Transcript
Page 1: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Loop-mediated Isothermal Amplification(LAMP) and its application in detection

A. Ishwara BhatSenior Scientist

Indian Institute of Spices ResearchMarikunnu, Calicut 673012

Page 2: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Loop mediated isothermal amplification (LAMP)New amplification method used for pathogen detection in humans, animals and plants

Amplification takes place at a single temperature (65 C) (No need of thermal cycler).

Economy in cost as it does not require special reagents or sophisticated equipments

Uses polymerase with high strand displacement activity (instead of Taq Poly)

Amplification efficiency is high

Can be used for RNA templates by addition of reverse transcriptase

Page 3: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Primers 

FIP (Forward Inner Primer): consists of the F2 region (at the 3' end) that is complementary to the F2c region, and the same sequence as the F1c region at the 5' end. F3: Forward Outer Primer consists of the F3 region that is complementary to the F3c region BIP (Backward Inner Primer): consists of the B2 region (at the 3' end) that is complementary to the B2c region, and the same sequence as the B1c region at the 5' end

External primer F3

Internal primer FIP

External primer B3

Internal primer BIP

Loop primer FL

Loop primer BL

F3c F2c

B2c B3cF3 F2

B2 B33’5’

5’3’

F1cF2

B2B1c

F1c

F1

B1

B1c

FL

FLc

BLc

BL

Page 4: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

B3: Backward Outer Primer consists of the B3 region that is complementary to the B3c region

Loop F (Loop Forward): sequences complementary to the single stranded loop region between the F1 and F2 regions on the 5' end of the dumbbell-like structure Loop B (Loop Backward): sequences complementary to the single stranded loop region between the B1 and B2 regions on the 5' end of the dumbbell-like structure

Distance between primer regions

Between 5' end of F2 and B2 is considered to be 120-180bp, and the distance between F2 and F3 as well as B2 and B3 is 0-20bp

The distance for loop forming regions (5' of F2 to 3' of F1, 5' of B2 to 3' of B1) is 40-60bp

Page 5: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Tm value for primer regions

About 60-65°C in the case of GC rich and Normal, about 55-60°C for AT rich

GC contents

About 50-60% in the case of GC rich and Normal, about 40-50% for AT rich

Secondary structurePrimers should be designed so as not to easily form secondary structures. 3' end sequence should not be AT rich or complementary to other primers

Others

If the restriction enzyme sites exist on the target sequence, except the primer regions, they can be used to confirm the amplified products

Animation site: http://loopamp.eiken.co.jp/e/lamp/anim.html

Page 6: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

LAMP ReactionSTEP1As double stranded DNA is in the condition of dynamic equilibrium at the temperature around 65°C, one of the LAMP primers can anneal to the complimentary sequence of double stranded target DNA, then initiates DNA synthesis using the DNA polymerase with strand displacement activity, displacing and releasing a single stranded DNA. With the LAMP method, unlike with PCR, there is no need for heat denaturation of the double stranded DNA into a single strand. The following amplification mechanism explains from when the FIP anneals to such released single stranded template DNA

Page 7: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

STEP2Through the activity of DNA polymerase with strand displacement activity, a DNA strand complementary to the template DNA is synthesized, starting from the 3' end of the F2 region of the FIP

STEP3The F3 Primer anneals to the F3c region, outside of FIP, on the target DNA and initiates strand displacement DNA synthesis, releasing the FIP-linked complementary strand.

STEP4A double strand is formed from the DNA strand synthesized from the F3 Primer and the template DNA strand

Page 8: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

STEP5The FIP-linked complementary strand is released as a single strand because of the displacement by the DNA strand synthesized from the F3 Primer. Then, this released single strand forms a stem-loop structure at the 5' end because of the complementary F1c and F1 regions.

STEP6This single strand DNA in Step (5) serves as a template for BIP-initiated DNA synthesis and subsequent B3-primed strand displacement DNA synthesis. The BIP anneals to the DNA strand produced in Step (5). Starting from the 3' end of the BIP, synthesis of complementary DNA takes place. Through this process, the DNA reverts from a loop structure into a linear structure. The B3 Primer anneals to the outside of the BIP and then, through the activity of the DNA polymerase and starting at the 3' end, the DNA synthesized from the BIP is displaced and released as a single strand before DNA synthesis from the B3 Primer

Page 9: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

STEP7Double stranded DNA is produced through the processes described in Step (6).

STEP8The BIP-linked complementary strand displaced in Step (6) forms a structure with stem-loops at each end, which looks like a dumbbell structure. This structure serves as the starting structure for the amplification cycle in the LAMP method (LAMP cycling). The above process can be understood as producing the starting structure for LAMP cycling

Animation site: http://loopamp.eiken.co.jp/e/lamp/anim.html

Page 10: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Cycling amplification step

A dumbbell-like DNA structure is quickly converted into a stem-loop DNA by self-primed DNA synthesis. FIP anneals to the single stranded region in the stem-loop DNA and primes strand displacement DNA synthesis, releasing the previously synthesized strand. This released single strand forms a stem-loop structure at the 3' end because of complementary B1c and B1 regions. Then, starting from the 3' end of the B1 region, DNA synthesis starts using self-structure as a template, and releases FIP-linked complementary strand (Step (9)). The released single strand then forms a dumbbell-like structure as both ends have complementary F1 - F1c and B1c - B1 regions, respectively (Step (11)). This structure is the 'turn over' structure of the structure formed in Step (8). Similar to the Steps from (8) to (11), structure in Step (11) leads to self-primed DNA synthesis starting from the 3' end of the B1 region. Furthermore, BIP anneals to the B2c region and primes strand displacement DNA synthesis, releasing the B1-primed DNA strand. Accordingly, similar structures to Steps (9) and (10) as well as the same structure as Step (8) are produced. With the structure produced in Step (10), the BIP anneals to the single strand B2c region, and DNA synthesis continues by displacing double stranded DNA sequence. As a result of this process, various sized structures consisting of alternately inverted repeats of the target sequence on the same strand are formed

Page 11: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat
Page 12: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat
Page 13: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat
Page 14: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Procedure

Page 15: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Detection methods

Visual methods

Real time

Optigene instrument for LAMP

Page 16: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Detection of Sweet potato feathery mottle and Sweet potato chlorotic stunt viruses by LAMP

Sweet potato chlorotic virus

Primers designedF3: CATCTGAGCAACTGGCTCTT (Sense orientation)B3: ACCATGAACACATTCTCGAGAT (antisense orientation)FIP: CCTGTAATTTGCCTCACAAAACTCTCCATTCTAACTCACCAGACATTATGTCT (F1c + F2)BIP: GAGATTTTTGCAAGTTTCTACGCATCTGGAAAAGAACGCGTCGAATG (B1 + B2c)F-loop: GTCTCTTGAATTCATCTTCTTGAC (antisense orientation)B-loop: CAAGCTTGGGCAAACCAAAG (Sense orientation)

Sweet potato feathery mottle

Primers designed

F3: TACAACGTAAMCTTGACTGATATGAGTB3: GTTATGTATATTTCTAGTAACA/GTCAGTFIP: GCTGCYTTTCATCTGYAWTWTGTGGATATGCATTTGATTTYTAYGAGCTBIP: AAGAATGCRCRWAATCGGTTGTTTGGGCCTCTCCGTATCYTCTTCTTF-loop: TTCTTTAGCACGTGYAGGKGB-loop: TGGAYGGAAACGTCTCCAC

Page 17: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Thermopol buffer (10x) 2.5 µl

MgSO4 (50 mM/µl) 4.0 µl

dNTP mix (10 mM/µl) 3.5 µl

F3 Primer (10 µM/µl) 0.5 µl

B3 primer (10 µM/µl) 0.5 µl

FIP Primer (100 µM/µl) 0.5 µl

BIP primer (100 µM/µl) 0.5 µl

F-Loop primer (100 µM/µl) 0.25 µl

B-Loop primer (100 µM/µl) 0.25 µl

Betaine (5M) 5.0 µl

Bst Polymerase 1.0 µl

Water 5.5 µl

Template 1.0 µl

Total 25.0 µl

ProcedureTotal DNA/RNA isolation from infected and healthy plant

Page 18: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Incubated tube at 65 C for 40 min

Product run on 1.2% agarose gel

Presence of multiple bands

Page 19: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Real time LAMP assay for detection of viruses

By including sybergreen dye in the reaction

LAMP instrument (Genie II from Optigene, UK).

Rapid amplification 

Result confirmation through anneal / melt 

Portable, Battery powered  ( 2 kg weight)

Stand alone operation without a computer

USB memory stick interface for easy access to data files 

Supports many fluorescence and luminescence chemistries 

Page 20: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Detection of SPFMV and SPCSV using real time LAMP

Page 21: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Melt curve analysis of LAMP products

Page 22: Loop-mediated Isothermal Amplification (LAMP) and its application in detection  A.  Ishwara Bhat

Thank

You


Top Related