Transcript
Page 1: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Forensic DNA Analysis (Part I)

Page 2: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Summary

What is DNA?

Where is DNA found in the body?

How does DNA differ among individuals?

Forensic DNA Analysis

DNA and Statistics

Page 3: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

What is DNA?

Page 4: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

What is DNA?

What does DNA stand for?

What does DNA do? DNA contains genetic information. DNA codes for the proteins our bodies make

that are necessary for survival.

Deoxyribose Nucleic Acid or Deoxyribonucleic Acid

Page 5: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

What is DNA?

DNA is a code for making proteins.

AGC TAG CTT ATA CTC TAT CTC TTT

AminoAcid

AminoAcid

AminoAcid

AminoAcid

AminoAcid

AminoAcid

The order of amino acids determines what type of protein is made.

Page 6: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Some common proteins are:

Hemoglobin - carries oxygen from lungs to cells Insulin - regulates metabolism Many types of enzymes - catalyze reactions in the

body, such as the breakdown of sugar for energy

DNA also determines how much of these proteins each cell makes.

What is DNA?

Page 7: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

What does DNA look like?

Double Helix Like a Twisted Ladder

What is DNA?

Page 8: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Sugar PhosphateBackbone

(Sides of Ladder)

NitrogenousBase

(Rungs of Ladder)

What is DNA?

What does DNA look like?

Page 9: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

The DNA ladder is made up of building blocks called nucleotides.

What is a nucleotide?

Phosphate Group

Deoxyribose sugar

Base

AdenineCytosineGuanineThymine

What is DNA?

Page 10: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

The 4 Bases

AAdenine

GGuanine

CCytosine

TThymine

What is DNA?

Page 11: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

G

C

T

A

What is DNA?

The 4 Bases

Page 12: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

A pairs with T

G pairs with C

The bases pair up to form the rungs of the ladder.

What is DNA?

The 4 Bases

Page 13: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

DNA is written as the sequence of these bases:

AAGTCGATCGATCATCGATCATACGT

What is DNA?

Only one side of the ladder is written.

In humans, there are three billion (3,000,000,000) base pairs (letters) in the DNA within each cell.

Page 14: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Among humans, most of the 3 billion bases in the DNA sequence are exactly the same.

Our Human DNA is 99.8% similar to each other, but the 0.2% difference is more than enough to distinguish us from one another.

NO TWO PEOPLE HAVE IDENTICAL DNA**except identical twins

What is DNA?

Human DNA is even 98% similar to chimpanzees.

Page 15: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference.

If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide.

If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).

What is DNA?

Stupid Facts:

Page 16: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Where is DNA?

Page 17: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Where is DNA?

DNA is found in the cells in our body.

Nucleus(Brain of the cell)

Mitochondria(more later)

Page 18: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

K-Fed sez:

Quiz on Monday.

Page 19: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

All types of cells in our body contain a copy of the same DNA.*

Some cells important to forensic science are:

White Blood Cell *Sperm Cell Cheek Cell

Where is DNA?

Page 20: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

DNA in the nucleus is packaged into Chromosomes.

Where is DNA?

Page 21: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

(one from Mother)

(one from Father)

Chromosomes

come in pairs

There are 46 chromosomes in

each cell. (23 pairs)

Where is DNA?

Page 22: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

What are sources of DNA at a crime scene?

DNA can be recovered from any substance that contains cells.

Where is DNA?

Blood Semen Saliva Tissue

Bone Teeth Hair Maggot Crops

Page 23: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Maggot Crop

Where is DNA?

Page 24: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

How does DNA differ among Humans?

Page 25: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

DNA is a sequence of 4 possible letters

GA C T

Of the 3 billion letters, 99.8% of the sequence in all humans is identical.

There are several ways the sequence can be different.

How does DNA differ among humans?

Page 26: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

1. One of the bases (letters) can be different.

Person 2 AGCTAGATCGTCATTCCGAGPerson 1 AGCTAGATCGTTATTCCGAG

How does DNA differ among humans?

Page 27: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Person 1 AGCTAGATCGTTATTCCGAGPerson 2 AGCTAGATCGTATTCCGAGPerson 3 AGCTAGATCGTTTATTCCGAGPerson 4 AGCTCCGAG

How does DNA differ among humans?

2. Bases (letters) can be added or removed.

Page 28: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Person 1 AGCTAGATCGTTATTCCGAGPerson 2 AGCTAGATCGTATTCCGAGPerson 3 AGCTAGATCGTTTATTCCGAGPerson 4 AGCTCCGAG

How does DNA differ among humans?

2. Bases (letters) can be added or removed.

Page 29: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..

How does DNA differ among humans?

3. Regions of DNA can be repeated a different # of times.

Page 30: Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA

How does DNA differ among humans?

3. Regions of DNA can be repeated a different # of times.

Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..1 2 3 4 5 6

Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT..

Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..

1 2 3 4 5

1 2 3 4 5 6 7


Top Related