![Page 1: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/1.jpg)
Invited review
Molecular complexity of sexual development and gene
regulation in Plasmodium falciparum
Nirbhay Kumar*, Gloria Cha, Fernando Pineda, Jorge Maciel,Diana Haddad, Mrinal Bhattacharyya, Eiji Nagayasu
Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins Malaria Research Institute,
Johns Hopkins University, 615 N. Wolfe Street, Baltimore, MD 21205, USA
Received 21 September 2004; received in revised form 19 October 2004; accepted 19 October 2004
Abstract
The malaria parasite, Plasmodium falciparum, has a complex life cycle which alternates between the vertebrate host and the
invertebrate vector. Various morphological changes as well as stage-specific transcripts and gene expression profiles that accompany
parasite’s asexual and sexual life cycle suggest that gene regulation is crucial for the parasite’s continual adaptations to survive the
changing environments as well as for pathogenesis. Development of sexual stages is crucial for malaria transmission and relatively
little is known about the role of specific gene products during asexual to sexual differentiation and further development. Therefore, in
order to have a full understanding of the biology of the malaria parasite, gene regulation on a genome-wide global level must be
understood, an area remaining to be elucidated in P. falciparum. Parasite features, such as A–T bias, difficulties in cloning, labor-
intensive culture and purification of specific stages of the parasite, all contribute to the difficulties to investigate many aspects of
parasite biology. However, despite these challenges, limited studies have revealed a number of parallelisms with eukaryotic
transcription. For example, the parasite’s genes are organised in a similar fashion, contain promoter elements and upstream activation
sequences, as shown by structural searches and functional assays, and some of the basal machinery and general transcription factors
have been found in Plasmodium. The completion of the full genome sequence of P. falciparum and other species of Plasmodium has
resulted in the search for specific transcription factors through genome mining. Although genome mining may identify some of the
factors, search for these factors solely by primary sequence homology would result in a non-comprehensive list for transcription factors
present in the genome. Here, we present further discussion on putative transcription factors like activities detected in the asexual and
sexual stages of P. falciparum.
q 2004 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Keywords: Plasmodium; Gametocytes; Transcription factors; Gene expression
1. Introduction
The worldwide incidence of symptomatic malaria cases
each year is 300–500 million and 1.5–2 million, mostly
children, die as a result of infection (Global Health Council,
2003). Infection occurs after the bite of the vector, the
female Anopheles mosquito. During the course of the bite,
the sporozoite form of the parasite is transmitted from the
salivary gland of the mosquito and the parasite then enters
0020-7519/$30.00 q 2004 Australian Society for Parasitology Inc. Published by
doi:10.1016/j.ijpara.2004.10.013
* Corresponding author. Tel.: C1 410 955 7177; fax: C1 410 955 0105.
E-mail address: [email protected] (N. Kumar).
hepatocytes and multiplies by asexual schizogony.
The resulting merozoites then invade erythroctes and the
parasite goes through a series of morphological changes
either as asexual stages or as sexual forms upon differen-
tiation. The intermittent fevers, characteristic of infection
with malaria, are attributed to release of asexual parasites
from red blood cells. For completion of the host–vector
cycle a final cellular transformation of a subset of these
asexual stages to the sexual gametocyte stage must occur.
It is this form which in ingested by the vector during a blood
meal and sexual differentiation and development thus
represent a crucial link for continued malaria transmission
between the vertebrate host and invertebrate insect vector.
International Journal for Parasitology 34 (2004) 1451–1458
www.parasitology-online.com
Elsevier Ltd. All rights reserved.
![Page 2: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/2.jpg)
Fig. 2. Unique gametocyte proteins using relational databases. Summary of
proteomic data on various stages of P. falciparum published (Florens et al.,
2002; Lasonder et al., 2002). Various stages of the parasite are sporozoite
(S), trophozoite (T), merozoite (M), gamete (G) and gametocytes.
N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581452
2. Complexity of sexual development and parasite
gene expression
Mechanisms involved in sexual differentiation and
development largely remain unknown. Previous studies
had suggested that morphologically and biochemically
parasites commit to sexual pathway at the time of invasion
of erythrocyte by the merozoite, thus the progeny of a
developing schizont either continues, life cycle as asexual
parasite or are sexually differentiated into either all male or
all female gametocytes (Fig. 1, see Lobo and Kumar, 1998;
Kongkasuriyachai and Kumar, 2002 for reviews and other
references). What triggers the initial switch to sexual
development is still not known. Previous biochemical and
immunochemical approaches and, more recently, genome,
proteome and transcriptome analysis have demonstrated
that the sexual development is accompanied by stage-
specific expression of a large number of genes (more than
400, Fig. 2) (Florens et al., 2002; Lasonder et al., 2002).
Some of these gene products are likely to be important
mechanistically, while others might offer novel targets for
immune attack against the parasite (Kongkasuriyachai and
Kumar, 2002). Targeted gene disruption via homologous
recombination has been used to show different roles for a
handful of these gene products. For example, disruption of
Pfg27 leads to complete loss of sexual phenotype, on the
other hand disruption of Pfs48/45 rendered male gametes
infertile (reviewed in Kongkasuriyachai and Kumar, 2002;
Lobo et al., 1999; Van Dijk et al., 2001). Attempts to
employ gene silencing methods based on RNAi in our
laboratory have in general not been successful, in spite of
previous published reports (Malhotra et al., 2002; Kumar
et al., 2002). Various approaches tested in our studies
included electropoartion of dsRNA in the parasites,
incubation ‘soaking’ of parasites in culture with dsRNA or
SiRNA and pre-loading red blood cells with SiRNA prior to
infection with Plasmodium falciparum. Lack of RNAi in
Fig. 1. Model for intraerythrocytic sexual commitment, differentiation and
development. Various stages are indicated, ring (R), trophozoite (T),
schizont (S), male (M) and female (F) gametocytes.
P. falciparum is not surprising in view of the fact that the
parasite appears to lack Dicer and various other components
of the RISC complex, necessary for RNAi effects (Aravind
et al., 2003).
Stage specific gene expression in the parasite arises from
changes in the apparent levels and abundance of mRNA
levels for such genes in different stages of the parasite. Gene
expression appears to be largely controlled transcription-
ally, however, very little is known about how this
differential transcriptional regulation is achieved. Control
at the level of specific transcription factors present in
particular stage of the parasite may provide a logical
explanation. Although not much is known about transcrip-
tional regulation, this process is fundamental to the parasite
as is implied by the highly complex life cycle. Plasmodium
falciparum alternates between the vertebrate host and the
invertebrate vector, and is accompanied by the parasite
going through numerous morphological changes, as well as
changes at the molecular level revealed by developmentally
distinct patterns of protein and RNA synthesis.
Examination of individual gene expression illustrates the
complexity in the parasite system. Some proteins are
expressed constitutively, while others are expressed only
in certain stages. For example, the RNA coding merozoite
surface protein can be seen through Northern blot analysis
and nuclear run-on analysis to be present during the entire
erythrocytic cycle (Lanzer et al., 1992). On the other hand,
expression of multiple var genes is seen by RT-PCR
analysis in the early ring stage asexual parasites followed by
predominant expression of a single var gene product,
PfEMP1 in erythrocytic trophozoite and schizonts (Scherf
et al., 1998). Changes in the expression of genes encoding
cytoskeletal proteins, such as actin and tubulin, during
sexual development have been reported (Wesseling et al.,
1989; Delves et al., 1990; Rawlings et al., 1992). Patterns of
expression of other proteins expressed in the sexual stage
has been reviewed previously (Kongkasuriyachai and
Kumar, 2002; Moreira et al., 2004, this issue).
In addition to studying the complex expression patterns
of individual genes, recent microarray data has revealed
interesting characteristics of global gene regulation in the
malaria parasite. These studies suggested that several
![Page 3: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/3.jpg)
N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–1458 1453
mechanisms are likely to be operational in the parasites and
that there is a coordinated program of gene expression
during the intraerythocytic development of the parasite.
Although genes of related function are not necessarily
clustered on the chromosomes, there was a coordinated
program of gene expression which grouped genes coding
proteins of similar function at particular times. Microarray
data also shows a sequential expression of transcripts in that
mRNA’s involved in protein synthesis peaked first,
followed by metabolism related genes, then adhesion/inva-
sion genes, and lastly protein kinases were turned on
(Hayward et al., 2000; Mamoun et al., 2001; Le Roch et al.,
2003; Bozdech et al., 2004). The presence of a consensus
element in the promoter of genes expressed at the same time
which allows the orchestration of simultaneous gene
expression is worth investigating. Global proteome analysis
of sporozoites, merozoites, trophozoites, and gametocytes
using tandem mass spectrometry analysis has been used to
identify proteins in various stages of the parasite and such
studies have revealed that genes encoding many coex-
pressed proteins are clustered on certain chromosomes
(Florens et al., 2002; Lasonder et al., 2002).
A recent gene expression profile analysis in the
intraerythrocytic developmental cycle of highly synchro-
nised parasite has demonstrated that nearly 60% of the
genes are turned on all the time, and interestingly, nearly all
of these have a discrete maximum and minimum for
transcript level over a time course (Bozdech et al., 2004).
These studies also suggest that transcription of multiple
genes may be achieved by a single induction resulting in a
cascade of gene expression, further suggesting that only a
few specific transcription factors are required. Thus
transcription of genes in the parasites may not be governed
on a need or response basis but instead follow a program of
gene expression upon induction. There are, however,
several examples which argue against this hypothesis. For
example, induction of certain genes in the parasite is turned
on during heat shock demonstrating gene expression in
response to environmental fluctuations (Kumar et al., 1991).
Understanding of transcriptional control mechanisms and
transcription factors in specific gene regulation in the
parasites are thus, at best, only poorly understood.
3. Regulation of gene expression
Regulation of gene expression can occur at different
levels such as transcription, mRNA stability, translation and
post-translation control mechanisms. In eukaryotes, it is
well established that transcription rate is influenced by
‘trans-acting elements’ called transcription factors (see
Latchman, 2004). These transcription factors are proteins
which localise to the nucleus where subsequent binding to
the upstream activation sequences (‘cis-acting element’) of
DNA within the promoter region occurs, thus modulating
the rate of transcription of genes through a number of steps.
Binding of transcription factors to the DNA alters the
overall conformation of the DNA in that region, causing
the DNA to twist or bend. Twisting and bending may allow
the DNA to expose otherwise unseen or unreachable
binding sites for other transcription factors, or conversely,
prevent binding of other transcription factors. Lastly,
transcription factors also affect the transcriptionally active
euchromotin or transcriptionally inactive heterochromatin,
state of the chromosomes by modifying histones through
methylation or acetylation thus affecting gene regulation.
In order to be able to effect gene regulation, transcription
factors need to be present in the nucleus where the
transcription factor-DNA binding occurs. The abundance
and availability of transcription factors in the nucleus is
regulated by several mechanisms (see Latchman, 2004, for
individual references). In general, transcription factors tend
to have short half life (minutes) allowing for regulation to
occur at the level of transcription factor production. In
certain cases transcription factors may be localised in areas
outside of the nucleus, however, are translocated into the
nucleus upon activation. For example, NFkB is localised in
the cytoplasm and bound to the inhibitor partner, IkB
(Baeuerle and Baltimore, 1988). In order to allow genes to
be activated by NFkB, IkB must be phosphorylated,
allowing dissociation between NFkB and IkB to occur.
The phosphorylated IkB is targeted for degradation by the
proteasome, while NFkB is free to translocate into the
nucleus and exert action on genes. Transcription factor
levels can also be regulated by targeted degradation. For
example, b-catenin, involved in the Wnt signaling path-
ways, is regulated by phosphorylation, ubiquitinylation, and
degradation by the proteasome system (Cong et al., 2003).
Transcription factors can also be controlled by conversion
of inactive monomeric states to active oligomeric states
either independently or with the assistance of other
components. For example, prior to heat shock activation,
monomeric heat shock factor (HSF) is bound and seques-
tered by the stabilising hsp 90 (Knowlton and Sun, 2001).
After heat shock, the chaperone hsp 90 dissociates and freed
monomeric HSF undergoes trimerisation. In addition to the
structural requirement of HSF trimer formation, this
complex must also be phosphorylated in order to translocate
inside the nucleus and activate transcription. The regulation
of transcription factors is obviously crucial to the proper
control of gene expression which is influenced by the
presence or absence of these trans-acting regulatory
elements.
4. Gene structure and transcriptional machinery
in P. falciparum
In the last decade, it has been established that the
gene structure of P. falciparum is similar to that of other
eukaryotes (Lanzer et al., 1993; Horrocks et al., 1998). For
example, common features include the monocistronically
![Page 4: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/4.jpg)
N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581454
transcribed genes, protein coding genes between the 5 0 and
3 0untranslated regions, the presence of introns, capped
mRNA, poly-A tails, and the presence of promoter regions.
Also, a number of enzymes and factors involved in
transcription have also been found and the actions of these
have been shown to be similar with eukaryotes. These
include RNA polymerase I, II and III, TATA-binding
protein (McAndrew et al., 1993; Hirtzlin et al., 1994; Fox
et al., 1993; Li et al., 1991; 1989). Recently, Coulson et al.
(2004) have utilised bioinformatics searches based on 51
profile-hidden Markov Models (HMMs) and found 17 of the
HMMs (corresponding to 71 proteins) in the genome of the
malaria parasite. HMMs are probabilistic models that
describe the likelihood that an amino acid residue occurs
at each given position of an alignment. A profile HMM can
convert a multiple sequence alignment into a position-
specific scoring marix (see Pevsner, 2003 for more details).
Identification of many of the above proteins gives support to
the notion that some of the transcription regulators in
P. falciparum might be homologous to those in plants,
animals and fungi. Elucidation of mechanisms involved in
transcriptional regulation in P. falciparum have been
difficult due to the AT-rich genome sequence of the
parasite. Initial identification and mapping of promoter
elements were approached structurally. However, the ‘ACT’ richness resulted in challenges to identify promoters
based on TATAA boxes as well as presenting challenges in
cloning these regions. Much information about promoter
and gene structure was initially based on gene encoding
glycophorin binding protein, GBP130 (Lanzer et al., 1993;
Lanzer and Horrocks, 1999), and more recently on other
genes, including those expressed in the sexual stages
(Dechering et al., 1999; Alano et al., 1996). With the
advent of transfection for P. falciparum some attempts have
been made to validate these promoters by functional studies
using reporter genes (Horrocks and Kilbey, 1996). Through
these limited studies it has been suggested that promoters in
the parasite have a bipartite structure which is characteristic
of eukaryotic promoters, with basal promoter elements
regulated by upstream elements. This structure is overall
similar to that of a normal eukaryotic RNA polymerase
promoter (Buratowski, 1994; Tjian et al., 1994; Goodrich et
al., 1996).
Although the overall structure of promoters is similar to
that of eukaryotes, several factors are divergent as observed
in GBP 130 (Horrocks et al., 1998). First, the distance
between the cis-acting elements and the transcriptional start
site is much longer than the distance in other eukaryotes
(Levitt, 1993; Horrocks and Kilbey, 1996; Crabb and
Cowman, 1996). Secondly, comparison of the 37 bp cis-
acting sequence of GBP-130 in the parasite similar to
corresponding eukaryotic sequences, has revealed that cis-
acting elements in parasites do not share homology with
eukaryotic cis-acting elements, suggesting evolutionary
divergence of these regulatory elements in Plasmodium.
5. Search for cis-and trans-acting elements
in Plasmodium by genome mining
The recent searches for transcriptional machinery and
specific transcription factors through Plasmodium genome
mining has revealed that many components involved in
eukaryotic specific transcriptional regulation can not be
easily identified, suggesting that Plasmodium might
use different mechanisms for transcriptional regulation
(Aravind et al., 2003). Although a few general transcription
factors, like TBP and TFIID have been identified, the
genome mining and proteome analysis has indicated a
paucity of recognisable transcription factors in
P. falciparum, emphasising the importance of epigenetic
mechanisms of transcriptional regulation in these organisms
(see Aravind et al., 2003 for a review and other references).
Simply searching by overall sequence homology can be
limiting, however, because while the functional regions of
the proteins are conserved, the trend in Plasmodium has
been that the remaining parts of the proteins show much
variation, including in the few general transcription factors
successfully cloned in P. falciparum. In Plasmodium, the
regions of the TATA-binding protein which contact
the DNA have been shown to be extremely conserved, but
the overall structure and remainder of the protein is quite
different with much less conservation in amino acid
sequence (Hernandez, 1993; McAndrew et al., 1993).
Recently, amino acid sequence search has revealed the
presence of a specific transcription factor, c-Myb, although
it’s role needs to be confirmed in biological functional
studies (Briquet et al., 2003. Molecular analysis of two
annotated transcription factors in P. falciparum. The Journal
of Eukaryotic Microbiology. Abstract for 41st annual
meeting for Society of Protozoologist). Therefore, identifi-
cation of genes simply by sequence homology, while
possibly identifying the presence of some transcription
factors, will yield only a partial list and other methods must
be employed to determine and validate the presence or
absence of putative transcription factors. In addition to the
search for these trans-acting elements, efforts to elucidate
the presence of cis-acting DNA elements in the genome
have also been undertaken. Whether the elements have
biological relevance has not been confirmed yet (Briquet
et al., 2003. Molecular analysis of two annotated transcrip-
tion factors in P. falciparum. The Journal of Eukaryotic
Microbiology. Abstract for 41st annual meeting for Society
of Protozoologist)
Using bioinformatics search for cis-acting elements in
Plasmodium, Militello et al. (2004) concluded that regulat-
ory sequences in the parasite are not homologous to
standard eukaryotic regulatory sequences. This study
characterised a ‘G-box’ which is an unusually G-rich
sequence element upstream of HSP genes, while lacking
standard eukaryotic sequences like CCAAT boxes or Sp1
binding sites. However, the bioinformatics analysis did
confirm previous data on the preservation of other features
![Page 5: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/5.jpg)
Table 1
Consensus binding sequencesa used in Panomics TranSignal Array
AP-1 CGCTTGATGACTCAGCCGGAA
AP-2 GATCGAACTGACCGCCCGCGGCCCGT
ARE CTACGATTTCTGCTTAGTCATTGTCTTCC
Brn3 CACAGCTCATTAACGCGC
CBF AGACCGTACGTGATTGGTTAATCTCTT
CDP ACCCAATGATTATTAGCCAATTTCTGA
C/EBP TGCAGATTGCGCAATCTGCA
ERE GTCCAAAGTCAGGTCACAGTGACCTGAT-
CAAAGTT
c-Myb TACAGGCATAACGGTTCCGTAGTGA
Ets GGAGGAGGGCTGCTTGAGGAAGTATAA-
GAAT
FAST-1 CGGATTGTGTATTGGCTGTAC
MEF2 GATCGCTCTAAAAATAACCCTGTCG
Myc-Max GGAAGCAGACCACGTGGTCTGCTTCC
Pit1 TGTCTTCCTGAATATGAATAAGAAATAA
CREB AGAGATTGCCTGACGTCAGAGAGCTAG
E2F-1 ATTTAAGTTTCGCGCCCTTTCTCAA
EGR GGATCCAGCGGGGGCGAGCGGGGGCCA
Ets-1/PEA3 GATCTCGAGCAGGAAGTTCGA
GAS/ISRE CGAAGTACTTTCAGTTTCATATTACTCTA
CAA
GATA CACTTGATAACAGAAAGTGATAACTCT
GRE GACCCTAGAGGATCTGTACAGGATGTTCTA-
GATCCAATTCG
HNF-4 (1) CTCAGCTTGTACTTTGGTACAACTA
IRF-1 GGAAGCGAAAATGAAATTGACT
MEF-1 GATCCCCCCAACACCTGCTGCCTGA
NF-1 TTTTGGATTGAAGCCAATATGATAA
NFATc ACGCCCAAAGAGGAAAATTTGTTTCAT
ACA
NF-E1 (YY1) CGCTCCGCGGCCATCTTGGCGGCTGGT
NF-E2 TGGGGAACCTGTGCTGAGTCACTGGAG
NFkB AGTTGAGGGGACTTTCCCAGGC
Oct-1 TGTCGAATGCAAATCACTAGAA
p53 TACAGAACATGTCTAAGCATGCTGGGG
Pax-5 GAATGGGGCACTGAGGCGTGACCACCG
Pbx1 CGAATTGATTGATGCACTAATTGGAG
PPAR CAAAACTAGGTCAAAGGTCA
PRE GATCCTGTACAGGATGTTCTAGCTACA
RAR(DR-5) TCGAGGGTAGGGTTCACCGAAAGTTCAC
TCG
RXR(DR-1) AGCTTCAGGTCAGAGGTCAGAGAGCT
SIE GTGCATTTCCCGTAAATCTTGTCTACA
Smad 3/4 TCGAGAGCCAGACAAAAAGCCAGACATT-
TAGCCAGACAC
Smad SBE AGTATGTCTAGACTGA
Sp1 ATTCGATCGGGGCGGGGCGAG
SRE GGATGTCCATATTAGGACATCT
Stat1 (p84/p91) CATGTTATGCATATTCCTGTAAGTG
Stat3 GATCCTTCTGGGAATTCCTAGATC
Stat5 AGATTTCTAGGAATTCAATCC
Stat6 GTATTTCCCAGAAAAGGAAC
Stat4 CTAGAGCCTGATTTCCCCGAAATGATGAGC-
TAG
TFIID GCAGAGCATATAAAATGAGGTAGGA
TR GATCGTAAGATTCAGGTCATGACCTGAG-
GAGA
TR(DR-4) AGCTTCAGGTCACAGGAGGTCAGAGAGCT
USF-1 CACCCGGTCACGTGGCCTACACC
VDR(DR-3) AGCTTCAGGTCAAGGAGGTCAGAGAGCT
HSE CTGGAATTTTCTAGA
MRE CTCTGCGCCCGGCCC
a Sequences obtained from Panomics, Inc. (www.panomics.com).
N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–1458 1455
of eukaryotic transcription like upstream activation
sequences, 5 0 untranslated regions start sites, and
3 0untranslated regions.
6. Experimental search for putative transcription factors
in asexual and sexual stages of P. falciparum
In order to modulate gene expression, DNA-binding
transcription factors must be localised in the nucleus. In our
search for functional transcription factors nuclear extracts
prepared from P. falciparum were used to test for
protein/DNA binding in two independent experimental
schemes, by the high throughput TranSignal Protein/DNA
array hybridisation (Panomics, Inc. Redwood City, CA,
USA) and the traditional gel mobility shift assay. Specific
transcription factors have DNA binding domains which
interact with short stretches of sequences in the promoter
region called the upstream activating sequences, and it is
through this sequence specific interaction that specific
regulation occurs. Since the sequence recognition and
binding is crucial to the action of transcription factors, the
specificity of binding of proteins in the nuclear extract to
transcription factor-specific consensus sequences suggests
possible functional roles of such proteins.
In the TranSignal Protein/DNA array hybridisation
approach we searched for putative transcription factors
based on their ability to bind highly-conserved cis-acting
elements for eukaryotic transcription factors (Table 1).
Proteins in the nuclear extracts prepared from P. falciparum
enriched for asexual or sexual stages or from parasites
stressed by heat shock or serum starvation bound to a
number of highly conserved eukaryotic consensus DNA
binding sequences. However, a distinct differential profile
was not seen between the nuclear extracts prepared from
asexual and sexual parasites tested (Fig. 3 and Table 2).
Likewise, the binding patterns with stressed parasites were
also not different from those obtained with unstressed
parasites. Future experiments with more stringent purifi-
cation of various parasite stages may be necessary to detect
changes in profiles, in conjunction with a more quantitative
Fig. 3. High throughput screening for putative P. falciparum transcription
factors. Hybridisation patterns for putative transcription factor activities in
the nuclear extracts prepared from asexual and sexual-enriched parasites.
Membranes used were Panomic’s TranSignal Protein/DNA Array (www.
panomics.com).
![Page 6: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/6.jpg)
Table 2
Summary of results from bioinformatics searches of consensus binding sequences within the 2 kb upstream of 5 0 untranslated region (5’utr) as compared to
positive spots from the TranSignal Protein/DNA array
Transcription factor Positive in TranSignal
array
cis-element identified
within 2 kb of 5 0utr
Transcription factor Positive in TranSignal
array
cis-element identified
within 2 kb of 5 0utr
AP-1 (1) X NF-E1
AP-2 (1) NF-E2 X
ARE NFkB X
Brn3 Oct-1 X
C/EBP P53 X
CBF Pax-5 X
CDP X X Pbx1
c-Myb X X Pit 1
CREB (1) X PPAR
E2F1 X PRE
EGR X RAR (DR5) X
ERE RXR (DR1) X
Ets SIE
Ets1/PEA3 Smad SBE X
FAST-1 Smad 3/4 X
GAS/ISRE Sp1 X
GATA X SRE X
GRE X Stat1 X
HNF-4 X Stat3
HSE X X Stat4 X X
IRF-1 Stat5
MEF-1 X X Stat6
MEF-2 TFIID X
MRE X TR
Myc-Max TR (DR-4) X
NF-1 X USF-1 X
NFATc VDR (DR3) X X
The ‘positives’ from the TranSignal are spots with the greatest intensity consistently in various asexual and sexual nuclear extracts.
Table 3
Summary of some putative transcription factor activities (revealed by array
hybridisation) and their roles as suggested in the literature (see Latchman,
2004 for individual references)
AP-1 Activator protein, regulate granulysin gene
expression
C-Myb Signal transduction, proliferation and differenti ation
CREB cAMP response element
E2F1 Regulates cyclin E, critical for the expression of
S phase-specific proteins
EGR Early grown response element
MEF-1 Myogenic cell fate specification and differentiation
MRE Metal response element
NF-E2 Erythroid transcription factor
NFkB Regulators of type 1 interferon system
Pax-5 Mutations result in mouse developmental mutants
Smad 3/4 Signalling
SP1 Serine protease 1
TR(DR-4) Thyroid hormone receptor
HSE Heat shock element
N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581456
method for measurement, like real-time reverse transcrip-
tase polymerase chain reaction. Furthermore these types of
results need independent verification by traditional
approaches like gel mobility shift assay.
An initial attempt has shed further light on the
complexity of such analysis. Oligonucleotides corre-
sponding to eight of the most prominent positive hits
(c-Myb, CREB, EGR, MEF-1, NFkB, E2F1, Smad 3/4,
HSE), as well as two consistently negative by TranSignal
(Oct-1 and Stat-1), were tested in the gel mobility shift
assays. Interestingly, although band-shift was observed in
many of these positive samples the specificity of such
binding by competition was unclear. For two of the eight
examined C-Myb and MEF-1, high specific binding was
observed, but for others the specificity of DNA protein
interaction remains questionable. In some cases even
unrelated oligonucleotide sequences seem to compete for
binding of specific probes, suggesting significant random
interactions. A possible interpretation is that the recog-
nition between DNA sequences and binding proteins may
not be strictly specific to the consensus sequences tested
and may display broader binding specificity. Another
possible explanation is that binding revealed by
the TranSignal array is non-specific. While our results
suggest the presence of many putative transcription
factors, future studies are needed to directly validate
their presence and stage-specific functions. Table 3 gives
a summary of suggested role for few representative
transcription factor activities detected by array hybridis-
ation approach.
![Page 7: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/7.jpg)
N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–1458 1457
7. Bioinformatics search of Plasmodium genome
The consensus binding sequences used to identify
transcription factor activation in the TranSignal Pro-
tein/DNA array represent highly conserved eukaryotic
consensus binding sequences (Table 1). Since malaria
genome is A–T rich, it was questioned whether these
consensus binding sequences could be found in the
promoter regions of the parasite genome. We employed a
bioinformatics approach to search the consensus binding
sequences against regions of the parasite genome
expected to be involved in gene regulation. The
sequences were searched up to 2 kb upstream of the
translation initiation codons. Seventeen out of 54 hits of
100% sequence homology were revealed by BLAST
analysis. It was expected that the transcription factors
which were positive in our TranSignal array would also
be confirmed by the presence of corresponding cis-
binding sequences upstream of genes, especially since
those sequences were affinity-selected by the proteins in
the parasite nuclear extracts. Paradoxically, only six out
of 17 of our strongest positive signals were confirmed by
these searches. It is noteworthy that the program used
was developed to recognise sequences of 100% hom-
ology only. It is possible that in these organisms the
sequences involved are slightly modified, thus undetect-
able in searches requiring 100% sequence homology and
perhaps the parasite exploits variation in consensus
binding sequences as a mechanism of regulation. In our
search we also noted some discrepancy in terms of
certain consensus sequences found in promoter regions
by bioinformatics search but negative by TranSignal
array analysis. We do not know whether it is a reflection
of temporal differences in terms of expression of
transcription factors at different time points in asexually
and sexually developing erythrocytic parasites.
8. Conclusion
A clear analysis of gene expression patterns can provide
clues about how gene expression is regulated and knowl-
edge of how transcription is controlled at the molecular
level will improve our understanding of the malaria parasite.
Currently there is only scant evidence for post-transcrip-
tional control mechanisms in these organisms, emphasising
the importance of transcriptional control mechanism.
However, the fact that significant regions of the genome
have been found to be either transcriptionally active or
transcriptionally silent, suggests that parasites may also
employ translational control mechanisms. Relatively
little is known about how the parasite globally regulates
the production of proteins important for its pathogenesis and
sequential development. Only a few putative transcription
factors have been mapped to the genes that they regulate. A
clear understanding how gene expression is regulated in
malaria parasites undoubtedly will improve our ability to
unravel complexity of parasite biology, evaluate gene
function in the parasite and even identify key targets for
controlling infection caused by these parasites.
Acknowledgements
Research in the NK laboratory is supported by research
grants from the NIH and pilot grant award from the JHMRI.
References
Alano, P., Silverstrini, F., Roca, L., 1996. Structure and polymorphism of
the upstream region of the pfg27/25 gene, transcriptionally regulated in
gametocytogenesis of Plasmodium falciparum. Mol. Biochem. Para-
sitol. 79, 207–217.
Aravind, L., Iyer, L.M., Wellems, T.E., Miller, L.H., 2003. Plasmodium
biology: genomic gleanings. Cell 115, 771–785.
Baeuerle, P.A., Baltimore, D., 1988. IkB: a specific inhibitor of the NF-kB
transcription factor. Science 242, 540–546.
Bozdech, Z., Llinas, M., Pulliam, B., Wong, E., Zhu, J., DeRisi, J.L., 2004.
The transcriptome of the intraerythrocytic developmental cycle of
Plasmodium falciparum. PLOS Biol. 1, 85–100.
Buratowski, S., 1994. The basics of basal transcription by RNA polymerase
II. Cell 77, 1–3.
Cong, F., Schweizer, L., Chamorro, M., Varmus, H., 2003. Requirement for
a nuclear function of beta-catenin in Wnt signaling. Mol. Cell Biol. 23,
8462–8470.
Coulson, M.R., Hall, N., Ouzounis, C.A., 2004. Comparative genomics of
transcriptional control in the human malaria parasite Plasmodium
falciparum. Genome Res. 14, 1548–1554.
Crabb, B.S., Cowman, A.F., 1996. Characterization of promoters and stable
transfection by homologous and non homologous recombination in
Plasmodium falciparum. Proc. Natl Acad. Sci. USA 93, 7289–7294.
Dechering, K.J., Kaan, A.M., Mbacham, W., Wirth, D.F., Eling, W.,
Konings, R.N., Stunnenberg, H.G., 1999. Isolation and functional
characterization of two distinct sexual-stage-specific promoters of the
human malaria parasite Plasmodium falciparum. Mol. Cell. Biol. 19,
967–978.
Delves, C.J., Alano, P., Ridley, R.G., Goman, M., Holloway, S.P.,
Hyde, J.E., Scaife, J.G., 1990. Expression of alpha- and beta-tubulin
genes during the asexual and sexual blood stages of Plasmodium
falciparum. Mol. Biochem. Parasitol. 43, 271–278.
Florens, L., Washburn, M., Raine, D., Anthony, R., Grainger, M.,
Haynes, D., Moch, J., Muster, N., Sacci, J., Tabb, D., Witner, A.,
Wolters, D., Wu, Y., Garder, M., Holder, A., Sinden, R., Yates, J.,
Carucci, D., 2002. A proteomic view of the Plasmodium falciparum life
cycle. Nature 419, 520–526.
Fox, B.A., Li, W.B., Tanaka, M., Inselburg, J., Bzik, D.J., 1993. Molecular
characterization of the largest subunit of Plasmodium falciparum RNA
polymerase I. Mol. Biochem. Parasitol. 61, 37–38.
Goodrich, J.A., Cutler, G., Tjian, R., 1996. Contacts in context: Promoter
specificity and macromolecular interaction in transcription. Cell 84,
825–830.
Hayward, R.E., Derisi, J.L., Alfadhli, S., Kaslow, D.C., Brown, P.O.,
Rathod, P.K., 2000. Shotgun DNA microarray and stage-specific gene
expression in Plasmodium falciparum malaria. Mol. Microbiol. 35,
6–14.
Hernandez, N., 1993. TBP, a universal eukaryotic transcription factor?.
Genes Dev. 7, 1291–1308.
Hirtzlin, J., Farber, P.M., Franklin, R.M., 1994. Isolation of a novel
Plasmodium falciparum gene encoding a protein homologous to the
Tat-binding protein family. Eur, J. Biochem 226, 673–680.
![Page 8: Molecular complexity of sexual development and gene regulation in Plasmodium falciparum](https://reader036.vdocument.in/reader036/viewer/2022080109/5750737f1a28abdd2e8fbe41/html5/thumbnails/8.jpg)
N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581458
Horrocks, P., Kilbey, B.J., 1996. Physical and functional mapping of the
Plasmodium falciparum proliferating cell nuclear antigen genes
transcription start site. Mol. Biochem. Parasitol. 82, 207–215.
Horrocks, P., Dechering, K., Lanzer, M., 1998. Minireview—control of
gene expression in Plasmodium falciparum. Mol. Biochem. Parasitol.
95, 171–181.
Knowlton, A.A., Sun, L., 2001. Heat-shock factor-1, steroid hormones, and
regulation of heat shock protein expression in the heart. Am. J. Physiol.
Heart Circ. Physiol. 280, H455–H464.
Kongkasuriyachai, D., Kumar, N., 2002. Functional characterization of
sexual stage specific proteins in Plasmodium falciparum. Int.
J. Parasitol. 32, 1559–1566.
Kumar, N., Koski, G., Harada, M., Aikawa, M., Hong, Z., 1991. Induction
and localisation of Plasmodium falciparum stress proteins related to the
heat shock protein 70 family. Mol. Biochem. Parasitol. 48, 47–58.
Kumar, R., Adams, B., Oldenburg, A., Musiyenko, A., Barik, S., et al.,
2002. Characterisation and expression of a PP1 serine / threonine
protein phasphatase (PfPP1) from the malaria parasite, Plasmodium
falciparum: demonstration of its essential role using RNA interference.
Malar J. 2002;, 1–5.
Lanzer, M., Horrocks, P., 1999. Mutational analysis identifies a five
base pair cis-acting sequence essential for GBP 130 promoter
activity in Plasmodium falciparum. Mol. Biochem. Parasitol. 99,
77–87.
Lanzer, M., de Bruin, D., Ravetch, J.V., 1992. Transcription mapping of a
100 kb locus of Plasmodium falciparum identifies an intergenic region
in which transcription terminates and reinitiates. Eur. Mol. Biol. Org. J.
11, 1949–1955.
Lanzer, M., Wertheimer, S., De Bruin, D., Ravetch, J., 1993. Minireview—
Plasmodium: control of gene expression in malaria parasites. Exp.
Parasitol. 77, 121–128.
Lasonder, E., Ishihama, Y., Andersen, J.S., Vermunt, A.M.W., Pain, A.,
Sauerwein, R.W., Eling, W.M.C., Hall, N., Waters, A.,
Stunnenberg, H.G., Mann, M., 2002. Analysis of the Plasmodium
falciparum proteome by high-accuracy mass spectrometry. Nature 419,
537–542.
Latchman, D., 2004. Eukaryotic Transcription Factors. Academic Press,
New York.
Le Roch, K.G., Zhou, Y., Blair, P.L., Grainger, M., Moch, K., Haynes, D.,
De la Vega, P., Holder, A., Batalov, S., Carucci, D.J., Winzeler, E.A.,
2003. Discovery of gene function by expression profiling of the malaria
parasite life cycle. Science 301, 1503–1508.
Levitt, A., 1993. RNA processing in malaria parasites. Parasitol. Today. 9,
465–468.
Li, W.B., Bzik, D.J., Gu, H.M., Tanaka, M., Fox, B.A., Inselburg, J., 1989.
An enlarged largest subunit of Plasmodium falciparum RNA poly-
merase II defines conserved and variable RNA polymerase domains.
Nucl. Acids Res. 17, 9621–9636.
Li, W.B., Bzik, D.J., Tanaka, M., Gu, H.M., Fox, B.A., Inselburg, J., 1991.
Characterization of the gene encoding the largest subunit of
Plasmodium falciparum RNA polylmerase III. Mol. Biochem. Para-
sitol. 46, 229–239.
Lobo, C.A., Kumar, N., 1998. Sexual differentiation and development in
malaria parasites. Parasitol. Today 14, 146–150.
Lobo, C.A., Fujioka, H., Aikawa, M., Kumar, N., 1999. Disruption of Pfg27
locus by homologous recombination leads to loss of the sexual
phenotype in Plasmodium falciparum. Mol. Cell 3, 793–798.
Malhotra, P., Dasarathi, P.V., Kumar, A., Mohmmed, A., Agrawal, A.,
Bhatnagar, R.K., Chauhan, V.S., 2002. Double-stranded RNA-
mediated gene silencing of cysteine protease (falcipain-1 and -2) of
Plasmodium falciparum. Mol. Microbiol. 45, 1245–1254.
Mamoun, C., Gluzman, I., Hott, C., MacMillan, S., Amarakone, A.,
Anderson, D., Carlton, J., Dame, J., Chakrabarti, D., Martin, R.,
Brownstein, B., Goldberg, D., 2001. Co-ordinated programme of gene
expression during asexual intraerythrocytic development of the human
malaria parasite Plasmodium falciparum revealed by microarray
analysis. Mol. Microbiol. 39, 26–36.
McAndrew, M., Read, M., Sims, P., Hyde, J., 1993. Characterization of the
gene encoding an unusually divergent TATA-binding protein (TBP)
from the extremely ACT-rich human malaria parasite Plasmodium
falciparum. Gene 124, 165–171.
Militello, K.T., Dodge, M., Bethke, L., Wirth, D.F., 2004. Identification of
regulatory elements in Plasmodium falciparum genome. Mol. Biochem.
Parasitol. 134, 75–88.
Moreira, C.K., Marrelli, M.T., Jacobs-Lorena, M., 2004. Gene expression
in Plasmodium: from gametocytes to sporozoites. Int. J. Parasitol. 2004;
(this issue).
Pevsner, J., 2003. Bioinformatics and Functional Genomics. Wiley (p. 325).
Rawlings, D.J., Fujioka, H., Fried, M., Keister, D.B., Aikawa, M.,
Kaslow, D.C., 1992. Alpha-tubulin II is a male-specific protein in
Plasmodium falciparum. Mol. Biochem. Parasitol. 56, 239–250.
Scherf, A., Hernandez-Rivas, R., Buffet, P., Bottius, E., Benatar, C.,
Pouvelle, B., et al., 1988. Antigenic variation in malaria: in situ
switching, relaxed and mutually exclusive transcription of var genes
during intra-erythrocytic development in Plasmodium falciparum. Eur.
Mol. Biol. Org. J. J. 17, 5418–5426.
Tjian, R., Maniatis, T., 1994. Transcriptional activation: a complex puzzle
with a few easy pieces. Cell 77, 5–8.
Van Dijk, L.H.M., Janse, C.J., Thompson, J., Waters, A.P., Brake, J.A.M.,
Dodemont, H.J., Stunnenberg, H.G., van Gemert, G.L.,
Saurwein, R.W., Eling, W., 2001. A central role for P45/48 in malaria
parasite male gamete fertility. Cell 104, 153–164.
Wesseling, J.G., Snijders, P.J.F., Someren Van, P., Jansen, J.,
Smits, M.A., Schoenmakers, J.G.G., et al., 1989. Stage-specific
expression and genomic organization of the actin genes of the
malaria parasites Plasmodium falciparum. Mol. Biochem. Parasitol.
35, 167–176.