
samples, without extraction or
concentration steps [14, 39].
Tanneberger et al [8] showed that
cytotoxicity results on RTgill-W1, by
using simple buffers and taking into
Figure 9 Main cell lines prepared from rainbow trout tissue. Diagram by Fabienne Roux.
Figure 10 RTgill-W1 cell line. Image taken by
Britt Wassmur.
![Page 17: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/17.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
15
account the true exposure, correlate with in vivo LC50s with less than a five-fold
difference in 73% of cases, including basal cytotoxicity but also some more specific
mechanisms. This cell line is presently being investigated for its use as an approved
alternative method by EURL-ECVAM in the context of fish acute toxicity testing
(CellSens project, [7]).
RTgill-W1 has already been used in many toxicological studies, such as for metals, waste
water and industrial effluents [3, 41], nanoparticles, viruses. It has been shown to form
tight monolayers when grown in transwell membrane chambers, expressing tight junction
proteins to some degree [34, 41] which allows it to be exposed to different media in each
compartment. Even seawater exposure can be performed as long as L-15 is supplemented
in the basolateral compartment [42, 43].
The metabolic capacities of RTgill-W1 have not been assessed thoroughly. Schirmer et al
recommend the use of RTgill-W1 for cytotoxicity testing as it lacks an inducible CYP
system, avoiding metabolism to influence exposure and cytotoxicity [44, 45]. However,
CYP1A gene expression has been shown to be induced and low EROD activity induction
is seen when exposed to BNF (see Results). The presence of other metabolic enzymes
(phase I, phase II) has not been reported.
RTL-W1
RTL-W1 is a liver epithelial cell line
derived from the normal liver of a 4-
year old adult male rainbow trout
(Figure 11). It underwent spontaneous
immortalization. This cell line was
specifically developed for its inducible
EROD activity and use in toxicological
studies [46].
RTL-W1 has been much used to test
AhR agonists and CYP1A induction, but
also to analyze cytotoxicity of
pharmaceuticals and personal care
products [12] and genotoxicity of
environmental samples [47, 48].
The metabolic capacities of RTL-W1 have been assessed by Thibaut et al [49]. The
activities of phase I enzymes such as CYP3A, CYP2K and CYP2M were very low
compared to freshly isolated hepatocytes. The same was observed for the phase II
enzymes as only low levels of UGT and of phenolic SULT activities were detected.
CYP1A, xenobiotic reductase and GST activities are better conserved [46, 49]. It has also
been reported that expression of Vtg or ER was not induced by estradiol and no increase
in vitellogenin was observed [29] which could suggest a non-functional ER pathway.
Figure 11 RTL-W1 cell line. Image taken by Britt
Wassmur.
![Page 18: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/18.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
16
2.2.3 Co-culture system
The co-culture system used in this thesis consists of two monolayers of cells separated by
a permeable insert (see Figure 7, Figure 12). The cell line grown on the insert (here
RTgill-W1) represents the epithelial biological barrier exposed to the toxicant, whereas
the cell line grown underneath (here RTL-W1), in the multiwell plate, represents the
target inner organs. The purpose of this system is to mimic uptake of toxicants through
the gill, possible metabolism and subsequent exposure of the liver.
2.4 Methods
2.4.1 Cell line maintenance
Both cell lines were obtained from Kristin Schirmer (EAWAG). They are routinely
maintained in 75 cm2 flasks containing L-15 medium with 10% (v/v) fetal bovine serum
(FBS) and without antibiotics, at 19°C.
2.4.2 Mixture toxicity assessment (NICE) – cytotoxicity
Cytotoxicity was determined using cell viability assays following the method detailed by
Dayeh et al [50], with both AlamarBlue (AB) and 5-carboxyfluorescein diacetate
acetoxymethyl ester (CFDA-AM). These probes are non-fluorescent and are taken up and
transformed to fluorescent metabolites by living cells, which can then be detected by
fluorimetry. AB is composed of resazurin and gives a measure of cellular metabolic
activity, since it is taken up by the cells and metabolized to the fluorescent resorufin in
living cells by cytoplasmic and mitochondrial oxidoreductases. CFDA-AM is
metabolized by non-specific esterases to carboxyfluorescein and gives a measure of cell
plasma membrane integrity since the latter maintains the necessary cytosolic conditions
for esterase activity. Also specific impairment of esterase activity or uptake of the dye
could influence the results [5, 50, 51]. These assays allow insight into the general health
status of the cells and possibly as well into the mode of action leading to cytotoxicity [5].
Figure 12 Co-culture system used in this thesis. A monolayer of RTgill-W1 is grown on the insert and
directly exposed to the toxicants. The RTL-W1 grown underneath can be indirectly exposed if the
toxicants make it through the first monolayer. Diagram by Fabienne Roux.
![Page 19: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/19.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
17
RTgill-W1 were seeded in 48 or 96-well plates at a density of 150 000 cells in 500 uL (L-
15 5% FBS) or 50 000 cells in 200 µL. The outer wells were filled with medium only to
avoid plate effects, as it has been noted that cells in outer wells grow much slower. The
plates were sealed with Parafilm® to avoid evaporation. Cells were allowed to grow for
48h to attain confluence. The 48h exposure was performed in L-15/ex. Single compounds
were first tested in 2 independent experiments to obtain toxicity curves and determine
EC50s. The mixtures were based on the EC50 ratio and on the environmental ratio.
DMSO was added to all compounds at a concentration of 0.1% (v/v). Cell toxicity was
determined by measuring fluorescence (excitation/emission wavelength for AB 530/590
and CFDA-AM 485/530 nm) using VICTORTM 1420 multilabel counter.
Data analysis was performed on the AB results as it showed to be the most sensitive
endpoint. Dose-response curves were modeled using the best fit approach (Generalized
Logit 1, Generalized Logit 2, Weibull, Gompertz, Morgan-Mercier Flodin, Box-Cox
Weibull, Brain-Cousens). The Concentration Addition (1) and Independent action (2)
models were used to analyze mixture toxicity.
CA: (1)
IA: (2)
Both models assume that the toxicants do not interfere with each other and that their
effects can be measured on a common endpoint. The additional assumptions of CA are
that the compounds have the same mode of action, and thus similar shapes and slopes of
concentration response curves, simply shifted depending on the sensitivity of the test
system to the compound. IA assumes on the contrary that the toxicants target totally
independent pathways through different modes of action [52].
2.4.3 Mechanistic analyses – single cell and co-culture systems
2.4.3.1 Gene expression
Seeding and exposure of RTL-W1
RTL-W1 were seeded in 6-well plates Cellstar® at a density of 500 000 in 3 mL L-15 5%
FBS 1% PS. They were exposed after 24h of growth to BBP and BPA. Both compounds
were first diluted in DMSO and final DMSO content was 0.1% (v/v). Concentrations
were based on preliminary cytotoxicity studies and literature search for BBP, and on
literature search for BPA. Exposure lasted for 24h, after which cells were trypsinized and
collected in eppendorf tubes.
𝐸(𝑐𝑚𝑖𝑥) = 𝐸(𝑐1 + ⋯ + 𝑐𝑛) = 1 − ∏[1 − 𝐸(𝑐𝑖)]
𝑛
𝑖=1
𝐸𝐶𝑥(𝑚𝑖𝑥) = (∑𝑝𝑖
𝐸𝐶𝑥(𝑖)
𝑛
𝑖=1
)
−1
![Page 20: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/20.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
18
RNA isolation
RNA was directly isolated using the QIAGEN RNeasy® Plus Mini kit, lysate
homogenization being performed using QIAshredderTM spin columns. The RNA
concentration and 260/280 ratios were determined using a Thermo Scientific Nanodrop
2000c spectrophotometer. The purified RNA was stored at -80C.
cDNA synthesis
cDNA was synthesized from 500ng RNA using the iScriptTM cDNA synthesis kit on the
MyCyclerTM instrument from BioRad and stored at -20C.
qPCR
New primers were designed using PRIMER-BLAST6 from NCBI and Primer3Plus7,
following the recommendations issued by [53]. The secondary structure was checked
using Beacon DesignerTM Free Edition8. As a rule of thumb, any primer with any ΔG < -
3,5 kcal/mol or a ΔG < -1 kcal/mol in the case of 3’ hairpins were discarded. Rating
according to NetPrimer9 was also taken into account for the final choice.
Amplification reactions were performed in duplicates using the SsoAdvancedTM
Universal SYBR® Green Supermix. Each reaction of qPCR contained the amount of
cDNA equivalent to 10 ng of total RNA, with 300 nM to 500 nM of each primer (
Table ), in a total volume of 10 μL in 96-well plates. Reactions were performed in the
CFX ConnectTM Real-Time system from BioRad, with 10 min denaturation at 95°C,
followed by 40 cycles of 95°C for 15 s and 60°C for 1 min (55°C in the case of CYP1A
and CYP3A, 58°C for Dio2 and PEPCK).
The obtained Cq values were normalized with the geometric mean of the 2 reference
genes, β-actin and ubiquitin. Fold change was determined using the ΔΔCq equation:
𝐹𝑜𝑙𝑑 𝑐ℎ𝑎𝑛𝑔𝑒 = 2−∆∆𝐶𝑞
Where ΔΔCq = ΔCqsample – ΔCqcontrol
ΔCqsample = difference between sample Cq and the reference Cq for each replicate,
ΔCqcontrol = mean of the difference between control Cq and the reference Cq.
Seeding and exposure of inserts
RTgill-W1 were seeded in inserts placed in 6-well plates Cellstar® at a density of
280 000 cells in 3 mL L-15 containing 5% FBS and 1% PS. The lower compartment was
filled with 3 mL of the same medium. Medium was changed once a week in both
compartments and cells were allowed to grow for at least 3 weeks. About one week
before exposure, the medium in the upper compartment was changed to L15-ex 1% PS.
Transepithelial resistance was measured after a few days. RTL-W1 were seeded in a
6 http://www.ncbi.nlm.nih.gov/tools/primer-blast/ 7 http://primer3plus.com/cgi-bin/dev/primer3plus.cgi 8 http://www.premierbiosoft.com/qpcr/ 9 http://www.premierbiosoft.com/netprimer/
![Page 21: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/21.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
19
separate 6-well plate Cellstar® at least 48 h prior to exposure at a density of 500 000 cell
in 3 mL, in L-15 5% FBS 1% PS. The inserts were moved to the plates containing RTL
and RTgill-W1 were exposed to BPA in L-15/ex 1% PS for 24 h. Gene expression
analysis was performed as explained above.
2.4.3.2 Total glutathione assay
Total glutathione (tGSH) content can give an insight into metabolic disruption and
oxidative stress as glutathione is involved in both processes.
To measure tGSH, an indirect assay is used. GSH reacts with DTNB to form GSH.TNB
and free TNB. The latter can be measured spectrophotometrically by measuring
absorbance at 415 nm. Addition of glutathione reductase (GR) allows the reduction of
GSSG to GSH, so that all glutathione present in the cell is in its reduced form and can
react with the DTNB (
Figure 13).
Figure 13 Total glutathione content measurement. Oxidized glutathione (GSSG) is converted to GSH by
glutathione reductase in presence of NADPH. The total reduced glutathione (GSH) can react with DTNB to
form GS-TNB, releasing free TNB that can be detected spectrophotometrically by measuring absorbance at
415 nm.
RTL-W1 were seeded in 6-well plates at a density of 500 000 cells in 3 mL L-15 5% FBS
1% PS. Once confluent, they were exposed to BPA for 48h. Both compounds were
prepared as stocks in DMSO with a total final concentration of 0.1% DMSO in the test
medium. After 48h, the test solution was discarded, the cells were rinsed with PBS first
and then with EDTA for 3 minutes, sampled by trypsination and pelleted by
centrifugation at 300g for 5 minutes. The supernatant was discarded, and the pellets were
resuspended in 100 µL of 5% 5-sulfosalicylic acid (SSA). They were homogenized by
sonication (3s), allowed to rest on ice for 15 min and then centrifuged for 20 min at
10 000g. The supernatant was stored at -80°C.
For tGSH measurements, the samples were thawed and diluted in 5% SSA. 20 µL was
added in duplicates to a 96-well plate, along with the GSH standard curve. 200 µL of
DTNB, NADPH and buffer were added to the plate and incubated for 5 minutes. Last, 20
µL of GR was added to the plate and readings were performed at 415 nm for 7 minutes in
the SpectraMax 190 spectrophotometer from Molecular Devices.
2.4.3.3 EROD
7-ethoxyresorufin-O-deethylase (EROD) activity gives a measurement of CYP1A-
mediated phase I metabolism. This activity is measured by the deethylation of 7-
ethoxyresorufin in the presence of endogenous NADPH to resorufin, a strongly
fluorescent molecule emitting at 590 nm [54].
![Page 22: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/22.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
20
RTgill-W1 and RTL-W1 were compared for their potential EROD activity induction
through BNF exposure. The cells were seeded in 48-well plates at a density of 150 000
and 50 000 cells in 0.5 mL respectively and allowed to grow to confluence. They were
then exposed to 1 and 0.1 µM BNF (final DMSO content 0.1% v/v) in L-15 5% FBS 1%
PS for 24 hours. Cells were washed with 500 µL PBS and then exposed to 200 µL of 7-
ethoxyresorufin solution. The plate was then read every minute for 10 minutes to measure
the formation of resorufin (excitation/emission wavelength 530/590 nm) using
VICTORTM 1420 multilabel counter. After the measurements, 100 µL fluorescamine in
acetonitrile (0,3 mg/mL) was added to each well to determine the protein content, and the
plate was measured again after 10 minutes of incubation (excitation/emission wavelength
400/460 nm).
This assay was performed as well on RTL-W1 when exposed to BPA for 24h.
2.4.4 Statistical analysis
All statistical analysis was performed using IBM SPSS Statistics 22 for Windows. Data
which showed normality (Shapiro-Wilk (SW) > 0.05) and homogeneity of variance
(Levene (L) > 0.05) was analyzed by a one-way ANOVA followed by Tukey post hoc
(p<0.05). If the data was not normal (SW<0.05), analysis was performed using a non-
parametric Levene test (>0.05) followed by a Kruskal-Wallis test (p<0.05). If the data
was normal (SW>0.05) but not with homogeneous variance (L<0.05), and if taking the
log of the data was not sufficient to improve homogeneity of variance, a Welch ANOVA
followed by a Dunnet T3 post hoc (p<0.05) was used instead. Significant results are
marked with an asterisk (*). Data is shown as mean ± standard error (SE).
Table 1 Primer sequences. The basic qPCR set up used a primer concentration of 300 nM and an annealing
temperature of 60°C, with the following exceptions: a primer concentration 500 nM; b annealing
temperature 55°C; c annealing temperature 58°C.
Forward primer 5’→3’ Reverse primer 5’→3’ Ubi ACAACATCCAGAAAGAGTCCAC GCAGCCTGAGGCACACTTG β-actin TGGCATCACACCTTCTAC AATCTGGGTCATCTTCTCC CYP1A a,b TCCTGCCGTTCACCATCCCACACTGCAC AGGATGGCCAAGAAGAGGTAGACCTC CYP3A a,b GCCAGCCAGCAGAAGAGT GGATTCGTAGCCAGATTGTAAGC GSTπ ACCTGGTGCTCTGCTCCAGTT AGAGCTCAGGAAGCCCTTGAT NRF-2 a TTTGTCCCTTCCTGAGCTGC GGGCAATGGGTAGAAGCTGT GPx CCTGGGAAATGGCATCAAGT GGGATCATCCATTGGTCCATAT GCLcat TGAGGGAGTTTGTGGACAAGC AATAGTTCTGGCATCGCTCCTC ERRγ CAGCAGATGAACCTGAGCCA TCATGGAGTCCGTCCTGGAA GR ATGGGGTCAGTCAGCTTTGG AGGGAGGAAAGGAAAGCAGC PEPCKc AGACCAACCCTCATGCCATG TGGAGTTGGGATGAGCACAC PPARγ ACAGACACTTTCCCCTGACCAA CGTCAGAGACTTCATGTCATGGA ERα ACTCTGGTGCCTTCTCCTTC GCGTCGGTGATGTTGTCC Dio2 c TTGAGGCACCCAACTCCAAA AGCCGAAGTTCACCACAAGA TTR ACTGCCCGTTGATGGTTAAG TTCCCCTGTCAAGTCTGTCA TRβ TACAAAAATTATCACCCCCGCCA CTCACAGAACATAGGCAGCTTTT
![Page 23: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/23.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
21
3 Results
3.1 Mixture toxicity assessment (NICE) – cytotoxicity
3.1.1 Single compound toxicity
The environmental concentrations of the different toxicants were the following:
Table 2 Environmental concentrations in ng/L of Cu2+, MET and TBP detected on the Swedish west coast
during the chemical monitoring by NICE, june 2012 and September 2013.
June 2012 September 2013
Instöränna Fiskebäckskil Skalkorgarna Lerkil Stenungsund Björlanda Fiskebäck
Cu2+ 1100 2300 1100 840 4900 8600 5200
MET 0,23 0,2 3,5 <0.1 0,44 1,4 0,89
TBP 27 <23 47 29 45 34 37
Two independent experiments (E01 and E02) were first performed to determine the
EC50s of each chemical. Depending on the quality of the results obtained, either one or
both experiments were used to calculate the EC50s and the EC50 ratio.
Table 3 Dose-response curve parameters obtained for Cu2+, MET and TBP, EC50s and molar ratio used for
the mixture. The experiment was performed in 48-well plates and for 48h. Only AB data was used for
EC50 calculation as it was the most sensitive endpoint. The numbers of controls was 11 for Cu2+, 8 for
MET, 7 for TBP, with 4 replicates of each concentration. Results from the first (E01) or second (E02)
experiment were chosen according to their quality, except for TBP where both experiments were pooled.
Cu2+ (E01) MET (E02) TPB (Pooled)
tet1 -4,02E+00 -4,10E+00 1,40E-03
tet2 7,53E+00 1,58E-02 1,48E+01
tet3 7,72E-01 5,73E-01 3,72E+02
Model Gl1 BCW Brain-Cousens
EC50 3 µM 5360 µM 420 µM
p (EC50 ratio) 0,05% 92,69% 7,26%
![Page 24: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/24.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
22
3.1.2 Mixture toxicity
For mixture toxicity testing, 3 different independent experiments (A, B and C) were
performed. Each compound was tested singularly (to account for potential fluctuations
between cell passages) and as a mixture, based on the EC50 and environmental ratios.
The results obtained for the single compounds are the following.
Table 4 EC50s [µM] obtained for the single compounds in 3 independent experiments, A, B and C,
using the cytotoxicity assay on RTgill-W1. Exposure lasted 48h.
Figure 14 Modeled single compound dose-response curves of Cu2+, TBP, MET in the 3 mixture
experiments (AlamarBlue) on RTgill-W1. Black line = Cu2+; dashed dark grey = TBP; dashed and dotted
light grey = MET. Each experiment was performed using 4 96-well plates, with 10 controls; dilution series
of 10 concentrations with 1 replicate on each plate. Exposure lasted 48h.
The first mixture to be assessed was based on the EC50 ratios and gave the following
results:
Table 5 EC50s [µM] obtained with the mixture based on the EC50 ratio of Cu2+, TBP and MET in the 3
experiments A, B and C, using the cytotoxicity assay on RTgill-W1. Exposure lasted 48h.
-1,2
-1
-0,8
-0,6
-0,4
-0,2
0
0,2
0,4
0,6
0,8
1
1 10 100 1000 10000
Me
tab
olic
inh
ibit
ion
single compound concentration [µM]
EC50 [µM] Cu2+ MET TBP
A 35 7480 218 B 19 7140 300 C 11 6590 324
EC50 [µM] Mixture (EC50 ratio) CA IA
A 3570 2120 2980 B 2635 2510 4530 C 3608 2360 4402
![Page 25: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/25.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
23
The environmental mixture, based on the concentrations of each chemical detected in the
sampling site of Stenungsund, was also assessed in experiment C. The ratio of each compound
can be found in Table 6:
Table 6 Molar ratio of Cu2+, MET and TBP for mixture testing according to the environmental concentrations
detected in Stenungsund during the chemical monitoring in June 2012.
Cu2+ MET TPB
p (env ratio) 99,08% 9,90 10-3 % 0,91%
-0,6
-0,4
-0,2
0
0,2
0,4
0,6
0,8
1
1,2
1000 10000
Me
tab
olic
inh
ibit
ion
Mixture concentration [µM]
A
-0,2
0
0,2
0,4
0,6
0,8
1
1,2
1000 10000
Me
tab
olic
inh
ibit
ion
Mixture concentration [µM]
B
-0,6
-0,4
-0,2
0
0,2
0,4
0,6
0,8
1
1,2
1000 10000
Me
tab
olic
inh
ibit
ion
Mixture concentration [µM]
C Figure 15 Modeled and predicted mixture
toxicity curves of the mixture based on the
EC50 ratio. Grey line = model from
experimental data; black line = IA prediction;
black dotted line = CA prediction. Each
experiment was performed using 4 96-well
plates, with 10 controls; dilution series of 10
concentrations with 1 replicate on each plate.
Exposure lasted 48h.
![Page 26: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/26.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
24
The obtained mixture toxicity was
Table 7 EC50s [µM] obtained in experiment C for the environmental mixture of Cu2+, TBP and MET, the CA and
IA predictions, using the cytotoxicity assay on RTgill-W1. Exposure lasted 48h.
Figure 16 Modeled and predicted mixture toxicity curves of the mixture based on the environmental concentrations.
Grey line = model from experimental data; black line = IA prediction; black dotted line = CA prediction. This
experiment was performed using 4 96-well plates, with 10 controls; dilution series of 10 concentrations with 1
replicate on each plate. Exposure lasted 48h.
EC50 [µM] Mixture (env ratio) CA IA
C 14,5 9,6 9,6
-0,4
-0,2
0
0,2
0,4
0,6
0,8
1
1,2
1 10 100
Me
tab
olic
inh
ibit
ion
Mixture concentration [µM]
C
![Page 27: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/27.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
25
3.2 Mechanistic analyses – single cell and co-culture systems
3.2.1 EROD activity and cytotoxicity in RTgill-W1 and RTL-W1
EROD activity was analyzed in RTgill-W1 and RTL-W1. Inducible EROD activity was
observed in both cell lines after 24h, with the highest response at 0.1 µM BNF. At 1 µM
BNF, BNF competes with 5-ethoxyresorufin (ER) for CYP1A active sites, which limits
the metabolism of ER and thus shows a low EROD activity.
Figure 17 EROD activity in RTgill-W1 and RTL-W1 after 24h exposure to 0.1 and 1 µM BNF. The
experiment was performed in L-15 5% FBS 1% PS. Metabolism of 7-ethoxyresorufin was normalized with
the amount of protein detected by fluorescamine.
EC50s (in µM) based on AlamarBlue were the following.
Table 8 EC50s (in µM) of BBP and BPA on RTL-W1 and RTgill-W1 with different media, 48h exposure.
The experiments were performed in 48 well plates. *Due to lack of toxicity of BBP, precise determination
of EC50s has been impossible to perform. The percentages between parentheses are the effect observed at
the concentration indicated. (1) indicates the EC50 on which the BBP concentrations were based for the
gene expression experiment on RTL-W1.
BBP* BPA
(1) RTL-W1 L-15/ex >6.4 (38%) -
RTL-W1 L-15 5%FBS - 194,5
RTgill-W1 L-15/ex ~50 (55%) 59
RTgill-W1 L-15 5%FBS >50 (15%) 69
-2
0
2
4
6
8
10
12
14
RTgill-W1 RTL-W1
spe
cifi
c ER
OD
act
ivit
y [p
mo
l/m
in/m
g p
rot]
CT 0.1 µM 1 µM
![Page 28: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/28.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
26
3.2.2 Tool identification on RTL-W1
Primer design
The development of a primer for EERγ was unsuccessful, and PPARγ and TTR do not
seem to be expressed in RTL-W1. It must be noted that optimization of primers for
PEPCK and CYP3A was not ideal as the efficiency was over 110%. All other primers
were optimized with efficiencies between 90 and 110%.
Gene expression
The concentrations for the exposure to BBP of RTL-W1 were chosen based on literature
and on a preliminary cytotoxicity test (noted (1), (see Table 8). A concentration of 1 µM
was chosen as highest test concentration since the EC50 seemed to be close to 10 µM and
as 1/10 of EC50 as highest concentration is reasonable for sublethal experiments.
Moreover, no cytotoxicity was observed at 0.64 µM. BPA was added in the experiment
before any cytotoxicity data could be measured in our facilities, and the highest
concentration was based on literature, where a 24h EC50 of 125 µM had been reported
by [55] for MeWo cells. 10 µM was chosen as it is about 10% of the EC50. A factor of
50 was used between the high and low concentration for both compounds.
BBP exposure showed no significant effect on any of the genes tested (see Figure 18).
BBP BPA
A significant effect was observed at 10 µM BPA on the Dio2 gene expression (see
Figure 18). No other significant difference or general trend was detected for ERα, GSTπ,
GPx or Nrf-2. PPARγ could not be detected in the RTL-W1 cell line even though it the
primers functioned on the liver samples.
The response of Dio2 led to a second round of exposure with BPA (Figure 19), with
more focus on the thyroid system. Unfortunately, quantification of TTR and TRα
expression was unsuccessful, due to lack of expression of non-functional primers. The
concentration span was increased to see if any low concentration effects, specific to
Figure 18 Fold change of different potential new biomarker genes observed in RTL-W1 exposed to BBP and BPA
for 24h. Data is shown as mean ± SE (n =3). Asterisks (*) indicate significant changes (one-way ANOVA and
Tukey post hoc, p<0.05).
*
![Page 29: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/29.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
27
endocrine disruptors, could be found. The highest concentration was increased to 20 µM
as RTgill-W1 showed no metabolic inhibition with up to 16 µM of BPA in both media.
å
Figure 19 Fold change of different potential new biomarker genes observed in RTL-W1 exposed to
different concentrations of bisphenol A for 24h. Data is shown as mean ± SE (n =4). Asterisks (*) indicate
significant changes (one-way ANOVA and Tukey post hoc, p<0.05).
Thyroid system
In the second round of exposure, 20 µM BPA showed a statistically significant decrease
for Dio2 levels (after having logged the data, one-way ANOVA p = 0.000; Tukey p =
0.000). This decreasing trend clearly starts at 2 µM, even though no statistical
significance supports it, and confirms the results obtained during the first round. No
response was observed when it comes to TRβ.
The expression of TTR was too low in the RTL-W1 to be quantified (data not shown).
The primer was however functional on the liver samples.
Glucocorticoid receptor
Exposure to BPA had no significant effect on the glucocorticoid receptor. A very slight
increase at 0.2 µM could be observed and might have been significant if the controls had
shown less variability.
Metabolism: phase I
BPA exposure of 20 µM clearly increased the amounts of CYP1A mRNA. Welch
ANOVA indicated significance (p = 0.022), however this was not confirmed by Dunnett
T3 post-hoc. CYP3A gene expression was on the opposite significantly decreased (one-
way ANOVA p = 0.016; Tukey p = 0.045) at 20 µM BPA.
0
1
2
3
4
5
Dio2 TRβ GR CYP1A CYP3A
Fold
ch
ange
CT 0,02 µM 0,2 µM 2 µM 20 µM
*
* *
![Page 30: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/30.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
28
EROD activity in RTL-W1
Figure 20 EROD activity in RTL-W1 after 24h exposure to different concentrations of BPA. 2 plates were
used for the experiment (1 and 2) and data was compared to the control on the corresponding plate (the 5
lowest BPA concentrations on plate 1, BNF and 20 µM BPA on plate 2). The number of controls was 4 per
plate, with 3 replicates for each BPA concentration. Data is shown as mean ± SE (n =4). Welch ANOVA
indicated significant difference between the groups (p=0.001), however Dunnet T3 validated only the
exposure to BNF as statistically different from the controls.
The increased expression of CYP1A translated at the activity level of this enzyme as a 4
to 5-fold increase in EROD activity could be observed with an exposure of 6.3 and
20 µM BPA compared to the controls (Figure 20). Welch ANOVA indicated significant
difference between the groups (p=0.001), however Dunnet T3 validated only the
exposure to BNF as statistically different from the controls.
Total glutathione measurements in RTL-W1
Figure 21 Total glutathione content in RTL-W1 after 48h exposure to BPA. The number of controls was 4
per plate, with 3 replicates for each BPA concentration. Data is shown as mean ± SE (n =4). Asterisks (*)
indicate significant results (Kruskal-Wallis, p<0.05).
0
1
2
3
4
5
6
7
8
9
10
ERO
D a
ctiv
ity
vs c
on
tro
l[p
mo
l/m
in/m
g p
rote
in]
0
20
40
60
80
100
120
140
160
CT BPA 2 uM BPA 20 uM
tGSH
co
nte
nt
[µm
ol]
*
![Page 31: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/31.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
29
Exposure to 2 µM of BPA on RTL cells showed a statistically significant increase in total
glutathione content (Kruskal-Wallis p = 0.043) (Figure 21).
No effect could be noted on the GSTπ and GPx expression levels through qPCR (see
Figure 18).
3.2.2 Co-culture system
TER measurements
Figure 22 TER measurements of empty inserts in L-15, in L-15/ex and of inserts with a confluent
monolayer of RTgill-W1, a few days after having changed the apical medium to L-15/ex.
TER values (Figure 22) were measured before exposure. No great difference was
observed. A slight increase can be noted with the monolayer of RTgill-W1.
Gene expression
RTgill-W1 RTL-W1
Figure 23 Fold change of CYP1A, CYP3A and Dio2 gene expression in RTgill-W1 and RTL-W1 when
exposed for 24h to BPA. Data is shown as mean ± SE (n =4). Asterisks (*) indicate significant results (one-
way ANOVA and Tukey post hoc, p<0.05).
0
100
200
300
400
500
600T
ER
[Ω
·cm
2]
CT L-15 CT L-15/ex Rtgill-W1
* * *
![Page 32: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/32.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
30
In both cell lines, significant CYP1A expression induction can be observed (Figure 23).
In the case of RTgill-W1 this already happens at 2 µM, whereas it takes 20 µM for RTL-
W1. This is the same response as was observed for single cell line exposure of RTL-W1,
but to a lesser extent (2-fold instead of 4-fold). The response of CYP3A is less clear and
no trend can be shown. Dio2 expression is clearly if not significantly inhibited at 20 µM
BPA, which is also similar to what had been observed in RTL-W1 before, and to a lesser
extent (fold change of 0.60 instead of 0.47).
![Page 33: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/33.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
31
4 Discussion
This project aimed to assess the potential uses of two different fish cell systems in
ecotoxicology. The first system was a gill cell line (RTgill-W1) in an optimized
cytotoxicity assay that had been designed by Tanneberger et al [8]. This system was
tested for mixture toxicity screening in the context of the NICE project. The second
system was a co-culture model composed of both gill (RTgill-W1) and liver (RTL-W1)
cell lines, aiming to mimick environmental exposure through the gills and subsequent
exposure of inner organs. Its properties for mechanistic studies were assessed using
different biochemical assays.
4.1 Mixture toxicity assessment (NICE) – cytotoxicity
To assess the mixture toxicity screening potential of the RTgill-W1 assay, the combined
toxicity of 3 compounds found in Swedish coastal waters, copper ions, metoprolol and
tributylphosphate, was tested. Single compound toxicity was first determined to obtain
the respective EC50s, which were compared with existing literature. Two mixtures were
tested: one was based on the EC50 ratio of the compounds, and the second on their
environmental ratio according to monitoring in Stenungsund. The mixture toxicity was
modeled using the concentration addition and independent action models.
4.1.1 Single compound toxicity
Copper, an essential trace element, is widely used by the metal industry, but also as
fertilizer, wood preservative, and pesticide [56]. Highly toxic to the aquatic environment,
it is besides cadmium one of the most polluting metals in the environment [57]. During
the chemical monitoring, the highest Cu2+ concentration, 8.6 µg/L (about 0.14 µM) (see
Table ), was detected in Björlanda. Copper sulfate toxicity has been assessed by [57] on
RTgill-W1 and an EC50 of 29.2 µM was obtained after 2.5h. They also suggest that
oxidative stress could trigger cytotoxicity. In vivo EC50s generally range between 0.1 and
10 µM (ECOTOX database). The EC50 values observed in this study varied between 3
and 35 µM (Table , Fel! Hittar inte referenskälla.). The second compound, metoprolol,
is a selective β1-adrenergic receptor blocking pharmaceutical widely used to treat
cardiovascular diseases such as hypertension, heart angina and abnormal heart rates. β-
blockers are found in WWTP effluents worldwide [58], at concentrations sometimes as
high as 5 µg/L [59]. The highest detected concentration on the Swedish west coast was in
Skalkorgarna (3.5 ng/L) (Table ). Metoprolol blocks β-adrenergic receptors and seems
non-toxic to fish (exposure of up to 100 mg/L during 2 days of Japanese Medaka larvae
did not result in increased mortality, [60]). Previous cytotoxicity studies performed on
RTG-2, a rainbow trout gonadal cell line reported EC50s higher than 1800 µM [10, 58].
The EC50 values that were obtained in this study ranged from 3800 to 7500 µM (Table ,
Fel! Hittar inte referenskälla.). The last compound, tributyl phosphate, is an
organophosphorus compound. Its main use is as a solvent in rare earth extraction and
purification and as component of flame retardant for aircraft hydraulic fluids [61]. It can
enter the aquatic environment through waste water discharges, in particular from
extraction plants [62]. Due to its relatively high logKOW (=4 according to [61], it is
expected to adsorb mainly to sediments and particulate matters. Surface waters in Europe
![Page 34: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/34.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
32
have been found to contain between 100 and 3900 ng/L of TBP [61]. During this study,
the highest TBP concentrations were detected in Skalkorgarna and Stenungsund (47 and
45 ng/L respectively) (Table ). Its bioconcentration factor in fish is relatively low and its
toxicity to rainbow trout (LC50, up to 48 days) has been shown to be in the range of 1 to
15 mg/L, thus 4 to 60 µM [62, 63]. Its mode of action for toxicity is unknown [61]. TBP
has been tested on HeLa cells and an EC50 of 5600 µM was found [64]. The EC50s
obtained here ranged from 200 to 420 µM (Table , Fel! Hittar inte referenskälla.),
which is less sensitive than in vivo data showed but more sensitive than the former in
vitro study.
Since no in vivo mortality data is available for MET, no in vitro – in vivo comparison can
be made. For the other two chemicals, the EC50s obtained during this experiment are in
good general accordance with in vivo studies, with a maximum of one order of magnitude
difference. As the repeatability of each experiment was limited, it is difficult to be more
precise, but when compared to general in vitro – in vivo differences which have been
reported to reach up to 3 orders of magnitude, the use of this sensitive RTgill-W1 assay
seems promising, as was noted by Tanneberger et al [8].
4.1.2 Mixture toxicity
Copper ions, MET and TBP are dissimilarly acting when it comes to their modes of
action, which would suggest the use of the IA model. However, RTgill-W1 is not a test
system that can account for the specific modes of action of the chemicals considered here
and the observed cytotoxicity should mostly be due to disruption of basal cellular
functions. It has been shown that both models give fairly similar results with mixtures
that are not composed of purely similarly or dissimilarly acting compounds, CA being an
efficient worst-case scenario with, in a majority of cases, not more than a 2-fold
underestimation of the EC50 [65, 66]. Both models seem thus reasonable to consider.
One important limitation to keep in mind is that none is able to account for hormesis in
the present situation, IA due to its intrinsic properties and CA since not all compounds
show hormesis in the same span [67].
The experimental mixture EC50 based on the EC50 ratio (Fel! Hittar inte
referenskälla.) is consistently underestimated by a factor of 1.1 to 1.7 by the CA. The
IA tends to overestimate it, by a maximum factor of 1.7, but does also underestimate it
one time by a factor of 1.2 (Figure 15). No antagonism or synergism can be noted.
Similarly, in the case of the mixture based on the environmental ration, both models
overestimate the toxicity by a factor of 1.5.
Interestingly, the EC50s of each compound varied significantly between each experiment
(up to a factor of 10 for copper ions, 1.5 for MET, 2 for TBP, 1.5 for the mixture, Figure
14, Figure 15) and thus between the mixture experiments and the initial single compound
assessment on which the EC50 ratio was based. Therefore, the toxicity of each compound
in each experiment was taken into account for the prediction. Except in the case of
copper, the variability is in expected and acceptable ranges. In the case of the mixtures,
considering the wide range of toxicity of these compounds, these variations seem
relatively small and both models give reasonably good estimates of the mixture EC50.
![Page 35: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/35.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
33
The observed variability can be due to several factors. Each experiment was performed
on a different passage of RTgill-W1, and it is known that differences in response can then
be observed. The use of 96-well plates instead of 48-well plates also leads to an increase
of variability. In this experimental setup, only 4 replicates per concentration were used,
and each one was on a different plate. This set up was necessary in order to assess the
toxicity of all 3 single compounds and of the mixture at the same time, to analyze
sensitivity differences between the passages. Moreover, only 64 wells out of 96 were
used per plate, as it has been observed that the cells in the outer wells grew significantly
slower. Finally, no chemical analysis was performed during this short study and nominal
concentrations were used, thus actual exposure was not taken into account, which could
also be a factor of variation.
To improve this assay, it would be necessary to evaluate how much variability comes
from the actual splitting (passaging) of the cells and how their behavior evolves with
regard to the EC50s, especially in cases of high variation such as was observed with
copper. Chemical analysis would be necessary to determine the actual exposure and
verify that the stocks remain stable. As TBP is lipophilic, the true exposure might be
much lower than is expected according to the nominal concentration. Optimization of the
dosing procedure could be helpful.
The use of this assay seems to be applicable for the analysis of mixture toxicity in fish.
However, this assay is considered as a good alternative to acute in vivo testing, but might
overlook important chronic effects happening via the specific modes of action of the
chemicals. This is relevant in case of single compound exposures and becomes even more
critical in case of multiple stressor situations. Metoprolol is here a perfect example as it
seems non-toxic to the system, however chronic exposure and potential effects on the
cardiac system could be very significant in case of multiple stressor situations. It is thus
of true importance to keep in mind that specific sublethal modes of action are a challenge
to assess with a cell line.
4.2 Mechanistic analyses – single cell and co-culture systems
Two endocrine disrupting chemicals, bisphenol A (BPA) and benzylbutylphthalate
(BBP), were chosen as model compounds to test on the co-culture system. An initial
identification of different biochemical tools (gene expression, EROD activity, glutathione
content) was first performed on RTL-W1 only, before the actual co-culture system was
used.
4.2.1 Tool identification on RTL-W1
The gene expression analysis was limited by the lack of or low expression of certain
genes, even though they are expressed in the normal liver. ERRγ, PPARγ and TTR could
thus not be assessed. This is unfortunate but can be expected when cell lines are used.
BBP did not show any significant effect on the genes that were analyzed. For some of
them, it is consistent with what has been found in the literature [68] for developing
zebrafish embryos. Higher concentrations of BBP could probably have been used due to
![Page 36: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/36.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
34
its probably very limited bioavailability in the test system, especially with the presence of
serum proteins. Additional genes having shown response to some degree could also be
considered.
Thyroid system
The only effect that could be observed when it comes to the thyroid system is a
significant decrease in Dio2 gene expression when exposed to BPA (see Figure 18,
Figure 19). Deiodinases are considered promising biomarkers for thyroid disruption in
fish due to their central role in thyroid hormone activation and metabolism, see Figure 6
[23]. Dio2 has already been shown to be responsive to endocrine disruptors such as
MEHP, a phthalate; however in that particular case its gene expression was significantly
increased [28]. This could be due to different properties of the compounds. The phthalate
which was tested in this study, BBP, did not have any effect on Dio2 (Figure 18). It is
interesting to see that Dio2 is expressed in RTL-W1 at low level (Cq values of 25-26).
BPA is expected to interact with TRβ although the exact nature of this interaction is
debated [27]. since the TR seems to be expressed at the transcriptional level even though
at low levels (Cq values of 30), different assays could have been used to follow receptor
interaction, and the transcription level of different genes downstream of the TR could
provide valuable information.
Interestingly, in the parallel study that was conducted on brown trout by Joan Martorell
Ribera [69], T4 plasma levels were decreased after 8 week exposure to BPA, BPS and
BBP, even though T3 plasma levels remained stable. The combination of these
observations could suggest a role of Dio2 in BPA-mediated thyroid disruption and
requires more investigations. The thyroid system is complex and a better overview of the
different actors is necessary. Even though RTL-W1 seems to express Dio2 and TRβ at
relatively low levels, this cell line is probably not the most suitable in order to study this.
The high concentrations of BPA needed to obtain a response at the transcriptional level
and the lack of response to BBP indicate that this cell line is not a very sensitive assay if
Dio2 is to be used as a biomarker for thyroid disruption. Many other proteins are reported
to be sensitive to endocrine disruption, which are either not expressed in RTL-W1 even
though they are expressed in the liver (as it seems to be the case for TTR) or simply
expressed in different tissues, such as the pituitary.
Metabolism
RTgill-W1 has been described as a cell line lacking inducible CYP1A by Schirmer et al
[44, 45], an advantage for cytotoxicity testing as phase I metabolism would not interfere
with cytotoxicity. As was shown when both cell lines were compared (Figure 17), EROD
activity was indeed less inducible in RTgill-W1, however a response could be observed.
CYP1A gene expression was also inducible in this cell line.
Phase I metabolism: CYP
Interestingly, the results obtained on RTL-W1 (Figure 19, Figure 20) are opposite to
most in vivo results. Indeed, a general down-regulation of 5 out of 6 different CYP
enzymes was observed with the exposure of juvenile atlantic cod to BPA (50 µg/L) for 3
weeks. In particular, down-regulation of CYP1A gene expression, decrease in CYP1A
![Page 37: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/37.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
35
enzyme levels and inhibition of EROD activity was noted. Similarly, CYP3A mRNA
levels decreased, as well as CYP3A activity even though enzyme levels remained stable
[70]. Brown trout exposed to BPA, BPS and BBP (2 and 20 mg/kg) for 2 to 8 weeks
show a general decrease in EROD activity for BPA [69]. Arukwe et al [71] also observed
a very clear decrease in EROD activity in the liver of juvenile atlantic salmon when
exposed to increasing concentrations of BPA (from 1 to 125 mg/kg) or E2 (5 mg/kg).
This inhibition of the hepatic CYP1A seems to be the most common in vivo response in
the case of exposure of fish to estrogens, however the opposite response has also been
observed. It is not exactly known why BPA has this effect on phase I metabolism but
involvement of the ER has been suggested [7]. Navas et al [72] studied the effects of E2
(endogenous ER agonist) on rainbow trout hepatocytes. They also noted a decreased
EROD activity and CYP1A mRNA levels due to E2 exposure but interestingly, the co-
exposure of E2 and an ER antagonist, tamoxifen, cancelled the inhibitory effect of E2 on
the CYP1A system. They therefore suggest that E2 inhibitory effect on CYP1A
expression and EROD activity is somehow mediated by the estrogen receptor. Grans et al
[73] obtained a similar inhibition of CYP1A in EE2 exposed rainbow trout hepatocytes,
but the use of fulvestrant, a specific ER antagonist, did not cancel that effect. It should be
noted however that ICI did not cancel EE2-mediated Vtg induction in this study, which is
surprising for an ER antagonist.
One hypothesis to partly explain the induction of CYP1A mRNA expression and EROD
activity observed here could be that as ER is probably non-functional in RTL-W1 [29],
this liver cell line cannot respond properly to estrogen exposure.
Unfortunately, studies involving the ER and CYP1A have not been performed with BPA
and it is therefore difficult to draw conclusions. However, the lacking ER pathway could
be related to this unexpected response. This highlights the importance of choosing
relevant test systems if one wants to analyze mechanistic effects of toxicants.
Phase II metabolism
Chemical analysis The two major metabolites that have been found for BPA in fish are the BPA sulfonate
and the BPA glucuronic acid [74, 75]. The main metabolite in both zebrafish and rainbow
trout is the BPA glucuronic acid [75]. [70] found a decreasing trend in UGT gene
expression when juvenile atlantic cod were exposed to BPA. An increase in GSTπ
expression was also noted, even though its activity was not altered.
Total glutathione
In this study, only tGSH was shown to be impacted by BPA (Figure 21), whereas GSTπ
expression levels remained stable (Figure 18). In case of increased metabolism, one
would expect increased clearance of GSH and thus lower tGSH levels. It is thus possible
that the increased tGSH is not related to phase II metabolism but more to oxidative stress
response, especially since GSTπ does not seem to be involved in BPA metabolism. It
would probably be informative to analyze the GSSG:GSH ratio since it is modified in
case of oxidative stress due to GSSG formation. Unfortunately, the amount of cells
![Page 38: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/38.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
36
required to detect GSSG is quite high and so this step has not been performed in this
study.
4.2.2 Co-culture system
Tightness of the membrane
It is difficult to determine whether the gill cells form a tight monolayer on the inserts in
this study. As the shape of these cells is quite elongated it is more difficult to see if they
are truly fully confluent. In addition to this, it is hard to detect them at all with a
microscope when they are seeded on the inserts due to the background formed by the
membrane. TER measurements, the presence of tight junction proteins and permeability
to dyes are all methods that can be used to determine how tight an epithelium is [33].
Only TER was measured in this study (Figure 22). This was performed on empty inserts
with both media, and after medium change to L-15/ex, shortly before exposure. The
values obtained were in the range of 102 Ω·cm2. A small increase in TER could be noted,
however the meaning of it is difficult to determine.
The study by Trubitt et al [34] suggests the presence of functioning tight junction proteins
by the measurement of TER and analysis of the response of confluent monolayers of
Rtgill-W1 on transwell inserts when exposed to different hormones. However the TER
values were significantly smaller than the ones found in primary cell cultures (in the
range of 10 Ω·cm2 vs. 103-104 Ω·cm2) [33, 34]. It states that tight junctions have also
been observed by TEM, even though they were undetectable on Western Blots. Their
expression at the gene level was also relatively low, indicating important differences
between in vivo epithelia and this in vitro model. However, they conclude that the
monolayer formed by RTgill-W1 should be tight.
In our case, the best would have been to measure the evolution of TER over time, which
was not performed due to contamination risks and lack of time. Moreover, an increase in
TER does not mean that the monolayer is totally tight, and should be backed up with
another method of analysis, such as tight junction protein detection. The permeability of
the membrane to the dye Lucifer Yellow will be analyzed in later experiments.
BPA exposure
Exposure of RTgill-W1 in the co-culture system increased CYP1A gene expression
(Figure 23). It is known that phase I metabolism also occurs in gills, and EROD activity
in the gill tissue is considered as a potential sensitive biomarker for exposure to CYP1A
inducers [2, 7]. Interestingly, it has been observed that estrogen exposure increases
EROD activity in the gills, which is in accordance with the CYP1A mRNA increase
noted here. The mechanisms of BPA are thus different in both organs, however to which
extent and why is not known [7]. CYP3A did not seem very impacted. Interestingly,
RTL-W1 responded (Figure 23), indicating indirect exposure to BPA. CYP1A gene
expression was induced, and Dio2 gene expression reduced, similarly as in the single cell
line exposure but to a lesser extent. CYP3A did not respond clearly.
The indirect exposure of the liver cell line could have happened via different ways. First
of all, it is not clear whether the RTgill-W1 was as tight as hoped for, which means that
leakage of BPA could have occurred. BPA could also have been taken up and excreted to
![Page 39: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/39.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
37
the basolateral side, maybe even metabolized. BPA is considered to be mainly
metabolized by the UGTs and SULTs in rainbow trout. It would have been interesting to
measure the gene expression of these enzymes in the RTgill-W1 but no sequence for
these genes was annotated for rainbow trout. The chemical analysis of both media will be
performed in the summer and might give interesting insights into the metabolic capacities
of RTgill-W1.
![Page 40: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/40.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
38
5 Conclusion
To conclude, the results obtained during this thesis confirm the good potential of cell
lines to be used for general cytotoxicity studies but their better characterization is needed
for more specific studies.
RTgill-W1 proved efficient and sensitive for the toxicity assessment of copper,
metoprolol and tributylphosphate. Single compound EC50s were in the range of in vivo
data (less than one order difference) and both Concentration Addition and Independent
Action predicted the mixture EC50s with less than a 2-fold difference compared to the
observed EC50. However this assay is limited for chronic toxicity and sublethal
endpoints, which is of critical importance for environmental mixture assessment. This
cell line could be of use for compounds acting through pathways that are known to be
expressed.
The co-culture system needs to be better characterized before it can be used for
toxicological studies, but promising indications of monolayer integrity have been
reported for RTgill-W1. In the specific case of BPA, inhibition of the Dio2 gene
expression was observed, indicating that this enzyme could potentially be an interesting
biomarker for endocrine disruption, encouraging further research in this direction. With
established in vitro biomarkers, capacities and limitations, this co-culture model could
prove very useful.
![Page 41: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/41.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
39
6 Acknowledgements
I would like to thank Joachim, my supervisor, who gave me the possibility to perform my
one year thesis in his lab; who somehow always managed to find time to listen, help and
support, even on weekends, and who guided me during this whole year with good advice.
Britt, who has been there every day of this thesis and has shown me everything, with
great patience, availability and clarity. Thank you ! Thomas, sometimes supervisor,
sometimes examiner, who was very helpful for the first part of this work and the
modeling. The whole ÅL group for its support (and nice fika!). Finally, the whole lunch
clan, my Fridays will be very boring from now on.
![Page 42: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/42.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
40
7 References
1. ECHA. ECHA publishes an updated list of pre-registered substances. 2009.
2. Russell, W.M.S., R.L. Burch, and C.W. Hume, The principles of humane
experimental technique. 1959.
3. Schirmer, K., Proposal to improve vertebrate cell cultures to establish them as
substitutes for the regulatory testing of chemicals and effluents using fish.
Toxicology, 2006. 224(3): p. 163-83.
4. Castaño, A., et al., The use of fish cells in ecotoxicology. The report and
recommendations of ECVAM Workshop 47. Alternatives To Laboratory Animals
ATLA, 2003. 31(3): p. 317-351.
5. Bols, N.C., et al., Use of fish cell lines in the toxicology and ecotoxicology of fish.
Piscine cell lines in environmental toxicology. Biochemistry and Molecular
Biology of Fishes, 2005. 6: p. 43-84.
6. Lakra, W.S., T.R. Swaminathan, and K.P. Joy, Development, characterization,
conservation and storage of fish cell lines: a review. Fish physiology and
biochemistry, 2011. 37(1): p. 1-20.
7. ECVAM, E., EURL ECVAM status report on the development, validation and
regulatory acceptance of alternative methods and approaches (2013-April 2014),
2014, EURL ECVAM.
8. Tanneberger, K., et al., Predicting fish acute toxicity using a fish gill cell line-
based toxicity assay. Environmental science & technology, 2013. 47(2): p. 1110-
9.
9. Klapper, W., et al., Telomerase activity in 'immortal' fish. FEBS letters, 1998.
434(3): p. 409-12.
10. Caminada, D., C. Escher, and K. Fent, Cytotoxicity of pharmaceuticals found in
aquatic systems: comparison of PLHC-1 and RTG-2 fish cell lines. Aquatic
toxicology, 2006. 79(2): p. 114-23.
11. Fernandez, C., G. Carbonell, and M. Babin, Effects of individual and a mixture of
pharmaceuticals and personal-care products on cytotoxicity, EROD activity and
ROS production in a rainbow trout gonadal cell line (RTG-2). Journal of applied
toxicology : JAT, 2013. 33(11): p. 1203-12.
12. Schnell, S., et al., Single and combined toxicity of pharmaceuticals and personal
care products (PPCPs) on the rainbow trout liver cell line RTL-W1. Aquatic
toxicology, 2009. 93(4): p. 244-52.
13. Fent, K. and R. Bätscher, Cytochrome P4501A induction potencies of polycyclic
aromatic hydrocarbons in a fish hepatoma cell line: Demonstration of additive
interactions. Environmental Toxicology and Chemistry, 2000. 19(8): p. 2047-58.
14. Dayeh, V.R., K. Schirmer, and N.C. Bols, Applying whole-water samples directly
to fish cell cultures in order to evaluate the toxicity of industrial effluent. Water
research, 2002. 36(15): p. 3727-38.
15. Ekwall, B., Screening of toxic compounds in mammalian cell cultures. Annals of
the New York Academy of Sciences, 1983. 407(1): p. 64-77.
16. Segner, H., Fish cell lines as a tool in aquatic toxicology. EXS, 1998. 86: p. 1-38.
![Page 43: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/43.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
41
17. Huggett, R.J., et al., Biomarkers: biochemical, physiological, and histological
markers of anthropogenic stress. Vol. 121. 1992, Boca Raton, Florida: Lewis
Publishers.
18. Casals-Casas, C. and B. Desvergne, Endocrine disruptors: from endocrine to
metabolic disruption. Annual review of physiology, 2011. 73: p. 135-62.
19. Rubin, B.S., Bisphenol A: an endocrine disruptor with widespread exposure and
multiple effects. The Journal of steroid biochemistry and molecular biology, 2011.
127(1-2): p. 27-34.
20. van der Oost, R., J. Beyer, and N.P. Vermeulen, Fish bioaccumulation and
biomarkers in environmental risk assessment: a review. Environmental
toxicology and pharmacology, 2003. 13(2): p. 57-149.
21. Kim, D.K., et al., Orphan nuclear receptor estrogen-related receptor gamma
(ERRgamma) is key regulator of hepatic gluconeogenesis. The Journal of
biological chemistry, 2012. 287(26): p. 21628-39.
22. Eichner, L.J. and V. Giguere, Estrogen related receptors (ERRs): a new dawn in
transcriptional control of mitochondrial gene networks. Mitochondrion, 2011.
11(4): p. 544-52.
23. Eales, J.G., et al., Deiodination as an index of chemical disruption of thyroid
hormone homeostasis and thyroidal status in fish, in Environmental Toxicology
and Risk Assessment1999, University of Manitoba. p. 136-64.
24. Morgado, I.M.S., Transthyretin and thyroid hormone transport in fish and the
effect of endocrine disruptors in this process, in Molecular Biology2007,
Universidade do Algarve.
25. Chan, W.K. and K.M. Chan, Disruption of the hypothalamic-pituitary-thyroid
axis in zebrafish embryo-larvae following waterborne exposure to BDE-47,
TBBPA and BPA. Aquatic toxicology, 2012. 108: p. 106-11.
26. Gentilcore, D., et al., Bisphenol A interferes with thyroid specific gene expression.
Toxicology, 2013. 304: p. 21-31.
27. Wetherill, Y.B., et al., In vitro molecular mechanisms of bisphenol A action.
Reproductive toxicology, 2007. 24(2): p. 178-98.
28. Zhai, W., et al., Thyroid endocrine disruption in zebrafish larvae after exposure
to mono-(2-ethylhexyl) phthalate (MEHP). PloS one, 2014. 9(3): p. e92465.
29. Fent, K., Fish cell lines as versatile tools in ecotoxicology: assessment of
cytotoxicity, cytochrome P4501A induction potential and estrogenic activity of
chemicals and environmental samples. Toxicology in vitro : an international
journal published in association with BIBRA, 2001. 15(4-5): p. 477-88.
30. Tanneberger, K., et al., Effects of solvents and dosing procedure on chemical
toxicity in cell-based in vitro assays. Environmental science & technology, 2010.
44(12): p. 4775-81.
31. Baron, M.G., et al., Towards a more representative in vitro method for fish
ecotoxicology: morphological and biochemical characterisation of three-
dimensional spheroidal hepatocytes. Ecotoxicology, 2012. 21(8): p. 2419-29.
32. Krovel, A.V., et al., Development of a co-culture model for in vitro toxicological
studies in Atlantic salmon. Toxicology in vitro : an international journal published
in association with BIBRA, 2011. 25(5): p. 1143-52.
![Page 44: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/44.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
42
33. Bury, N.R., S. Schnell, and C. Hogstrand, Gill cell culture systems as models for
aquatic environmental monitoring. The Journal of experimental biology, 2014.
217(Pt 5): p. 639-50.
34. Trubitt, R.T., et al., Transepithelial resistance and claudin expression in trout
RTgill-W1 cell line: effects of osmoregulatory hormones. Comparative
biochemistry and physiology. Part A, Molecular & integrative physiology, 2015.
182: p. 45-52.
35. Drieschner, C., Development and characterization of a piscine intestinal barrier
model using the fish cell line RTgutGC, in Environmental Toxicology2011,
University of Konstanz, ETH-Zürich: Konstanz. p. 68.
36. Catinot, T., Effects of silver nanoparticles in a rainbow trout cell line, in
Ecotoxicology2014, University of Maine, University of Gothenburg: Le Mans. p.
43.
37. Wolf, K. and G. Rumsey, The representative research animal: why rainbow trout
(Salmo gairdneri Rich.)? Journal of Applied Ichthyology 1985. 1(3): p. 131-8.
38. Evans, D.H., P.M. Piermarini, and K.P. Choe, The multifunctional fish gill:
dominant site of gas exchange, osmoregulation, acid-base regulation, and
excretion of nitrogenous waste. Physiological reviews, 2005. 85(1): p. 97-177.
39. Lee, L.E., et al., Applications and potential uses of fish gill cell lines: examples
with RTgill-W1. In vitro cellular & developmental biology. Animal, 2009. 45(3-
4): p. 127-34.
40. Bols, N.C., et al., Development of a cell line from primary cultures of rainbow
trout, Oncorhynchus mykiss (Walbaum), gills. Journal of Fish Diseases, 1994.
17(6): p. 601-11.
41. Lee, L.E., et al., Fish cell lines as rapid and inexpensive screening and
supplemental tools for whole effluent testing. Integrated environmental
assessment and management, 2008. 4(3): p. 372-4.
42. Lee, L.E., et al., High yield and rapid growth of Neoparamoeba pemaquidensis in
co-culture with a rainbow trout gill-derived cell line RTgill-W1. Journal of fish
diseases, 2006. 29(8): p. 467-80.
43. Dorantes-Aranda, J.J., et al., Novel Application of a fish gill cell line assay to
assess ichthyotoxicity of harmful marine microalgae. Harmful Algae, 2011. 10: p.
366-73.
44. Schirmer, K., et al., Ability of 16 priority PAHs to be photocytotoxic to a cell line
from the rainbow trout gill. Toxicology, 1998. 127(1-3): p. 143-55.
45. Schirmer, K., et al., Ability of 16 priority PAHs to be directly cytotoxic to a cell
line from the rainbow trout gill. Toxicology, 1998. 127(1-3): p. 129-41.
46. Lee, L.E., et al., Development and characterization of a rainbow trout liver cell
line expressing cytochrome P450-dependent monooxygenase activity. Cell
biology and toxicology, 1993. 9(3): p. 279-94.
47. Nehls, S. and H. Segner, Detection of DNA damage in two cell lines from rainbow
trout, RTG-2 and RTL-W1, using the comet assay. Environmental toxicology,
2001. 16(4): p. 321-9.
48. Kosmehl, T., et al., Comparative genotoxicity testing of Rhine river sediment
extracts using the Comet assay with permanent fish cell lines (RTG-2 and RTL-
W1) and the Ames test. Journal of Soils and Sediments, 2004. 4(2): p. 84-94.
![Page 45: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/45.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
43
49. Thibaut, R., S. Schnell, and C. Porte, Assessment of metabolic capabilities of
PLHC-1 and RTL-W1 fish liver cell lines. Cell biology and toxicology, 2009.
25(6): p. 611-22.
50. Dayeh, V.R., et al., The use of fish-derived cell lines for investigation of
environmental contaminants: an update following OECD's fish toxicity testing
framework No. 171. Current protocols in toxicology / editorial board, Mahin D.
Maines, 2013. Chapter 1: p. Unit1 5.
51. Bopp, S.K. and T. Lettieri, Comparison of four different colorimetric and
fluorometric cytotoxicity assays in a zebrafish liver cell line. BMC pharmacology,
2008. 8: p. 8.
52. Cedergreen, N., et al., A review of independent action compared to concentration
addition as reference models for mixtures of compounds with different molecular
target sites. Environmental toxicology and chemistry / SETAC, 2008. 27(7): p.
1621-32.
53. Thornton, B. and C. Basu, Real-Time PCR (qPCR) primer design using free
online software. Laboratory exercise. Biochemistry and Molecular Biology
Eduction, 2011. 39(2): p. 145-54.
54. Heinrich, P., et al., Improving the in vitro ethoxyresorufin-O-deethylase (EROD)
assay with RTL-W1 by metabolic normalization and use of beta-naphthoflavone
as the reference substance. Comp Biochem Physiol C Toxicol Pharmacol, 2014.
164: p. 27-34.
55. Morck, T.J., et al., Placental transport and in vitro effects of Bisphenol A.
Reproductive toxicology, 2010. 30(1): p. 131-7.
56. Flemming, C.A. and J.T. Trevors, Copper toxicity and chemistry in the
environment: a review. Water, Air, and Soil Pollution, 1989. 44(1-2): p. 143-58.
57. Bopp, S.K., H.K. Abicht, and K. Knauer, Copper-induced oxidative stress in
rainbow trout gill cells. Aquatic toxicology, 2008. 86(2): p. 197-204.
58. Bain, P.A. and A. Kumar, Cytotoxicity of binary mixtures of human
pharmaceuticals in a fish cell line: approaches for non-monotonic concentration-
response relationships. Chemosphere, 2014. 108: p. 334-42.
59. Contardo-Jara, V., et al., The beta-receptor blocker metoprolol alters
detoxification processes in the non-target organism Dreissena polymorpha.
Environmental pollution, 2010. 158(6): p. 2059-66.
60. Huggett, D.B., et al., Toxicity of select beta adrenergic receptor-blocking
pharmaceuticals (B-blockers) on aquatic organisms. Archives of environmental
contamination and toxicology, 2002. 43(2): p. 229-35.
61. SIDS, O., SIDS Initial Assessment Report for 12th SIAM, Tributyl phosphate,
2001, UNEP: Paris.
62. Dave, G., H. Blanck, and K. Gustafsson, Biological effects of solvent extraction
chemicals on aquatic organisms. Journal of Chemical Technology and
Biotechnology, 1979. 29(4): p. 249-57.
63. Dave, G., et al., Toxicity of eight solvent extraction chemicals and of cadmium to
water fleas, Daphnia magna, rainbow trout, Salmo gairdneri, and zebrafish,
Brachydanio rerio. Comparative Biochemistry and Physiology Part C:
Comparative Pharmacology, 1981. 69(1): p. 83-98.
![Page 46: Fish cell lines and their potential uses in ecotoxicology: from … · 2015-08-18 · vivo testing in the case of human health studies2. The use of in silico methods such as QSARs](https://reader036.vdocument.in/reader036/viewer/2022070721/5ee159c6ad6a402d666c43cf/html5/thumbnails/46.jpg)
Fabienne Roux Master thesis in Ecotoxicology 2014-2015
44
64. Ekwall, B., C. Nordensten, and L. Albanus, Toxicity of 29 plasticizers to HeLa
cells in the MIT-24 system. Toxicology, 1982. 24(3-4): p. 199-210.
65. Backhaus, T., A. Arrhenius, and H. Blanck, Toxicity of a mixture of dissimilarly
acting substances to natural algal communities: predictive power and limitations
of independent action and concentration addition. Environmental science &
technology, 2004. 38(23): p. 6363-70.
66. Backhaus, T. and M. Faust, Predictive environmental risk assessment of chemical
mixtures: a conceptual framework. Environmental science & technology, 2012.
46(5): p. 2564-73.
67. Belz, R.G., N. Cedergreen, and H. Sorensen, Hormesis in mixtures -- can it be
predicted? The Science of the total environment, 2008. 404(1): p. 77-87.
68. Mankidy, R., et al., Biological impact of phthalates. Toxicology letters, 2013.
217(1): p. 50-8.
69. Martorell Ribera, J., Endocrine disrupting effects of bisphenol A, bisphenol S and
benzyl butyl-phthalate on the thyroid system of juvenile Brown trout (Salmo
trutta), in Zoophysiology2015, GU: Gothenburg.
70. Olsvik, P.A., et al., Transcriptional effects of nonylphenol, bisphenol A and
PBDE-47 in liver of juvenile Atlantic cod (Gadus morhua). Chemosphere, 2009.
75(3): p. 360-7.
71. Arukwe, A., et al., Effects of xenoestrogen treatment on zona radiata protein and
vitellogenin expression in Atlantic salmon (Salmo salar). Aquatic toxicology,
2000. 49(3): p. 159-170.
72. Navas, J.M. and H. Segner, Estrogen-mediated suppression of cytochrome
P4501A (CYP1A) expression in rainbow trout hepatocytes: role of estrogen
receptor. Chemico-biological interactions, 2001. 138(3): p. 285-98.
73. Grans, J., B. Wassmur, and M.C. Celander, One-way inhibiting cross-talk
between arylhydrocarbon receptor (AhR) and estrogen receptor (ER) signaling in
primary cultures of rainbow trout hepatocytes. Aquatic toxicology, 2010. 100(3):
p. 263-70.
74. Lindholst, C., S.N. Pedersen, and P. Bjerregaard, Uptake, metabolism and
excretion of bisphenol A in the rainbow trout (Oncorhynchus mykiss). Aquatic
toxicology, 2001. 55(1-2): p. 75-84.
75. Lindholst, C., et al., Metabolism of bisphenol A in zebrafish (Danio rerio) and
rainbow trout (Oncorhynchus mykiss) in relation to estrogenic response.
Comparative biochemistry and physiology. Toxicology & pharmacology : CBP,
2003. 135(2): p. 169-77.