Download - Genetics lab paper
![Page 1: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/1.jpg)
Identi'ication and Characterization of the Drosophila retinal degeneration B 205 (rdgB205)
Gene as a Phosphoinositol Transfer Protein.
ABSTRACT
The retinal degeneration B 205 (rdgB205) gene in Drosophila causes retinal degeneration
of photoreceptor cells in the eye in response to light. We aimed to identify and characterize a
mutation in the phosphatidylinositol transfer protein (PITP) domain as a factor resulting in
retinal degeneration in rdgB205 mutants. Chromosome and deletion mapping resulted in the
determination of the rdgB205 gene being located in the 12B-‐C region of the X chromosome. A
complementation test resulted in the identiFication of rdgB205 as an allele of the known gene
rdgB. Mutations to the genes norpA and ninaE caused the suppression of the rdgB205 phenotype,
suggesting that rdgB205 functions downstream of these two genes in the phototransduction
cascade. The PITP domain was ampliFied using PCR and the product was electrophoresed to
ensure that the selected 567 base pair fragment of the 834 base pair rdgB205 gene was properly
cloned. Sequencing of this fragment resulted in the discovery of a point mutation at base pair 175
which caused adenine to be replaced by guanine, resulting in a non-‐conservative, missense
mutation at amino acid 58 where glutamic acid was replaced by glycine. We also compared rdgB
in Drosophila to the rat brain PITP domain and determined the 58th amino acid was not
evolutionarily conserved. Immunolocalization in Drosophila head sections revealed that the
location of expression between wild type and rdgB205 mutants had not changed, suggesting a
loss of function producing the rdgB205 phenotype rather than a lack of expression. These results
suggest that rdgB205 functions as a PITP domain due to its allelism with rdgB and similar
expression of their respective proteins.
![Page 2: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/2.jpg)
![Page 3: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/3.jpg)
INTRODUCTION
The retinal degeneration B 205 (rdgB205) gene in Drosophila encodes a
phosphatidylinositol transfer protein (PITP) that is essential to proper functioning of the
phototransduction cascade and prevention of retinal degeneration (Milligan 1997). The
Drosophila eye is composed of about 800 ommatidia, which contain eight photoreceptor cells
each. Photoreceptor cells contain a cell body and a rhabdomere, which is Filled with the
membrane protein rhodopsin. The rdgB205 protein is localized adjacent to the rhabdomeres, in
the subrhabdomeric cisternae (SRC) (Vihtelic 1993). Retinal degeneration is caused by the death
of these photoreceptor cells that will lead to blindness in the Flies.
In Drosophila, several genes involved in the phototransduction cascade are known to
cause the failure of photoreceptor cells leading to retinal degeneration. One of these genes, ninaE,
is characterized by a failure to produce functional rhodopsin in the photoreceptor cells R1-‐6
(Vihtelic 1991). Another gene, norpA, encodes the phototransduction effector molecule
phospholipase C (VIhtelic 1991). Suppression of the rdgB phenotype in the presence of a
mutated ninaE or norpA gene suggests that rdgB functions downstream of phospholipase C in the
phototransduction cascade (Vihtelic 1993). Further evidence suggests that rdgB does not
function directly downstream of phospholipase C, but instead is mediated by a mechanism
related to the regeneration of phosphatidylinositol 4,5-‐diphosphate (PIP2) (Vihtelic 1993). The
current proposed mechanism involves the hydrolyzation of PIP2 into inositol 1,4,5-‐triphosphate
(IP3) and diaglycerol (DAG), followed by a multistep process that results in DAG being converted
back into PIP2 (Wang and Montell 2007). During this multistep process, PITP (encoded by rdgB)
promotes the transfer of phosphoinoside (PI) from the SRC back into the rhabdomeres for
phosphorylation of PI into PIP2 (Wang and Montell 2007). A lack of being able to transport PI
back into the rhabdomere for phosphorylation is a proposed effect of the rdgB mutation leading
![Page 4: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/4.jpg)
![Page 5: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/5.jpg)
to retinal degeneration. This model is consistent with rdgB’s localization to the SRC membrane,
but PI transfer has not been proven to be the critical activity in producing rdgB-‐type retinal
degeneration (Paetkau 1999).
Since rdgB encodes an integral membrane protein that may bind calcium (Vihtelic 1993),
it has been proposed that the gene may play a role in maintaining the functionality of the
rhabdomere by transporting membrane proteins to the rhabdomere and acting as a source of the
Ca2+ release following phototransduction (Vihtelic 1993). The functionality of the SRC
membrane as an intracellular Ca2+ store has led to experimentation that suggests that either the
rdgB protein may alter intracellular Ca2+ levels or is regulated by Ca2+ (Paetkau 1999). Further,
a mutation to the light activated calcium channel called trp resulted in slowed rdgB degeneration
(Paetkau 1999). Another study showed that blocking the calcium channels slowed the rdgB-‐type
degeneration, suggesting that an increase in intracellular Ca2+ via the calcium channels may lead
to rdgB-‐type degeneration (Sahly 1992). This is in contrast to inaC (encoded by protein kinase C,
PKC), which does not slow rdgB-‐type retinal degeneration (Paetkau 1999). This data supports
that PKC is not directly upstream of rdgB and that Ca2+ entry into photoreceptors stimulates
rdgB degeneration (Paetkau 1999).
Our study aims to identify and characterize the function of an EMS-‐induced mutant
allele of rdgB, rdgB205. We know that rdgB-‐type retinal degeneration is involved with the PITP
domain, so we targeted that area of the rdgB gene for examination. PCR ampliFication of a 567
base pair fragment of the PITP domain of rdgB205 as well as DNA sequencing allowed for
comparison to the wild-‐type rdgB gene resulting in the discovery of a nonconservative missense
mutation in the amino acid sequence. The mutation was compared with the rat brain PITP
domain and was determined to be not evolutionarily conserved. Immunolocalization, which
showed the location of the protein expression in the mutant rdgB205 head section versus a wild
![Page 6: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/6.jpg)
![Page 7: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/7.jpg)
type, showed that the rdgB205 protein was expressed in the same location as wild-‐type, but
suggests a loss of functionality due to the mutation. RdgB205’s allelic nature to rdgB as well as its
sequence identity with the rat brain PITP (Vihtelic 1993) serve to suggest its function as a PITP.
MATERIALS AND METHODS
Deep Pseudopupil Analysis: By placing Flies under a light microscope, it is possible to
fully examine the individual rhabdomeres within the ommatidia of the compound eye. The deep
pseudopupil itself represents virtual images of the rhabdomere patterns from several ommatidia
that are observed head on. A wild-‐type deep pseudopupil exhibits a trapezoidal shape, composed
of seven dots which indicate seven of the eight individual rhabdomeres of the ommatidia, one of
which always being distal to the observer and therefore unable to be seen. Deep pseudopupils
showing signs of retinal degeneration have blurry, scattered, dull, or fewer than seven
rhabdomeres visible.
Chromosome Mapping: rdgB205 females were mated to balancer males (X/Y; SM1/Sco;
TM2/Sb). After 14 days, the F1 generation was examined for phenotypic markers Scutoid (Sco)
and Stubble (Sb), which were then examined for retinal degeneration via deep pseudopupil
analysis.
Deletion Mapping: rdgB205 males were mated to deFicient bar eye females (Df/FM6;
+/+; +/+). Four different deFiciencies were utilized: Df 1-‐ 966, breakpoints 11C – 11F; Df 2-‐ 967,
breakpoints 11D – 12A; Df 3-‐ 968, breakpoints 12A -‐12D; Df 4-‐ 969, breakpoints 12D – 12F. After
14 days, the female F1 progeny of each deletion mapping cross were examined for the phenotypic
![Page 8: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/8.jpg)
![Page 9: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/9.jpg)
marker heart eye, those of which were then examined for retinal degeneration via deep
pseudopupil analysis.
Complementation: rdgB205 females were crossed with males containing known retinal
degeneration mutations ( rdgB, rdgB/y; +/+; +/+). After 14 days, the F1 Flies were examined for
retinal degeneration via deep pseudopupil analysis.
Epistasis: rdgB205 Flies were crossed with ninaE and norpA mutant Flies in order to
create rdgB205, ninaE ( rdgB205/ninaE; +/+; +/+) and rdgB205, norpA (rdgB205/rdgB205; +/+;
norpA/norpA) double mutants. These double mutants were obtained and then examined for
retinal degeneration via deep pseudopupil analysis after 3-‐5 days of incubation under constant
light.
Genomic DNA Isolation and Ampli'ication: Genomic Drosophila DNA was isolated
following standard protocol (Whaley 2014). Primers for PCR were designed using the DNA
sequence of the rdgB gene and were ordered from the NCBI website. The forward primer used
had the sequence 5’-‐AAAAGAGTCGCGAGGAGAGC-‐3’ and the reverse primer had the sequence
5’-‐TTGTCTGCATGCCCCAGTAG-‐3’. Standard PCR via Taq Polymerase was carried out using the
designed primers in order to amplify a 567 base pair portion of the PITP region of the rdgB205
gene. The PCR cycling consisted of 30 total cycles: a six minute initial denaturing step at 95o C and
35 cycles of 30 seconds at 95oC, 60 seconds at 52oC, and 60 seconds at 65oC, followed by a ten
minute cycle at 65oC and then a Final 24 hour cycle at 4oC. The PCR product was then
electrophoresed on an 1% agarose gel.
DNA Ligation and E. Coli Transformation: After determining the concentration of the
PCR product from the gel electrophoresis, a ligation reaction was set up using a mixture of 1μl of
the fresh PCR product, 2.1 TOPO vector (Invitrogen), and distilled ddH2O. After Five minutes the
![Page 10: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/10.jpg)
![Page 11: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/11.jpg)
recombinant plasmid DNA was plated on LB/Amp-‐agar plates following standard procedure
(Whaley 2014). Two methods were used to select colonies that had been transformed and
contained the PCR product DNA insert: First, colonies were selected for ampicillin resistance. The
other selection process utilized the blue/white system of the LacZ gene in the presence of X-‐gal
media. One blue colony and three white colonies were selected and then run on a 1% agarose gel.
DNA Digest via ECOR1 Enzyme: Standard procedures were followed using the QIAprep®
Spin Miniprep Kit. Plasmid DNA was cut by mixing isolated plasmid DNA, EcoR1 10X buffer,
EcoR1 restriction enzyme, and distilled water and then incubating at 37oC for 45 minutes. Cut
plasmid DNA and lambda DNA standards were electrophoresed on a 1% agarose gel using 1X TBE
buffer for 55 minutes at 100V.
DNA Capillary Sequencing: Cells from white colony 2 were DNA sequenced via standard
automated capillary sequencing protocol using an ABI 3700 Prism sequencer (Whaley 2014).
Genomic DNA was then aligned with and compared to wild-‐type DNA at the nucleotide level via
the NCBI website. Both sequences were then translated and compared at the amino acid level.
Immunolocalization of the rdgB Protein: Flies were decapitated and the heads were
placed in Fix (4% paraformaldehyde, 5% sucrose) overnight at 4°C. 18 hours later, the Fix was
removed and the heads were suspended in 5% sucrose for 4 hours. Next, the 5% sucrose was
removed and the heads were suspended in 30% sucrose for 48 hours. The 30% sucrose was then
removed and replaced with 1:1 30% sucrose: OCT. Standard cryosectioning procedures were then
followed. Standard procedures for Immunolocalization via GFP were followed afterwards, and the
stained heads were examined under a Leica 400DM Fluorescence microscope (Whaley 2014).
![Page 12: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/12.jpg)
![Page 13: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/13.jpg)
RESULTS
Chromosome Mapping: In order to determine which chromosome rdgB205 was located
on, rdgB205 females were crossed with balancer males (X/Y; SM1/Sco; TM2/Sb) and the F1
generation was examined for phenotypic markers Stubble (Sb) and Scutoid (Sco), and those that
had those markers were examined for signs of retinal degeneration via deep pseudopupil
analysis. Only F1 males showed signs of retinal degeneration, thus indicating that the rdgB205
gene maps to the X chromosome.
Deletion Mapping: : In order to narrow down the rdgB205 locus to a small region along
the X chromosome, rdgB205 males were crossed with deFicient bar eye females (Df/FM6; +/+;
+/+). A total of four deFiciencies were analyzed (Containing breakpoints as mentioned in
Materials and Methods). Of the four deFiciency crosses analyzed, only the cross between rdgB205
males and Df 3-‐968 bar eye females (Df3/FM6; +/+; +/+) yielded Heart Eye females phenotypic
for retinal degeneration. Therefore, the rdgB205 gene should be located on the X chromosome
between breakpoints 12B -‐ 12C.
Complementation: In order to examine whether the rdgB205 gene was allelic to rdgB
since it maps to the same region, rdgB205 females were mated to rdgB males, and the F1
generation was examined for signs of retinal degeneration via deep pseudopupil analysis. F1 Flies
yielded offspring phenotypic for retinal degeneration, indicating that the two genes were
non-‐complementary, and therefore allelic.
Epistasis: In order to map rdgB205 within the phototransduction cascade, rdgB205 Flies
were crossed with ninaE and norpA mutant Flies in order to create rdgB205, ninaE
(rdgB205/ninaE; +/+; +/+) and rdgB205, norpA (rdgB205/rdgB205; +/+; norpA/norpA) double
mutants. These double mutants were obtained and then examined for signs of retinal
![Page 14: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/14.jpg)
![Page 15: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/15.jpg)
degeneration via deep pseudopupil analysis. Neither set of double mutants displayed any signs of
retinal degeneration, providing evidence that both ninaE and norpA are epistatically dominant to
rdgB205. This also suggests that rdgB205 is located downstream of both ninaE and norpA within
the phototransduction cascade, which allows us to map rdgB205 downstream of Phospholipase C
and Rhodopsin.
Genomic DNA Isolation and Ampli'ication: The ampliFied 567 base pair portion of the
PITP region of our genomic rdgB205 DNA, was run on an agarose gel in order to conFirm proper
ampliFication. In Figure 1, lane 205 shows clear banding of DNA at approximately the anticipated
567 base pair length. This suggests that we have correctly ampliFied the desired 567 base pair
portion of the PITP region of the rdgB205 gene, however until sequencing data is obtained there
is no way to conclude that this is in fact the correct region.
![Page 16: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/16.jpg)
![Page 17: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/17.jpg)
Figure 1. -‐-‐ Ampli'ied rdgB205 DNA run on 1% agarose gel showing ampli'ication of
a 567 base pair region of rdgB205. Lane 205 shows a single clear band at approximately 600
base pairs. Our desired region of the PITP region is 567 base pairs long. This would suggest that
the desired portion of the PITP region of the rdgB205 gene was correctly ampliFied, however
without sequencing data there is no way guarantee that this ampliFied DNA is the intended region
of rdgB205.
DNA Ligation and E. Coli Transformation: We performed DNA ligation into the TOPO
vector (Invitrogen) in order to insert the ampliFied 567 base pair portion of the PITP domain of
our rdgB205 gene into plasmid DNA. Cell colonies that were successfully transformed were
ampicillin resistant, allowing them to survive on the media containing ampicillin. Cell colonies
that had been ligated correctly due to lacZ inactivation showed up as white on the agar gel plates,
whereas those cells that had not been ligated successfully showed up as blue on the plate. 3 white
colonies and 1 blue colony were selected for gel electrophoresis on a 1% agarose gel. Blue colony
1, as expected, showed to be smaller in base pair length than white colonies 1 and 2 (Fig. 2.). This
is because plasmids not containing the DNA insert (blue colonies) would be shorter in length than
plasmids containing the insert (white colonies). Therefore, we can conclude that our ampliFied
portion of the rdgB205 gene was successfully inserted into the plasmid DNA within white
![Page 18: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/18.jpg)
![Page 19: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/19.jpg)
colonies 1 and 2. Since the white colony 3 electrophoresed identically to the blue colony, we can
also conclude that this colony was a false white, meaning that the ampliFied rdgB205 DNA was not
successfully inserted into the plasmid DNA within that colony.
![Page 20: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/20.jpg)
![Page 21: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/21.jpg)
Figure 2.-‐-‐ 1% agarose gel electrophoresis of transformed E. Coli DNA showing
successful ligation of the PCR insert.with 2.1 TOPO vector. (From left to right): lambda
standard, blue colony 1, white colony 1, white colony 2, white colony 3. The selected colonies
were run on an agarose gel to ensure that the rdgB205 DNA insert had been correctly ligated into
the TOPO vector. Blue colony 1, as expected, is smaller in base pair length than white colonies 1
and 2 due to the fact that it does not contain the DNA insert. We can conclude that our desired
portion of the rdgB205 gene was successfully inserted into the plasmid DNA within white
colonies 1 and 2. White colony 3 is anomalous because it is identical in size to Blue colony 1,
providing evidence that White colony 3 is a false white, and does not contain the rdgB205 DNA
insert.
DNA Digest via ECOR1 Enzyme: Plasmid DNA from all four selected colonies was
digested via the EcoR1 enzyme in order to cut the rdgB205 DNA insert out of the plasmid DNA.
The digested fragments were then electrophoresed on an agarose gel to ensure proper fragment
length. Fig. 3 shows two sets of bands in each lane, with one band being much larger at
approximate 5,000 in base pair length and the other much smaller at approximately 1,000 base
![Page 22: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/22.jpg)
![Page 23: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/23.jpg)
pairs in length. The larger band represents the plasmid DNA size and the smaller band
corresponds to the size of the rdgB205 DNA insert, providing evidence that the rdgB205 DNA
insert was successfully cloned and digested from plasmid DNA, and is ready for sequencing.
![Page 24: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/24.jpg)
![Page 25: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/25.jpg)
Figure 3.-‐-‐ 1% agarose gel electrophoresis of EcoR1-‐digested plasmid DNA showing
that the desired portion of the PITP region of rdgB205 was successfully inserted and
cloned within E. coli plasmids. All four colonies were digested via EcoR1 enzyme. Blue colony 1
contains only one band of approximately 4,000 base pairs because it did not contain an insert,
and therefore was only cut once. White colonies 1-‐3 each contain two bands of approximately
4,000 base pairs and 600 base pairs respectively, one representing the plasmid DNA and the other
corresponding to the rdgB205 DNA insert, From this we can conclude that the rdgB205 DNA was
successfully cloned and digested out of the plasmid DNA.
DNA Capillary Sequencing: In order to compare mutant rdgB205 DNA and wild-‐type
DNA of the 567 base pair portion of the PITP domain, cells from white colony 2 were sequenced
using standard automated capillary sequencing. The mutant rdgB205 DNA was aligned with and
compared to corresponding wild-‐type DNA, and both sequences were compared in order to
detect mutations within that region. We found one point mutation at base pair 175(adenine
changed to guanine)[Fig. 4.]. In order to further examine the effects of this point mutation, each
sequence was translated and compared at the amino acid level. The mutation at base pair 175
resulted in a nonconservative missense mutation at amino acid 58 (glutamic acid changed to
glycine), which could result in a loss of function due to improper protein folding because glutamic
acid contains a negatively charged side chain, whereas glycine is a special case amino acid (Fig. 5.)
This mutation does not seem to be evolutionarily conserved, as the corresponding amino acid
![Page 26: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/26.jpg)
![Page 27: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/27.jpg)
within the PITP domain of rats is a histidine as opposed to the mutant rdgB205 glycine (Vihtelic
1993).
RdgB205 Mutant DNA
AAAAGAGTCGCGAGGAGAGCCATGGCGAGGGCAGTGGCGTTGAGATAATCATCAATGAGCCGTACAAGGATGGACCCGGCGGTAATGGTCAATACACAAAGAAGATCTATCACGTGGGCAATCATCTGCCTGGCTGGATTAAAAGTCTCTTGCCGAAAAGCGCTTTAACCGTGGGGGAGGAGGCATGGAATGCCTATCCGTATACCAGGACTCGCTACACCTGTCCGTTTGTGGAGAAATTCTCGCTGGATATTGAGACATACTATTATCCGGACAATGGCTATCAGGACAATGTCTTCCAGCTGTCCGGAAGCGATTTGCGTAATCGGATCGTAGACGTAATTGACATTGTCAAGGATTAGCTGTGGGGCGGTGACTATGTGAAGGAGGAGGATCCCAAGCACTTTGCGTCGGACAAGACGGGCCGTGGACCCTTGGCCGAGGATTGGCTGGAGGAGTATTGGCGCGAAGTGAAGGGCAAAAAGCAACCGACACCGCGCAACATGTCCCTGATGACCGCCTACAAGATCTGCCGCGTGGAGTTTCGCTACTGGGGCATGCAGACAAA
Wild-‐Type DNA
AAAAGAGTCGCGAGGAGAGCCATGGCGAGGGCAGTGGCGTTGAGATAATCATCAATGAGCCGTACAAGGATGGACCCGGCGGTAATGGTCAATACACAAAGAAGATCTATCACGTGGGCAATCATCTGCCTGGCTGGATTAAAAGTCTCTTGCCGAAAAGCGCTTTAACCGTGGAGGAGGAGGCATGGAATGCCTATCCGTATACCAGGACTCGCTACACCTGTCCG
![Page 28: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/28.jpg)
![Page 29: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/29.jpg)
TTTGTGGAGAAATTCTCGCTGGATATTGAGACATACTATTATCCGGACAATGGCTATCAGGACAATGTCTTCCAGCTGTCCGGAAGCGATTTGCGTAATCGTATCGTAGACGTAATTGACATTGTCAAGGATCAGCTGTGGGGCGGTGACTATGTGAAGGAGGAGGATCCCAAGCACTTTGTGTCGGACAAGACGGGCCGTGGACCCTTGGCCGAGGATTGGCTGGAGGAGTATTGGCGCGAAGTGAAGGGCAAAAAGCAACCGACACCGCGCAACATGTCCCTGATGACCGCCTACAAGATCTGCCGCGTGGAGTTCCGCTACTGGGGCATGCAGACAAA
Figure 4.-‐-‐ Point mutations within the DNA sequence of the ampli'ied 567 base pair region
of the PITP domain of the rdgB205 gene as compared to wild-‐type DNA. One point mutation
within the rdgB205 DNA was discovered after comparison to wild-‐type DNA. The point mutation
occurs at base pair 175 and resulted in an adenine changed to a guanine.
RdgB205 mutant
K S R E E S H G E G S G V E I I I N E P Y K D G P G G N G Q Y T K K I Y H V G N H L P G W I K S L L P K S A L T V G
E E A W N A Y P Y T R T R Y T C P F V E K F S L D I E T Y Y Y P D N G Y Q D N V F Q L S G S D L R N R I V D V I D
I V K D Stop L W G G D Y V K E E D P K H F A S D K T G R G P L A E D W L E E Y W R E V K G K K Q P T P R N
Met S L Met T A Y K I C R V E F R Y W G Met Q T
Wild-‐type
![Page 30: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/30.jpg)
![Page 31: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/31.jpg)
K S R E E S H G E G S G V E I I I N E P Y K D G P G G N G Q Y T K K I Y H V G N H L P G W I K S L L P K S A L T V E
E E A W N A Y P Y T R T R Y T C P F V E K F S L D I E T Y Y Y P D N G Y Q D N V F Q L S G S D L R N R I V D V I D
I V K D Q L W G G D Y V K E E D P K H F V S D K T G R G P L A E D W L E E Y W R E V K G K K Q P T P R N Met S
L Met T A Y K I C R V E F R Y W G Met Q T
Figure 5.-‐-‐ Amino acid sequence of the ampli'ied 567 base pair portion of the PITP region
of the rdgB205 gene compared to wild-‐type amino acid sequence showing missense
mutation of glutamic acid to glycine at base pair 58. One missense mutations (glutamic acid to
glycine, amino acid 58) was discovered after comparison of mutant rdgB205 amino acid sequence
to wild-‐type amino acid sequence. This mutation corresponds to the point mutation within the
DNA sequence at base pair 175, which resulted in an adenine replaced with a guanine. This
missense mutation at amino acid 58 suggests a loss of function mutation due to improper protein
folding because glutamic acid contains a negatively charged side chain, whereas glycine is a
special case amino acid.
Immunolocalization of the rdgB205 Protein: In order to make Fly tissue more dense for
cryosectioning, decapitated Fly heads were placed in Fix and varying concentrations of sucrose. We
then performed standard immunolocalization via GFP in order to compare rdgB protein
expression in both wild-‐type and mutant rdgB205 Flies, which contain a missense mutation at
amino acid 58. Both the wild-‐type and mutant rdgB205 Flies showed similar immunolocalization
patterns of rdgB protein (Fig. 6.). This provides evidence that the missense mutation located at
amino acid 58 causes a loss of function within the rdgB protein, because both images show the
protein is being equally expressed, so therefore the problem must be due to a lack of function
rather than expression.
![Page 32: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/32.jpg)
![Page 33: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/33.jpg)
Figure 6.-‐-‐ Immunolocalization of rdgB protein expression in wild-‐type and rdgB205
mutant Drosophila showing a loss of function due to missense mutation. Decapitated Fly
heads were cryosectioned and immunoFluoresced via GFP for rdgB protein expression. Both the
wild-‐type and mutant rdgB205 Flies showed similar immunolocalization patterns of rdgB protein.
This provides evidence that the missense mutation located at amino acid 58 causes a loss of
function because both images show that the protein is being expressed equally by location,
therefore the mutant must be defective due to a loss of function.
DISCUSSION
Genetic and molecular analysis of the rdgB205 gene resulted in the identiFication and
characterization of a possible function of the allele as it relates to retinal degeneration. The First
goal was to establish a connection between the new, EMS generated mutant gene (rdgB205) and
an existing gene (rdgB). Through chromosome and deletion mapping, it was determined that the
mutation in rdgB205 was on the X chromosome in the 12B-‐C region. The gene rdgB is known to
![Page 34: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/34.jpg)
![Page 35: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/35.jpg)
map to the 12C1 salivary region of the X chromosome (Vihtelic 1991), which suggests that the
known gene rdgB and rdgB205 might be allelic. A complementation experiment conFirmed that
the two genes were allelic, resulting in the ability to apply the information previously known
about rdgB to our new mutant rdgB205.
RdgB encodes the PITP domain and a mutation to this region is known to produce retinal
degeneration consistent with the rapid light-‐induced retinal degeneration observed in rdgB205
mutants (Vihtelic 1991). This suggests that the PITP domain is of interest in determining the
characterization and possible function of the rdgB205 gene.
In order to provide more evidence that the rdgB and rdgB205 genes are allelic, an
epistasis experiment was conducted to determine rdgB205’s relative location in the
phototransduction cascade. NorpA and ninaE are two genes known to be epistatic over retinal
degeneration caused by rdgB mutants (Vihtelic 1991). Results conFirm that ninaE and norpA are
also epistatic toward rdgB205 mutants, suggesting that rdgB205 functions similarly to rdgB in
the phototransduction cascade.
PCR was used to amplify the PITP domain which was suspected to contain the region of
the mutation that characterized rdgB205. Following the PCR reaction, ligation was conducted in
order to clone the PCR fragment into the plasmid vector. Miniprep was then performed to obtain
isolated plasmid DNA, free from contaminants. Electrophoresis on the restriction cut fragment
was carried out and the fragment was found to be 567 bp in length, identical to the expected
length of 567. These results suggest that the correct fragment of the PITP domain speciFied by
the primers was ampliFied.
DNA sequencing allowed the comparison of wild-‐type and rdgB205 sequences for the
fragment and a point mutation was found at base pair 175 (adenine to guanine). This resulted in
![Page 36: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/36.jpg)
![Page 37: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/37.jpg)
a missense mutation at the 58th amino acid where glutamic acid was replaced by glycine. Since
glutamic acid has a negatively charged side chain and glycine lacks a side chain, the mutation is
considered to be non-‐conservative, which is important because a change in the amino acid side
chain will likely result in a change in the secondary structure of the produced protein. A result of
this structural change could be the inactivation or degradation of the protein, inducing
rdgB205-‐type retinal degeneration.
Additionally, Immunolocalization showed that rdgB205 mutants expressed their protein
product in the same location as wild-‐type Drosophila. Wild-‐type rdgB proteins are known to be
located in the retina, optic lobes, ocelli, central brain, and the antennal segments of the adult
Drosophila (Vihtelic 1993). Since the location of protein expression is retained, the functionality
of the protein must be affected due to the amino acid secondary structure that is suspected to
have changed following the non-‐conservative change. This result differs from previous research,
where immunolocalization showed that mutant rdgB protein was not present in the same
locations as wild-‐type (Vihtelic 1993). Previous studies also concluded that the gene product
must be present in photoreceptors to prevent degeneration (Vihtelic 1993), to which we now can
add that the gene product must be present and functional for rdgB205-‐type retinal degeneration.
In the future, we will conduct a PITP assay as an experiment to examine the function of
the rdgB205 transfer protein. We hypothesize that the mutation observed to the PITP domain is
the cause of rdgB205-‐type retinal degeneration. A dephosphorylation assay (Vihtelic 1993) will
allow us to link the mutation via biochemical activity back to the retinal degeneration phenotype
that was observed in this experiment.
We also hypothesize that rdgB205 has a second function as a calcium transporter,
independent of PI transfer (Paetkau 1999). Testing this would allow us to better understand the
function of rdgB205 as an integral membrane protein in phototransduction as well as provide
![Page 38: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/38.jpg)
![Page 39: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/39.jpg)
clariFication in regards to rdgB’s unique location in the SRC, which stores intracellular Ca2+ and
contains a proposed Ca2+ binding site (Paetkau 1999). To achieve this end, we will stain calcium
and see if rdgB205 mutants have a higher level of Ca2+ inside the SRC than wild-‐type. This would
suggest that the retinal degeneration observed is due, at least in part, to increased intracellular
Ca2+ levels.
Third, we propose to examine the PIP2 regeneration cycle, which is required for
photoresponse in Drosophila. RdgB is a proposed component of the pathway, so we suggest the
overexpression of the gene Laza, which may bypass rdgB in this proposed PIP2 cycle.
Deep-‐pseudopupil analysis can be used to score the Drosophila for this experiment. The rescue or
lack-‐of-‐rescue of the mutant rdgB205 phenotype when exposed to this will allow us to learn more
about the pathway to elucidate the function of the protein.
APPENDIX
Chromosome mapping; successful Deletion mapping; successful Complementation; successful
Epistasis; successful. PCR; successful. Ligation, transformation, miniprep; incubated the colonies
for ~28 hours instead of ~14 hours. Colonies appeared as larger dots. Lane 4 in Figure 2
represents a false white. Restriction cut and gel; used class data of proper migration because
ours showed only one size band and they were all the same length. We had three mutations in
our sequence, but only examined the First missense mutation and did not discuss the other two.
Used picture of immunolocalization results from LabArchives (missense).
LITERATURE CITED
![Page 40: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/40.jpg)
![Page 41: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/41.jpg)
Milligan, J.G. Alb, Jr., R.B. Elagina, V.A. Bankaitis, D.R. Hyde. 1997. The Phosphatidylinositol
Transfer Protein Domain of Drosophila Retinal Degeneration B Protein Is Essential for
Photoreceptor Cell Survival and Recovery from Light Stimulation
Paetkau, D.W., A.E. Vecheslav, L.M. Sendi, D.R. Hyde. 1999. Isolation and Characterization of
Drosophila retinal degeneration B Suppressors.
Sahly, I., S. Bar Nachum, E. Suss-‐Toby, A. Rom, A. Peretz, T. Byk, Z. Selinger, B. Minke. 1992.
Calcium channel blockers inhibit retinal degeneration in the retinal-‐degeneration-‐B mutant of
Drosophila.
Vihtelic, T.S., D.R. Hyde, and J.E. O’Tousa. 1991. Isolation and characterization of the Drosophila
retinal degeneration B (rdgB) gene.
Vihtelic, T.S., M. Goebl, S. Milligan, J.E. O’Tousa, and D.R. Hyde. 1993. Localization of Drosophila
retinal degeneration B, a membrane-‐associated phosphatidylinositol transfer protein.
Wang, T., C. Montell. 2007. Phototransduction and retinal degeneration in Drosophila.
Whaley, M. 2014. Laboratory Manual: Classical and Molecular Genetics
![Page 42: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/42.jpg)
![Page 43: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/43.jpg)
![Page 44: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/44.jpg)
![Page 45: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/45.jpg)
Grant: Link more experiments into the discussion and in future experiments. Beefs it up and gives it validity.
1) Abstract -‐ molecular defects -‐ nucleotide changes in the PITP domain?, Amino acid changes? Non-‐conservative changes? Characterize by what our mutant actually is.
2) USE missense -‐ its there it just cant carry out function, loss of function.
3) ASK: Abstract: molecular defects: nucleotide changes in the PITP domain that would
result in alterations to the amino acid sequence, causing conservative/non-‐conservative
changes to the protein. Conservative is more important? Should we only be looking for
conservative since it is the part that clearly has a close like to effect?
4) We know that the mutation doesn’t affect expression location due to IF just the function.
Propose that the folding is changed? Glutamic acid → glycine (negative to polar
uncharged) base pair 175. Altering the binding of PI or active site of transfer.
-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐
Identi'ication and Characterization of the Drosophila retinal degeneration B 205 (rdgB205)
Gene as a Phosphoinositol Transfer Protein.
ABSTRACT
The retinal degeneration B 205 (rdgB205) gene in Drosophila causes retinal degeneration
of photoreceptor cells in the eye in response to light. We aimed to identify and characterize a
mutation in the phosphatidylinositol transfer protein (PITP) domain as a factor resulting in
retinal degeneration in rdgB205 mutants. Chromosome and deletion mapping resulted in the
determination of the rdgB205 gene being located in the 12B-‐C region of the X chromosome. A
complementation test resulted in the identiFication of rdgB205 as an allele of the known gene
rdgB. Mutations to the genes norpA and ninaE caused the suppression of the rdgB205 phenotype,
![Page 46: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/46.jpg)
![Page 47: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/47.jpg)
![Page 48: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/48.jpg)
![Page 49: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/49.jpg)
![Page 50: Genetics lab paper](https://reader031.vdocument.in/reader031/viewer/2022030401/58ad62691a28ab9e428b4edf/html5/thumbnails/50.jpg)