Investigation of Aerobic and Anaerobic Ammonium-oxidizing
bacteria presence in a small full-scale wastewater treatment system comprised by
UASB reactor and three polishing ponds
Juliana Calabria Araujo, M. Correa, E. Silva, V. Godinho, M. Von Sperling and C. A. Chernicharo
Background I• Nitrogen removal is often
accomplished by microbialprocesses such as nitrification anddenitrification. These reactions havebeen known for a long time andhave been successfully applied inmost modern wastewater treatmentplants (Egli et al., 2001)
• ANAMMOX is a biological processin which ammonium is directlyconverted to N2 with nitrite aselectron acceptor under anoxicconditions (Jetten et al., 1999).
N fixation
NitrificationDenitrification
www.anammox.com
ANAMMOX
NH4+ + 1.32NO2
- + .066 HCO3-→
1.02N2 + 0.26NO3- + 0.066 CH2O0.5 N 0.15 + 2.03 H2O
(Strous et al., 1998)
•This reaction was first discovered in a denitrifying pilot plant reactor(nitrate and ammonium) in Delft, The Netherlands (Mulder et al., 1995),and today anammox reactions have been reported from several othertreatment plants (Egli et al., 2001; van Dogen et al., 2001), includingconstructed wetland system (Sanchez-Melsió, 2009).
Chemolithoautotrophic bacteriaPlanctomycetales
Brocadia anammoxidansThey are strictly anaerobes, very difficult to be cultured, have slow growth rates and they have not been isolated in pure culture yet.
www.anammox.com
Anammox detection by phylogenetic analysis
Schmid 2005, AEM 71:1677-1684
Anammoxoglobus propionicus (Kartal, et al., 2006)Jettenia asiatica(Quan et al., 2008)
Backgroung II• Systems comprised by a UASB reactor
followed by shallow polishing (maturation)ponds in series have been applied in differentparts of Brazil, leading to good results in termsof organic matter removal and coliform removal(von Sperling et al. 2005).
• Also some nitrogen removal occur, bynitrification process, and/or NH3 stripping(mechanism under investigation). Until nowAnammox process was not investigated inthese systems.
Goal• to search for the Anammox and
ammonia-oxidizing bacteria presence ina small full scale WWT system (UASB +three PP) by using PCR (polymerase chainreaction) and FISH (Fluorescence in situhybridization)
• to verify if Anammox and/or AerobicAmmonia oxidation process would beoccurring in polishing ponds and beingresponsible for ammonia removal inthese systems.
Methods- investigated system
UASB200 ih
PolishingPond 1HRT=4dL/W =5
D=0.80m
PolishingPond 2D=0.80 m
PolishingPond 3HRT=2 dD=0.60m
Belo Horizonte Experimental WWTP UFMG/Arrudas-Copasa
Methods- samples
Analyses SamplesPCR (Anammox) and FISH (Anammox and AOB)
UASB sludge and effluent;Sediment from P1, P2 and P3
MPN (Nitrosomonasand Nitrobacter)
Water samples from P1, P2, and P3
MethodsSludge and sediment
DNA extractionEgli et al. (2003)
PCR amplificationwith 7 pairs of primers
Rapid amplification of specific target segments of 16S rDNA
FISH (De Long et al., 1989)
Ribosome
Probe can bind to 16S rRNA
Each single cell contains manyribosomes-when probed the wholecell lights up-when observed underthe fluorescence microscope
CGGCGTCGCTGCGTCAGG-5’GCCGCAGCGACGCAGUCC
Cell
Probes to Anammox (Amx820) and AOB (Nso190 and Nso1225) bacteria
RESULTS I-Detection of Anammox
PCR with Pla46f / Amx 368r:“Ca. Brocadia”, “Ca. Kuenenia”, “Ca. Scalindua”
500bp
250bp
M P1 P2 P3 U Ue Nc
Results IIPCR with Pla46f / Amx 667r:
Specific to AnammoxM P1 P2 P3 U Ue PC nc
750bp
PC=positive control from a SBR used for Anammoxenrichment, in which activated sludge was used as inoculum
Results III-FISH
Probe Name P. Pond 1 P. Pond 2 P. Pond 3 UASB sludge
UASB effluent
Amx820 (Kueneniaand Brocadia
ND ND ND ND ND
Nso190 (Ammoniaoxidizing-bacteria)
ND ND ND ND ND
Nso1225 (Ammoniaoxidizing-bacteria)
ND ND ND ND ND
FISH was positive only for SBR sample, used as positivecontrol in PCR experiments
ND=non-detectable
Use of a CY3-labelled oligonucleotide probe to Brocadiaanammoxidans rRNA to detect Anammox in enriched
sample
B. anammoxidans detected (Amx1240) in SBR Anammox enrichment
MPN Results (Number of cells/ ml)
Results IV
Water samples from Nitrosomonas(MPN analysis)
Nitrobacter(MPN analysis)
Polishing pond 1 1.1 x 102 4.9 x 101
Polishing pond 2 4.9 x 103 5.0 x 102
Polishing pond 3 2.3 x 103 2.4 x 105
Some Nitrification in the water column might have occurred
Ammonia removal efficiencies and concentration of N-compounds in the system
Results V
Parameter Mean removal efficiencies (%)UASB Pond 1 Pond 2 Pond 3 Overall
BOD 73 9 12 -13 81COD 62 -14 4 -31 71TSS 68 -36 1 -25 78Total N 21 28 26 56Ammonia-N 24 32 34 57Parameter Mean concentration (mg. l-1)Ammonia -N 31 24 16 13NO2
- - N 0.10 0.28 1.02 1.63NO3
- - N 0.15 0.15 0.20 0.20Modified from Sperling et al., 2008
Conclusions• 16S rDNA genes of Anammox organisms were
amplified from PP sediments and UASB samples suggesting that these bacteria could be present in this system
• However, FISH analysis did not reveal the presence of nitrifying and Anammox bacteria in this system, or they could be present but below FISH detection limit (103 to104 cells/ml)
• MPN analysis of the water column revealed the presence of Aerobic ammonia and nitrite oxidizing bacteria, indicating that some Nitrification might have occurred in the polishing ponds
Conclusions• In principle, nitrogen losses which could be only
explained by the Anammox process were not verified in this system, or they were too low to be noticed.
• suggest that anammox may be more common, and also that anammox reaction could be a widely occuring phenomenon in WWTP
• Some cloning and sequencing will be done to confirm that the anammox sequences amplified in the PCR are from anammox organisms.
• Anammox activity test will be done in batch cultures using sediment from PP3 in order to investigate potential anammox activity
RESULTS III-Detection of Anammox
PCR results with different primer pairs:Pair of primers Pond 1
sludgePond 2sludge
Pond 3sludge
UASB sludge
UASB effluent
Pla46rc/1392r + + + + +Pla46rc/Amx368r + + + + +Pla46rc/Amx667r + + + - -P46rc/Amx820r - - - - -P46rc/Amx1240r - - - - -An7f/An1388r - - - - -Brod541f/Brod1260r - - - - -
(+) positive result, amplification product was visualized on agarose gel(- ) negative result, no amplification product was formed
Methods
Probe name Specificity Sequence
(5´to 3´)Reference
Amx 820“Brocadiaanammoxidans” and “Kueneniastuttgartiensis”
AAAACCCCTCTACTTAGTGCCC Schmid et al.(2000)
Nso190Many but not all ammonia-oxidizing β-Proteobacteria
CGATCCCCTGCTTTTCTCC Mobarry et al.(1996)
Nso1225Almost all ammonia-oxidizing β-Proteobacteria
CGCCATTGTATTACGTGTGA Mobarry et al.(1996)
Oligonucleotide probes used for FISH Analysis
Cells were fixed with PFA 4% and hibridizations were preformed asdescribed by Egli et al., 2003