Transcript
Page 1: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Genetics:Gene Mutations and DNA Repair

Page 2: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

INTRODUCTION

The term mutation refers to a heritable change in the genetic material

Mutations provide allelic variations On the positive side, mutations are the foundation

for evolutionary change E.g. Light skin in high latitude human populations

On the negative side, mutations are the cause of many diseases

E.g. Hemophilia

Page 3: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

DNA Maintenance

Mutation rate are extremely low

1 mutation out of 109 nucleotides per generation

Page 4: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Mutations can be divided into three main types 1. Chromosome mutations

Changes in chromosome structure 2. Genome mutations

Changes in chromosome number 3. Single-gene mutations

Relatively small changes in DNA structure that occur within a particular gene

Type 3 will be discussed in this set of lecture notes

CONSEQUENCES OF MUTATIONS

Page 5: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

A point mutation is a change in a single base pair It involves a base substitution

Gene Mutations Change the DNA Sequence

5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’

5’ AACGCGAGATC 3’3’ TTGCGCTCTAG 5’

A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine

A transversion is a change of a pyrimidine to a purine or vice versa

Transitions are more common than transversions

Page 6: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic
Page 7: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

10 μmNormal red blood cells Sickled red blood cells

10 μm

(a) Micrographs of red blood cells

: NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – GLUTAMIC ACID – GLUTAMIC ACID...

: NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – VALINE– GLUTAMIC ACID...

(b) A comparison of the amino acid sequence between normal -globin and sickle-cell -globin

NORMAL

SICKLECELL

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

© Phototake/Alamy © Phototake/Alamy

7

Page 8: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Mutations may also involve the addition or deletion of short sequences of DNA

5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’

5’ AACGCTC 3’3’ TTGCGAG 5’

5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’

5’ AACAGTCGCTAGATC 3’3’ TTGTCAGCGATCTAG 5’

Deletion of four base pairs

Addition of four base pairs

Page 9: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Silent mutations are those base substitutions that

do not alter the amino acid sequence of the polypeptide

Due to the degeneracy of the genetic code E.g. AUU to AUC still codes for Ile

Missense mutations are those base substitutions in which an amino acid change does occur

Example: Sickle-cell anemia If the substituted amino acid does not affect protein

function (as measured by phenotype), the mutation is said to be neutral

Gene Mutations Can Alter the Coding Sequence Within a Gene

Page 10: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Nonsense mutations are those base substitutions that change a normal codon to a termination codon

Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two

This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation

Page 11: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic
Page 12: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

In a natural population, the wild-type is the most common genotype (may be encoded by a dominant or recessive allele)

A forward mutation changes the wild-type genotype into some new variation If it is beneficial, it may move evolution forward Otherwise, it will be probably eliminated from a

population A reverse mutation has the opposite effect

It is also termed a reversion (changes mutant back to wild-type)

Gene Mutations and Their Effects on Genotype and Phenotype

Page 13: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Mutations can also be described based on their effects on the wild-type phenotype When a mutation alters an organism’s phenotypic

characteristics, it is said to be a variant Variants are often characterized by their differential

ability to survive Deleterious mutations decrease the chances of survival

The most extreme are lethal mutations E.g. Homozygous polydactyly in cats

Beneficial mutations enhance the survival or reproductive success of an organism

Some mutations are called conditional mutants They affect the phenotype only under a defined set of

conditions (such as temp affecting wild type and mutant bacteria)

Page 14: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic
Page 15: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

A second mutation will sometimes affect the phenotypic expression of another

These second-site mutations are called suppressor mutations or simply suppressors

Suppressor mutations are classified into two types Intragenic suppressors

The second mutant site is within the same gene as the first mutation

Intergenic suppressors The second mutant site is in a different gene from the first

mutation

Page 16: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

These mutations can still affect gene expression A mutation, may alter the sequence within a promoter

Up promoter mutations make the promoter more like the consensus sequence

They may increase the rate of transcription Down promoter mutations make the promoter less like the

consensus sequence They may decrease the rate of transcription

Probably responsible for most differences between closely-related organisms (e.g. humans and chimps)

A mutation can also alter splice junctions in eukaryotes

Gene Mutations in Non-coding Sequences

Page 17: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-13

(3'-UTR) is the section of messenger RNA (mRNA) that immediately follows the translation termination codon.

Page 18: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) The term refers to the phenomenon that a sequence of

3 nucleotides can increase from one generation to the next

These diseases include Huntington disease (HD) Fragile X syndrome (FRAXA)

Mutations Due to Trinucleotide Repeats

Page 19: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic
Page 20: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Certain regions of the chromosome contain trinucleotide sequences repeated in tandem In normal individuals, these sequences are transmitted

from parent to offspring without mutation However, in persons with TRNE disorders, the length of a

trinucleotide repeat increases above a certain critical size It also becomes prone to frequent expansion This phenomenon is shown here with the trinucleotide repeat

CAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

n = 11

n = 18

Page 21: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

In some cases, the expansion is within the coding sequence of the gene Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of

glutamine This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease

In other cases, the expansions are located in noncoding regions of genes These expansions are hypothesized to cause abnormal

changes in RNA structure Thereby producing disease symptoms

Page 22: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

A chromosomal rearrangement may affect a gene because the break occurred in the gene itself

A gene may be left intact, but its expression may be altered because of its new location This is termed a position effect Movement may be next to a regulatory sequence or into

into a heterochromatic region and now expressed.

Changes in Chromosome Structure Can Affect Gene Expression

Page 23: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Figure 16.2

Regulatory sequences are often bidirectional

Page 24: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Geneticists classify the animal cells into two types Germ-line cells

Cells that give rise to gametes such as eggs and sperm Somatic cells

All other cells Germ-line mutations are those that occur directly in a

sperm or egg cell, or in one of their precursor Somatic mutations are those that occur directly in a

body cell, or in one of its precursor cells

Mutations Can Occur in Germ-Line or Somatic Cells

Page 25: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Figure 16.4

Therefore, the mutation can be

passed on to future generations

The size of the patch will depend on the timing of the mutation

The earlier the mutation, the larger the patch

An individual who has somatic regions that are genotypically different

from each other is called a genetic mosaic

Therefore, the mutation cannot be passed on to future generations

Page 27: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Mutations can occur spontaneously or be induced

Spontaneous mutations Result from abnormalities in cellular/biological processes

Errors in DNA replication, for example

Induced mutations Caused by environmental agents Agents that are known to alter DNA structure are termed

mutagens These can be chemical or physical agents

Refer to Table 16.4

OCCURRENCE AND CAUSES OF MUTATION

Page 28: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic
Page 29: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Are mutations spontaneous occurrences or causally related to environmental conditions? This is a question that biologists have asked

themselves for a long time

Jean Baptiste Lamarck Proposed that physiological events (e.g. use and disuse)

determine whether traits are passed along to offspring Charles Darwin

Proposed that genetic variation occurs by chance Natural selection results in better-adapted organisms

Spontaneous Mutations Are Random Events

Page 30: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Joshua and Ester Lederberg were also interested in the relation between mutations and the environment

At that time (1950s), there were two new theories Directed mutation theory

Selected conditions could promote the formation of specific mutations allowing the organism to survive

This was consistent with Lamarck’s viewpoint

Random mutation theory Environmental factors simply select for the survival of those

individuals that happen to possess beneficial mutations This was consistent with Darwin’s viewpoint

Random Mutations Can Give an Organism a Survival Advantage

Page 31: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Spontaneous mutations can arise by three types of chemical changes

1. Depurination

2. Deamination

3. Tautomeric shift

Causes of Spontaneous Mutations

The most common

Page 32: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Depurination involves the removal of a purine (guanine or adenine) from the DNA The covalent bond between deoxyribose and a purine

base is somewhat unstable It occasionally undergoes a spontaneous reaction with water

that releases the base from the sugar

Fortunately, these can be repaired However, if the repair system fails, a mutation may result

during subsequent rounds of DNA replication

Causes of Spontaneous Mutations

Page 33: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Spontaneous depurinationFigure 16.8

Three out of four (A, T and G) are the incorrect nucleotideThere’s a 75% chance

of a mutation

Page 34: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Deamination involves the removal of an amino group from the cytosine base The other bases are not readily deaminated

Figure 16.9

DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it

However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication

Page 35: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Deamination of 5-methyl cytosine can also occur

Thymine is a normal constituent of DNA This poses a problem for repair enzymes

They cannot determine which of the two bases on the two DNA strands is the incorrect base

For this reason, methylated cytosine bases tend to create hot spots for mutation

Figure 16.9

Page 36: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

A tautomeric shift involves a temporary change in base structure

These rare forms promote AC and GT base pair

For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication

Page 37: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Figure 16.10

RareCommon

Page 38: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Figure 16.10

Page 39: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

16-42Figure 16.10

Temporary tautomeric shift

Shifted back to its normal fom

Page 40: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

An enormous array of agents can act as mutagens to permanently alter the structure of DNA

The public is concerned about mutagens for two main reasons: 1. Somatic mutagens are often involved in the

development of human cancers 2. Germ-line mutations may have harmful effects in

future generations Mutagenic agents are usually classified as

chemical or physical mutagens

Types of Mutagens

Page 41: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-53

Page 42: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Nonionizing radiation Includes UV light Has less energy Cannot penetrate deeply

into biological molecules Causes the formation of

cross-linked thymine dimers

Thymine dimers may cause mutations when that DNA strand is replicated

Figure 16.15

Page 43: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

43

Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Page 44: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

DNA Repair All species have a variety of DNA

repair systems to avoid the harmful effects of mutations.

Excision repair recognizes and removes a damaged base or damaged segments of DNA.

Base mismatch repair recognizes a base mismatch and removes a segment of the DNA strand with the incorrect base.

Page 45: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Mismatch Repair

Page 46: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Excision Repair

Page 47: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

DNA polymerase replaces missing or damaged bases.

Page 48: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Mutant Hemoglobin Lab

Page 49: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic

Top Related