![Page 1: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/1.jpg)
Mutagenesis of Actinomycetes Workshop
July 11 –15 2005University of Wales Swansea
ActinoGENSIXTH FRAMEWORK PROGRAMME
SIXTH FRAMEWORK PROGRAMMEPRIORITY 1
LIFE SCIENCES, GENOMICS AND BIOTECHNOLOGY FOR HEALTH
![Page 2: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/2.jpg)
Actinomycetes are an important resource for new
antibiotics • techniques to manipulate actinomycete genes are vital to exploiting this resource
• precursor biosynthesis
• regulatory networks
• antibiotic biosynthetic genes
• exemplified in S. coelicolor
![Page 3: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/3.jpg)
Why Streptomyces coelicolor ?
Undecyl-prodigiosin
“red”
Actinorhodin
“act”
• Streptomycetes makes two- thirds of all natural antibiotics
• Genome sequenced
• 8,667,507bp Chromosome
• G+C content of 72.1%
• contains 7825 orfs
![Page 4: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/4.jpg)
Genome sequencing was based on a detailed genetic and physical map
![Page 5: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/5.jpg)
John Innes Centre:Proteomics &Redirect mutagenesis
University of Surrey:microarrays
UMIST:Bioinformatics & metabolomics
University of Warwick:20 metabolite analysis
University of WalesSwansea:Systematic mutagenesis
Functional genomics of Streptomyces coelicolor
![Page 6: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/6.jpg)
Mutagenesis
Three techniques that exploit the genome sequence:
(1) In vitro transposon mutagenesis – systematic
(2) In vivo transposon mutagenesis – identify genes of related function
(3) PCR targetting (Redirect) – functional analysis of a set of genes
![Page 7: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/7.jpg)
(1) In vitro ‘shuttle’ transposition
Tn5062 [AprR oriT]
+Cosmid
Target Site
• Transposition is (fairly) random• Target site is duplicated and Insertion Sequence integrated
Ref: Bishop et al 2004 Genome Research 14: 893-900
![Page 8: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/8.jpg)
transposase
In vitro transposition
(1) Mutant cosmid isolation
+cosmid Tn5062
+
Transform E.coli [AprRKanRAmpR ]
Isolate cosmid DNA
Sequence
In vitro transposon mutagenesis
![Page 9: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/9.jpg)
Organisation of Tn5062
MEstop RBS gfp apramycinR MEoriTT4T4
EZR1 sequencing primer
![Page 10: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/10.jpg)
Analysis of Tn5062 insertions
• sequence files are directly processed using Transposon Express software
• finds boundary of Tn5062 sequence
• compares succeeding sequence with cosmid or genome sequence
• reports coordinates of insertion and identity of disrupted gene
Ref: Herron et al 2004 Nucleic Acids Res 32: e113
![Page 11: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/11.jpg)
Transposon Express
![Page 12: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/12.jpg)
![Page 13: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/13.jpg)
![Page 14: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/14.jpg)
http://streptomyces.org.uk/S.coelicolor/index.html
• location and description of each insertion provided at:
![Page 15: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/15.jpg)
Progress to date:
• 105 of 319 cosmids fully processed
• 11493 independent insertions
• 10459 insertions in 2520 orfs (of 7825 in total)
• 4.2 insertions per orf
Systematic mutagenesis of Streptomyces coelicolor A3(2)
![Page 16: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/16.jpg)
![Page 17: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/17.jpg)
Advantages of systematic in vitro transposon mutagenesis
• High throughput
• Conjugation and the recovery of gene replacement clones are efficient, so that many replicate clones are obtained for phenotypic testing
• With one insertion per 280 bp, phenotypic analysis of several independent insertions in a given gene obviates the need for linkage analysis
• Mutations can be moved into different genetic backgrounds, facilitating analysis of gene interactions
![Page 18: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/18.jpg)
Advantages of systematic in vitro transposon mutagenesis
• Mutations can be stored and shipped as: cosmid DNA E coli containing cosmids Streptomyces mutants
• A Tn5062 insertion can be manipulated to: change resistance marker (eg switch AprR to HygR ) leave an in-frame deletion induce transcription of downstream genes
![Page 19: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/19.jpg)
MEstop RBS gfp apramycinR MEoriTT4T4
Tn5062
Tn5066
Tn5069
Tn5070
MEstop RBS gfp hygromycinR MEoriTT4T4 Thyg
MEstop RBS luxABluxAB hygromycinR MEoriTT4Thyg
ME Tmmr tetR hygromycinR MEoriTT4Thygtcp
exchange cassettes can be excised as PvuII fragments and used to:
(1) replace an existing Tn5062 insertion by Red recombination in E.coli
(2) for de novo in vitro transposon mutagenesis
![Page 20: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/20.jpg)
Select for marker replacement
[AprRKanS]
usually 1-10% of exconjugants if gene/operon is non-essential
Transfer by conjugation from
E.coli ET12567(pUZ8002) into
S. coelicolor
Transfer of mutated cosmid to Streptomyces
X X
AprKm
Apr
![Page 21: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/21.jpg)
SCO5751
1 2 3 4 x 5 6 7
Bam
HI
Sph I osaB
response regulator
osaA
hybrid histidine kinase
SCO5750
1 kb
6279200 bp 6290053 bp
Insertional mutagenesis of cosmid SC7C7
osaB complementing DNA
![Page 22: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/22.jpg)
Mutant phenotypes
R2YE (containing 10.3% sucrose)
A: wild type
B: osaB mutant [insertion x, Tn5493]
1) S. lividans
A B
A:wild type B:osaA (HK) mutant [insertion #1]; C:osaB (RR) mutant+vector; D:osaB (RR) mutant (complemented); E:osaB (RR) mutant [insertion #5]
2) S. coelicolorR2YE MS + 250mM KCl MS
![Page 23: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/23.jpg)
• osaB encodes a response regulator (insertion 5) that is essential for osmoadaptation during the transition between vegetative and reproductive growth
osaAB, genes involved in osmoadapation
• osaA mutants (1-4) all exhibit delayed aerial hyphal formation in the presence of osmolyte; a second orphan HHK (SCO7327) may also be involved in osmoadaptation
• SCO5750 mutants (6) are unaffected by osmolyte; insertions 1-5 are non-polar with respect to SCO5750
• osaB complementation, with a fragment initially cloned linked to AprR of insertion 7, indicates osaA and osaB are independently transcribed
• insertions 1 and 5 have been successfully introduced into S. lividans: similar phenotypes as for the S.
coelicolor osaAB mutants were obtained
1 2 3 4 x 5 6 7
osaB
response regulator
osaA
hybrid histidine kinase
![Page 24: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/24.jpg)
Transcription
pro
mo
ter
Truncatedprotein
Translation Translation
eGFP
Monitoring of gene expression
Expression analysis of mutated gene
Chromo-
some
ME stop RBS gfp apramycin
resistance gene
MEoriTT4T4
Tn5062
![Page 25: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/25.jpg)
osaB is induced by hyperosmolarity
+ sucrose
- sucrose
![Page 26: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/26.jpg)
osaB has its own promoter
Timecourse of osaB expression: mRNA isolated from R2YE-grown cultures
12 – 72h t g c a
6285056 chromosome position……
cttctggtctcccgccgcgcttccgctacgagcacagtgacatcacggtgacagggtgtg
gcgacaggcggggtgcggctacgatgaccggcacaaggacgggcggcgcaagggagtcgt
cccccggggcggcacccgccggtgccgtgccaagtcctgtggacaggggaggccccacgc
cggggcgaggagggcgggccatggtgcagaaggccaagatcctcctggtcgatgaccggc
cggagaatctgcttgcgctggaggcgatcctctcggcgctcgatcagacgctggtgcggg
-35 -10
Translation start
Transcription start
![Page 27: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/27.jpg)
0
0.5
1
1.5
2
2.5
20h 36h 46h 71h 84h
Time (h)
Und
ecyl
prod
igio
sin...
A53
0 m
l-1 A
450-1
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0.08
20h 36h 46h 71h 84h
Time (h)
Tot
al b
lue
pigm
ents..
.
A64
0 m
l-1 A
450-1
osaB mutant (+S)
wild-type (+S)
osaB mutant (-S)
wild-type (-S)
Overproduction of ACT and RED in an osaB mutant
![Page 28: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/28.jpg)
wild-type osaB mutant Complemented
strain
Overproduction of ACT and RED in an osaB mutant
![Page 29: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/29.jpg)
Osmoadaptation – conclusions
• the response regulator encoded by osaB is essential for developmental osmoadaptation
• osaB impacts on antibiotic production in conditions of hyperosmolarity
• unlike most sensory kinase-response regulator gene pairs, osaB is independently transcribed
• the sensory kinase encoded by osaA is required for osmoadaptation, but not essential – another kinase may also interact with OsaB
![Page 30: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/30.jpg)
(2) In vivo transposon mutagenesis
Kay Fowler
AimGenerate a library of transposon induced, tagged mutants for gene function studies
![Page 31: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/31.jpg)
Tn4560 (8 kb)Derived from Tn 4556 of Streptomyces fradiae (Chung 1987)
Viomycin phosphotransferase gene for selection in Streptomyces
38 bp IRsRecombinase ?
38 bp IRs~Tn3
vph
![Page 32: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/32.jpg)
Tn4560 delivery plasmid pKAY1
• based on temperature-sensitive plasmid pUC1169 (derivative of pIJ101 containing Tn4560)
• pOJ260 (contains E. coli ori and oriT) was cloned at the unique BamHI site
• encodes a truncated Rep protein due to mutation at the unique BstBI site:
-GCCCCGTTCGCGAACTCCTCGGACGGATCGGGGACCTGA-AlaProPheAlaAsnSerSerAspGlySerGlyThr***
![Page 33: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/33.jpg)
Transposon delivery on pKAY1 introduced into Streptomyces by conjugation from E. coli
1. Mix Streptomyces and E. coli on agar plate2. Overlay with antibiotics:
Nalidixic acid or carbenicillin to kill E. coliViomycin to select Streptomyces::Tn
>1000 colonies containindependent Tn insertions
Conjugation plate2d after overlay
![Page 34: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/34.jpg)
In vivo transposon mutagenesis
• wash off microcolonies
• plate on SFM viomycin
• harvest spores = Tn library
• plate library using conditions to detect a specific phentype
• isolate DNA from mutant
• Ligation-mediated PCR
![Page 35: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/35.jpg)
Ligation-mediated PCR for target sequence amplification
End primer
PCR Product
1. Digest DNA using EagI (C’GGCCG)
2. Ligate non-phosphorylated End primer/Adaptor
3. PCR
Genome
Tn primerNo ligation
Ligation
Tn primerEnd primer
3’ nested
Transposon Adaptor
![Page 36: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/36.jpg)
Target sequence identification
• Use TA cloning to clone PCR products
• Sequence inserts
• Blast sequence against genome to identify target gene
![Page 37: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/37.jpg)
(3) PCR targetting (Redirect)
Bertolt GustTübingen
![Page 38: Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS](https://reader036.vdocument.in/reader036/viewer/2022062407/56649e1a5503460f94b07384/html5/thumbnails/38.jpg)
Acknowledgements
Swansea:
Amy Bishop osaAB
Sue Fielding sequencing
Paul Herron in vitro transposition
Gareth Hughes Transposon Express
Ricardo del Sol exchange cassettes
Norwich:
Govind Chandra ScoDB
Tobias Kieser in vivo transposon mutagenesis
Kay Fowler in vivo transposon mutagenesis