Download - Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat
![Page 1: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/1.jpg)
Loop-mediated Isothermal Amplification(LAMP) and its application in detection
A. Ishwara BhatSenior Scientist
Indian Institute of Spices ResearchMarikunnu, Calicut 673012
![Page 2: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/2.jpg)
Loop mediated isothermal amplification (LAMP)New amplification method used for pathogen detection in humans, animals and plants
Amplification takes place at a single temperature (65 C) (No need of thermal cycler).
Economy in cost as it does not require special reagents or sophisticated equipments
Uses polymerase with high strand displacement activity (instead of Taq Poly)
Amplification efficiency is high
Can be used for RNA templates by addition of reverse transcriptase
![Page 3: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/3.jpg)
Primers
FIP (Forward Inner Primer): consists of the F2 region (at the 3' end) that is complementary to the F2c region, and the same sequence as the F1c region at the 5' end. F3: Forward Outer Primer consists of the F3 region that is complementary to the F3c region BIP (Backward Inner Primer): consists of the B2 region (at the 3' end) that is complementary to the B2c region, and the same sequence as the B1c region at the 5' end
External primer F3
Internal primer FIP
External primer B3
Internal primer BIP
Loop primer FL
Loop primer BL
F3c F2c
B2c B3cF3 F2
B2 B33’5’
5’3’
F1cF2
B2B1c
F1c
F1
B1
B1c
FL
FLc
BLc
BL
![Page 4: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/4.jpg)
B3: Backward Outer Primer consists of the B3 region that is complementary to the B3c region
Loop F (Loop Forward): sequences complementary to the single stranded loop region between the F1 and F2 regions on the 5' end of the dumbbell-like structure Loop B (Loop Backward): sequences complementary to the single stranded loop region between the B1 and B2 regions on the 5' end of the dumbbell-like structure
Distance between primer regions
Between 5' end of F2 and B2 is considered to be 120-180bp, and the distance between F2 and F3 as well as B2 and B3 is 0-20bp
The distance for loop forming regions (5' of F2 to 3' of F1, 5' of B2 to 3' of B1) is 40-60bp
![Page 5: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/5.jpg)
Tm value for primer regions
About 60-65°C in the case of GC rich and Normal, about 55-60°C for AT rich
GC contents
About 50-60% in the case of GC rich and Normal, about 40-50% for AT rich
Secondary structurePrimers should be designed so as not to easily form secondary structures. 3' end sequence should not be AT rich or complementary to other primers
Others
If the restriction enzyme sites exist on the target sequence, except the primer regions, they can be used to confirm the amplified products
Animation site: http://loopamp.eiken.co.jp/e/lamp/anim.html
![Page 6: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/6.jpg)
LAMP ReactionSTEP1As double stranded DNA is in the condition of dynamic equilibrium at the temperature around 65°C, one of the LAMP primers can anneal to the complimentary sequence of double stranded target DNA, then initiates DNA synthesis using the DNA polymerase with strand displacement activity, displacing and releasing a single stranded DNA. With the LAMP method, unlike with PCR, there is no need for heat denaturation of the double stranded DNA into a single strand. The following amplification mechanism explains from when the FIP anneals to such released single stranded template DNA
![Page 7: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/7.jpg)
STEP2Through the activity of DNA polymerase with strand displacement activity, a DNA strand complementary to the template DNA is synthesized, starting from the 3' end of the F2 region of the FIP
STEP3The F3 Primer anneals to the F3c region, outside of FIP, on the target DNA and initiates strand displacement DNA synthesis, releasing the FIP-linked complementary strand.
STEP4A double strand is formed from the DNA strand synthesized from the F3 Primer and the template DNA strand
![Page 8: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/8.jpg)
STEP5The FIP-linked complementary strand is released as a single strand because of the displacement by the DNA strand synthesized from the F3 Primer. Then, this released single strand forms a stem-loop structure at the 5' end because of the complementary F1c and F1 regions.
STEP6This single strand DNA in Step (5) serves as a template for BIP-initiated DNA synthesis and subsequent B3-primed strand displacement DNA synthesis. The BIP anneals to the DNA strand produced in Step (5). Starting from the 3' end of the BIP, synthesis of complementary DNA takes place. Through this process, the DNA reverts from a loop structure into a linear structure. The B3 Primer anneals to the outside of the BIP and then, through the activity of the DNA polymerase and starting at the 3' end, the DNA synthesized from the BIP is displaced and released as a single strand before DNA synthesis from the B3 Primer
![Page 9: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/9.jpg)
STEP7Double stranded DNA is produced through the processes described in Step (6).
STEP8The BIP-linked complementary strand displaced in Step (6) forms a structure with stem-loops at each end, which looks like a dumbbell structure. This structure serves as the starting structure for the amplification cycle in the LAMP method (LAMP cycling). The above process can be understood as producing the starting structure for LAMP cycling
Animation site: http://loopamp.eiken.co.jp/e/lamp/anim.html
![Page 10: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/10.jpg)
Cycling amplification step
A dumbbell-like DNA structure is quickly converted into a stem-loop DNA by self-primed DNA synthesis. FIP anneals to the single stranded region in the stem-loop DNA and primes strand displacement DNA synthesis, releasing the previously synthesized strand. This released single strand forms a stem-loop structure at the 3' end because of complementary B1c and B1 regions. Then, starting from the 3' end of the B1 region, DNA synthesis starts using self-structure as a template, and releases FIP-linked complementary strand (Step (9)). The released single strand then forms a dumbbell-like structure as both ends have complementary F1 - F1c and B1c - B1 regions, respectively (Step (11)). This structure is the 'turn over' structure of the structure formed in Step (8). Similar to the Steps from (8) to (11), structure in Step (11) leads to self-primed DNA synthesis starting from the 3' end of the B1 region. Furthermore, BIP anneals to the B2c region and primes strand displacement DNA synthesis, releasing the B1-primed DNA strand. Accordingly, similar structures to Steps (9) and (10) as well as the same structure as Step (8) are produced. With the structure produced in Step (10), the BIP anneals to the single strand B2c region, and DNA synthesis continues by displacing double stranded DNA sequence. As a result of this process, various sized structures consisting of alternately inverted repeats of the target sequence on the same strand are formed
![Page 11: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/11.jpg)
![Page 12: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/12.jpg)
![Page 13: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/13.jpg)
![Page 14: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/14.jpg)
Procedure
![Page 15: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/15.jpg)
Detection methods
Visual methods
Real time
Optigene instrument for LAMP
![Page 16: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/16.jpg)
Detection of Sweet potato feathery mottle and Sweet potato chlorotic stunt viruses by LAMP
Sweet potato chlorotic virus
Primers designedF3: CATCTGAGCAACTGGCTCTT (Sense orientation)B3: ACCATGAACACATTCTCGAGAT (antisense orientation)FIP: CCTGTAATTTGCCTCACAAAACTCTCCATTCTAACTCACCAGACATTATGTCT (F1c + F2)BIP: GAGATTTTTGCAAGTTTCTACGCATCTGGAAAAGAACGCGTCGAATG (B1 + B2c)F-loop: GTCTCTTGAATTCATCTTCTTGAC (antisense orientation)B-loop: CAAGCTTGGGCAAACCAAAG (Sense orientation)
Sweet potato feathery mottle
Primers designed
F3: TACAACGTAAMCTTGACTGATATGAGTB3: GTTATGTATATTTCTAGTAACA/GTCAGTFIP: GCTGCYTTTCATCTGYAWTWTGTGGATATGCATTTGATTTYTAYGAGCTBIP: AAGAATGCRCRWAATCGGTTGTTTGGGCCTCTCCGTATCYTCTTCTTF-loop: TTCTTTAGCACGTGYAGGKGB-loop: TGGAYGGAAACGTCTCCAC
![Page 17: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/17.jpg)
Thermopol buffer (10x) 2.5 µl
MgSO4 (50 mM/µl) 4.0 µl
dNTP mix (10 mM/µl) 3.5 µl
F3 Primer (10 µM/µl) 0.5 µl
B3 primer (10 µM/µl) 0.5 µl
FIP Primer (100 µM/µl) 0.5 µl
BIP primer (100 µM/µl) 0.5 µl
F-Loop primer (100 µM/µl) 0.25 µl
B-Loop primer (100 µM/µl) 0.25 µl
Betaine (5M) 5.0 µl
Bst Polymerase 1.0 µl
Water 5.5 µl
Template 1.0 µl
Total 25.0 µl
ProcedureTotal DNA/RNA isolation from infected and healthy plant
![Page 18: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/18.jpg)
Incubated tube at 65 C for 40 min
Product run on 1.2% agarose gel
Presence of multiple bands
![Page 19: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/19.jpg)
Real time LAMP assay for detection of viruses
By including sybergreen dye in the reaction
LAMP instrument (Genie II from Optigene, UK).
Rapid amplification
Result confirmation through anneal / melt
Portable, Battery powered ( 2 kg weight)
Stand alone operation without a computer
USB memory stick interface for easy access to data files
Supports many fluorescence and luminescence chemistries
![Page 20: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/20.jpg)
Detection of SPFMV and SPCSV using real time LAMP
![Page 21: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/21.jpg)
Melt curve analysis of LAMP products
![Page 22: Loop-mediated Isothermal Amplification (LAMP) and its application in detection A. Ishwara Bhat](https://reader036.vdocument.in/reader036/viewer/2022062305/56815af1550346895dc8ad2e/html5/thumbnails/22.jpg)
Thank
You