Transcript
Page 1: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

Gene Expression I:Transcription and RNA Processing

6 November, 2002Text Chapter 17

Page 2: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

•Usually, dominant alleles are recipes for functional proteins.

•Recessive alleles are altered recipes that produce non-functional proteins.

Think about flower color in pea plants.

Substrate (colorless) Product (purple)

The P allele is a recipe for a functional enzyme. The p allele is a recipe for a non-functional enzyme. Purple is dominant because one copy of a functional recipe is enough.

Enzyme P

In the analogous situation in snapdragons, one copy is not enough, And an intermediate phenotype is seen.

At the molecular level, both functional and non-functional proteins are present. This is more like codominance.

Page 3: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17
Page 4: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

Neurospora crassa is a fungus that can grow on minimal medium. This means that it can synthesize all of the amino acids, including arginine, from simple precursors.

The biochemical pathway specific to arginine synthesis consists of three enzymes. Arginine auxotrophs are deficient in one of these enzymes.

Page 5: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

In prokaryotes, this is a two-step process. Eukaryotes add an RNA processing step.

Genes are the instructions for making proteins.

Page 6: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

mRNA molecules are complementary to the template strand of the DNA.

Codons are 3-letter genetic words that specify amino acids.

Proteins are linear polymers of amino acids.

Page 7: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

The code is not delimited (there is no punctuation).

This means that in any RNA, there are three possible reading frames.

auaugauucuucgauaacaa uau gau ucu ucg aua acaau aug auu cuu cga uaa caaua uga uuc uuc gau aac aauAUGauucuucgauaaca Met-Ile-Leu-Arg-*

Codons are read as non-overlapping three-letter words.

Page 8: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

The genetic code is redundant - most amino acids are coded by more than one of the 64 possible codons.

The genetic code is not ambiguous - no codon codes for more than one amino acid.

The genetic code is universal - all organisms use the same code, indicating that the code evolved once, early in the history of life.

An important implication of the universal code is that genes code for the same protein sequence in any organism.

The Genetic Code

Page 9: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17
Page 10: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

Transcription begins when protein transcription factors bind at the promoter. These proteins allow RNA polymerase to bind and unwind the DNA at the transcription start site.

Transcription Factors

Page 11: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

These modifications include a modified nucleotide cap at the 5’ end, and a poly-A tail added to the 3’ end of the completed transcript.

Eukaryotes modify the pre-mRNA after transcription.

Page 12: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

Most eukaryotic genes are spliced - introns are removed, and exons (coding regions) are joined

Page 13: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

Introns are removed when spliceosome RNA pairs with signal sequences at the ends of the intron. The spliceosome then joins the exons that flank the removed intron.

Many mRNAs can potentially code for a number of different proteins, depending on which exons end up in the final mRNA,

Page 14: Gene Expression I: Transcription and RNA Processing 6 November, 2002 Text Chapter 17

Top Related