![Page 1: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/1.jpg)
MUTATION AND POLYMORFISM
Genetics and genomics for ED students 20.02.2015.
![Page 2: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/2.jpg)
Genetic variability
- is increased by – mutation
– sexual reproduction
meiosis (generation of gametes)
- homologous recombination (crossing over) - independent assortment of homologous chromosomes
fertilisation
- significance
![Page 3: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/3.jpg)
DNA
DNA variants, alleles(any coding or non-coding sequence)
Mutation causing any
change)
Genetic (DNA) polymorphism
![Page 4: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/4.jpg)
Significance of mutation (for all species)
Without mutation, evolution would not be possible. This is because mutations provide the "raw material" upon which the mechanisms of natural selection can act.
![Page 5: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/5.jpg)
• normal or wild variant (allele) is the most frequent in a population
• polymorphism (or polymorphic) is the variant (allele) if its frequency is › 1 % in the population (formerly:having no effect on phenotype)
• mutation (or mutant) is the variant (allele) if itsfrequency is ‹ 1 % in the population
(formerly: disease causing, it has a negative connotation)
Regarding the variants….
![Page 6: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/6.jpg)
Long way from mutation to polymorphism
Appearance of new variant by mutation Survival of rare allele
Increase in allele frequency after population expand
New allele is fixed in population as novel polymorphism
![Page 7: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/7.jpg)
Classification of mutation types
• by the cause
• by the site
• by the function
• by the fitness
• by the size
![Page 8: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/8.jpg)
By the cause mutations may be
• Spontaneous
• Induced
![Page 9: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/9.jpg)
![Page 10: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/10.jpg)
Spontaneous mutation
- Spontaneous chemical reactions in bases• Tautomerization• Depurination • Deamination
- Errors in DNA related processes• Replication• Recombination• Repair
![Page 11: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/11.jpg)
E.g. Tautomers of adenine
T - A
Imino groupAmino group
(Purine-Purine)
results
Frequent rare
![Page 12: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/12.jpg)
Depurination (hydrolysis)
![Page 13: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/13.jpg)
Deamination
Repaired Not repaired
DNA methylation(regulation of DNA functions, see epigenetics)
Mutation hot spot
![Page 14: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/14.jpg)
Induced mutation
Some environmental agent = mutagen– physical - radiation
• Heat• UV• Ionizing
– chemicals • Natural toxins• Synthetic substances
– Laboratory substances– Pollutants– Chemoterapeutics
![Page 15: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/15.jpg)
Natural substances
Psoralen
Aflatoxin Aspergillus sp.
![Page 16: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/16.jpg)
Laboratory chemicals: acridine orange, ethidium bromide, propidium jodide
A senescent endothelial cell stained with the fluorescent dye acridine orange to visualise the lysosomes.
Fluorescent dyes
BrdU - thymine analogue
Acrylamide Polyacrylamide
![Page 17: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/17.jpg)
Pollutants
E.g. benzpyrene Metabolized to epoxides in liver polyaromatic hydrocarbons (PAH)
DNA adduct
Mutation
![Page 18: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/18.jpg)
Biological warfare agent
Mustard gase
Iranian victim (end of 20th century)
I. World war victim (beginning of 20th century)
![Page 19: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/19.jpg)
Correction of DNA errors
• DNA polymerase with proofreading ability
• Repair mechanisms nuclear but not mitochondrial DNA
![Page 20: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/20.jpg)
DNA repair mechanisms
• Direct repair the change is reversed
no template is needed
mainly in prokaryotes
• Excision repair template is needed
in eukaryotes
![Page 21: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/21.jpg)
Repair of single strand damage(complementer strand is used as template)
![Page 22: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/22.jpg)
Xeroderma pigmentosum is caused by the defective nucleotide excision repair enzymes
![Page 23: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/23.jpg)
Repair of double strand breaks (DSB)
may result loss of nucleotides = deleterious
Sister chromatid (after S phase) or like in meiosis, homologous chromosome is used as template = safety
![Page 24: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/24.jpg)
Multicellular cell cycle
GoG2
G1
S
M-phase
Restriction point
G2
M
- Growth factors- anchorange
mitosis cytokinesis
Interphase
Checkpoints:Restriction pointG2M (spindle)
![Page 25: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/25.jpg)
Function and activity of checkpoint machinery
G1 G2 M
DNA damage free kinetochors not complete DNA replication sensor protein kinases
transducer
effector s t o p of c e l l c y c l e
repair
![Page 26: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/26.jpg)
Ataxia telangiectasia (ATM=sensor)
Its mutation causes rare, neurodegenerative, inherited disease (AR), that affects many parts of the body and causes severe disability, characterized by radiosensitivityand different tumors.
![Page 27: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/27.jpg)
Role of BRCA (transducer) proteins in DNA repair
BRCA mutations are found in breast and ovarian tumors.
![Page 28: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/28.jpg)
p53
![Page 29: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/29.jpg)
Site of mutations - in the organism
• Somatic - in somatic cells
localized- inherited within cells of an organism
(mosaicism: tumors,
antibody diversity, etc.)
higher in dividing cells
• Generative - in primordial
germ line inherited from one
generation to the next one
![Page 30: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/30.jpg)
And nondisjunction of sex chromosomes
![Page 31: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/31.jpg)
B.R. Korf: Human Genetics and Genomics,2006
Site of mutations - in a gene may be
1/ Promoter mutations decreased transcription2/ Exon mutations amino acid change or truncated protein (stop) see later3/ Intron mutations errors in splicing4/ Polyadenylation site mutations decreased mRNA stability 5 5 UTR disturbed ribosome binding
1 2
3 4
UTR UTR
Mutations of other regulatory sequences (enhancers, silencers) also may influence transcription.
![Page 32: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/32.jpg)
Splicing mutations
B.R. Korf: Human Genetics and Genomics,2006
![Page 33: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/33.jpg)
Splicing mutations
B.R. Korf: Human Genetics and Genomics,2006
![Page 34: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/34.jpg)
Different mutations of a gene may lead to different malfunctions of the protein(=CFTR)
Most frequent
![Page 35: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/35.jpg)
Function and mutationsBack mutation or reversion is a point mutation that restores the original sequence and hence the original phenotype.
Lethal mutations are mutations that lead to the death of the organisms which carry the mutations.
Gain-of-function mutations - change the gene product such that it gains a new and abnormal function. These mutations usually have dominant phenotypes.
Loss-of-function mutations - gene product having less or no function. Phenotypes associated with such mutations are most often recessive.
Exception is when the reduced dosage of a normal
gene product is not enough for a normal phenotye
(this is called haploinsufficiency).
Dominant negative mutations - the altered gene
product acts antagonistically to the wild-type allele.
These mutations are characterised by a dominant
phenotype. In humans, dominant negative mutations
have been implicated in cancer (e.g. mutations in
genes p53, ATM).
![Page 36: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/36.jpg)
Fitness and mutations
- Most are neutral – during evolution later may be harmful or beneficial
- Some are beneficial – - harmful one mutates back to wild - getting beneficial function – diversity of antibody - CCR532 – HIV resistency - sickle cell anemia – malaria resistency
- Some are harmful – causing diseases (all monogenic inherited diseases)
![Page 37: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/37.jpg)
Size of mutations
• Large Genome mutation = change of chromosome number
• Medium Chromosome mutations = change of chromosome structure
• Small gene mutations = ranging from a change of single nucleotide to a whole gene (not visible) Affecting the lenght of DNA Deletion (single base or shorter-longer sequences)
Insertion (single base or shorter-longer sequences- repetitive more insertion than deletion
No effect on the length of DNA
nucleotide substitution
Cytogenetics
![Page 38: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/38.jpg)
38
Repetitive insertions
– Tandem repeats• Satellite DNA
– pericentromeric heterochromatin
• Minisatellite (VNTR)– 10-60 bp– Telomere
• Microsatellite (STR=short tandem repeats)– 2- some bp– good markers of kinship– Repeat number expansion diseases
– Interspersed repeats: • SINEs (Short Interspersed Elements), • LINEs (Long …) e. g. L1
![Page 39: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/39.jpg)
Microsatellite (STR = short tandem repeats)
• 1-4 bp• Trinucleotide (triplet) repeats are very frequent
– only few of them cause disease
![Page 40: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/40.jpg)
(huntingtin)(Huntingtin)
Trinucleotide repeats may be either in coding(C) or noncoding (NC) region
NC
C
NC
C
C codingNC noncoding
![Page 41: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/41.jpg)
Polyglutamine Polyalanine disorders disorders
• CAG repeats
• Neurodegenerative disorders • Different proteins
• Gain of function mutations
• Variable length
• Expansion
• Replicational slippage
![Page 42: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/42.jpg)
Replication slippage
![Page 43: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/43.jpg)
MATLEKLMKAFESLKSFQQQQQQQQQQQQQQQQQQQQQQQPPPP
PPPPPPPQLPQPPPQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRPK
KELSATKKDRVNHCLTICENIVAQSVRNSPEFQKLLGIAHELFLLCSDD...
Huntingtin
• 350 kD protein • ubiquitously expressed • function unknown • correlation between repeat size and age of onset and the severity of disease (Huntington chorea)
Huntington
healthy
![Page 44: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/44.jpg)
Polyglutamine Polyalanine disorders disorders
• CAG repeats
• Neurodegenerative disorders • Different proteins
• Gain of function mutations
• Variable length
• Expansion
• Replicational slippage
• GCX repeats
•Developmental abnormalities
• Transcription factors
• Loss of function mutations
• Constant length
• Stable
• Uneven crossing over
![Page 45: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/45.jpg)
Uneven crossing over
![Page 46: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/46.jpg)
Unevensister chromatid exchange
![Page 47: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/47.jpg)
Disorder Gene
• Holoprosencephaly ZIC2
Polyalanine disorder
![Page 48: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/48.jpg)
Deletion or insertion of a single nucleotide (InDel)
It is a frameshift mutation if number of nucleotide is not a multiple of three,and in-frame if number of nucleotide is a multiple of three
![Page 49: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/49.jpg)
DNA
mRNA
protein
Mutant protein
![Page 50: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/50.jpg)
Medium InDel mutations
• Deletion– Pl. Hypodontia
(Deletion of Pax 9)
• Insertion– (retro)transposons
• Eg. L1 hemophilia A
L1 is a LINE: Long Interspersed Elements
![Page 51: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/51.jpg)
51
L1 insertion and recombination in Hemophilia A
Hemophilia A inversion mutation due to recombination between L1 repetitive sequences within (gray arow) an outside (red arrow) the F8 gene
VIII. Blood clotingfactor gene (F8)
![Page 52: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/52.jpg)
Single nucleotide substitution
![Page 53: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/53.jpg)
Nucleotide substitutions in coding region
Transition
Transversion
Pyr ↔ PyrPu ↔ Pu
Pyr ↔ Pu
Synonymous not synonymousNo change in amino acid change of amino acid or no amino acid
More frequent in human
![Page 54: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/54.jpg)
Missense mutation – sickle cell anemia
![Page 55: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/55.jpg)
Frequences of disease causing mutations
![Page 56: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/56.jpg)
![Page 57: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/57.jpg)
![Page 58: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/58.jpg)
Polymorphism
• Polymorphism appears at different levels:
– Phenotype polymorphism– Protein polymorphism (Immunoglobulins, ABO blood groups)– Genetic (DNA) polymorphism
![Page 59: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/59.jpg)
Rate of genetic polymorphism
– Identity between individuals = 99,5%
– Difference between individuals = 0,5%
![Page 60: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/60.jpg)
• It is variation of DNA sequence that is common in the general population (>1%)
• Most are neutral, but some confer susceptibility or resistance to disease
• In human genome there are many, that is why can be used for personal identification
• Detection technics are available
DNA Polymorphism
![Page 61: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/61.jpg)
Genetic polymorphism
• chromosomal (minor variants)• tandem repeats
Satellite DNApericentromeric heterochromatin
Minisatellite (VNTR)Telomere
Microsatellite (STR=short tandem repeats)
• Single nucleotide polymorphism (SNP)
![Page 62: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/62.jpg)
Chromosomal polymorphism
1, 9,16 chromosomes centromeresY chromosome long arm
![Page 63: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/63.jpg)
ATGGTAAGCCTGAGCTGACTTAGCGT ATGGTAAACCTGAGTTGACTTAGCGT SNP SNP
Nucleotide substitution=SNP(single nucleotide polymorphism)
![Page 64: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/64.jpg)
Disease resistant population Disease susceptible population
Genotype all individuals for thousands of SNPs
ATGATTATAG ATGTTTATAG
Resistant people all have an ‘A’ at position 4 in geneX, while susceptible people have a ‘T’
geneX
![Page 65: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/65.jpg)
PPARG = Peroxiszóma Proliferátor Aktivátor Receptor γ, APOE = Apolipoprotein E; F5 = Faktor V; CTLA4 = Cytotoxikus T-lymphocyta Antigén 4; GSTM1 =Glutathione S-transferase Mu 1; INS = inzulin;KCNJ11 = ATP szenzitív K+csatornát kódoló gén; HF1/CFH = Komplement faktor H;COL1A1 = Kollagén 1 típus A1; CARD15 = Caspase Recruitment Domain 15;
Some disease associated SNPs
Association ≠ correlation
![Page 66: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/66.jpg)
CNVR = copy number variations
1 kb - 5 megabAbout 1500 CNV12% of genome2900 gene
![Page 67: MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015](https://reader035.vdocument.in/reader035/viewer/2022081519/56649ed05503460f94bde9bd/html5/thumbnails/67.jpg)
is based on mutations and polymorphisms