![Page 1: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/1.jpg)
Recent findings from NGS studies in eye diseases
Dr.P.Sundaresan
Senior Scientist
Aravind Medical Research Foundation
Aravind Eye Hospital
Madurai
NGS conference-Genotypic-Bangalroe-11th Sep.2014
![Page 2: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/2.jpg)
![Page 3: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/3.jpg)
• 285 million people
• USA- direct and indirect costs associated with adult visual disorders is $35.4 billion
• Genetic factors play a significant role in all common ocular diseases.
![Page 4: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/4.jpg)
![Page 6: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/6.jpg)
![Page 7: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/7.jpg)
Ocular diseases/leading cause of blindness
worldwide.• Age-related cataract - results from clouding of the lens
• Age-related macular degeneration leads to loss of central vision as a result photoreceptor cell death.
• central corneal thickness (CCT) in. For instance, a thinner CCT is a risk factor for primary open angle glaucoma (POAG) and is also associated with keratoconus (KC)
• Diabetic retinopathy (DR) is the most common microvascular complication of types 1 and 2 diabetes mellitus
• Fuchs endothelial corneal dystrophy (FECD) is characterized by bilateral, progressive loss of corneal endothelial cells and thickening of Descemet’s membrane.
• Primary Open Angle Glaucoma : Glaucoma refers to a heterogeneous group of disorders that are characterized by progressive loss of retinal ganglion cells and their axons that produces characteristic glaucomatousoptic neuropathy.
• Primary angle closure glaucoma (PACG) is characterized by obstruction of the iridocorneal angle by the iris, which leads to impaired aqueous humor outflow and increased IOP.
• Leber hereditary optic neuropathy (LHON) is a mitochondrial-mediated, maternally inherited disease that leadsto degeneration of retinal ganglion cells and loss of central vision in early life.
• Keratoconus (KC) is a degenerative corneal disorder characterized by localized thinning and protrusion of the cornealstroma.
• Leber congenital amaurosis (LCA) is an autosomal recessive disorder that results from dysfunction and degeneration of photoreceptors.
![Page 8: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/8.jpg)
![Page 9: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/9.jpg)
• The Human Genome Project -identified and mapped the 20 000–25 000 human genes
• SNPs can be used as genetic markers in association studies.
• To date the majority of large-scale genetics studies have used somewhere between 500 000 and 2 500 000 SNPs genotyped on high-throughput genotyping arrays.
• Genome-wide association studies (GWAS) are designed to investigate the associations between SNPs and traits or diseases by comparing the frequency of alleles of a group of people with a particular disease (cases) to that of another group without that disease (controls).
![Page 10: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/10.jpg)
• In recent years, there has been a dramatic increase in gene discovery for ocular diseases, driven by large-scale genome-wide association studies (GWASs), powerful meta-analyses, and next-generation sequencing technologies (eg, whole-exome sequencing).
• Gene discovery has also fueled translational researchgeared toward development of gene-based screening tests and targeted gene therapies.
![Page 11: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/11.jpg)
The output of a GWAS can be displayed in a figure, referred to as a
Manhattan plot
![Page 12: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/12.jpg)
![Page 13: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/13.jpg)
KEY POINTS
• Genome-wide association studies have shed considerable insight into the genetic mechanisms of eye disease.
• Recently seven novel genes have been found to be associated with age- related macular degeneration and over 20 genes have been implicated in the development of myopia or refractive error.
• A genome-wide association study of primary angle closure glaucoma identified significant associations at three separate regions
![Page 14: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/14.jpg)
![Page 15: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/15.jpg)
A map of human genome variation from population-scale sequencing
• Nature Volume: 467, Pages: 1061–1073 (28 October 2010)
• The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation as a foundation for investigating the relationship between genotype and phenotype. Here we present results of the pilot phase of the project, designed to develop and compare different strategies for genome-wide sequencing with high-throughput platforms. We undertook three projects: low-coverage whole-genome sequencing of 179 individuals from four populations; high-coverage sequencing of two mother–father–child trios; and exon-targeted sequencing of 697 individuals from seven populations. We describe the location, allele frequency and local haplotype structure of approximately 15 million single nucleotide polymorphisms, 1 million short insertions and deletions, and 20,000 structural variants, most of which were previously undescribed. We show that, because we have catalogued the vast majority of common variation, over 95% of the currently accessible variants found in any individual are present in this data set. On average, each person is found to carry approximately 250 to 300 loss-of-function variants in annotated genes and 50 to 100 variants previously implicated in inherited disorders. We demonstrate how these results can be used to inform association and functional studies. From the two trios, we directly estimate the rate of de novo germline base substitution mutations to be approximately 10−8 per base pair per generation. We explore the data with regard to signatures of natural selection, and identify a marked reduction of genetic variation in the neighbourhood of genes, due to selection at linked sites. These methods and public data will support the next phase of human genetic research.
![Page 16: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/16.jpg)
Genetics of Eye diseases
Inheritance of cataract gene Albinism family
Single gene diseases Complex gene diseases
Mitochondrial
disease
Congenital cataract,
Albinism ,
Corneal dystrophies
Diabetic Retinopathy, Age related
macular degeneration and
cataract, Leber’s congenital
amaurosis, Glaucoma, Pseudo
exfoliation syndrome,
Microphthalmia, Anophthalmia ,
Coloboma , Keratoconus
Leber’s hereditary
optic neuropathy
(LHON)
![Page 17: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/17.jpg)
Genetics studies on various eye diseasesPhenotype Gene----------------------------------------------------------------------------------------------------------------Aniridia - PAX6
CRYAA, CRYAB, CRYBA1CRYBA4, Cataract CRYBB1, CRYBB2, CRYGC, CRYGD,
CRYGS, GJA3, GJA8, BFSP1 and HSF4.Primary Open Angle Glaucoma - MYOC, OPTN, WDR36Congenital Glaucoma - CYP1B1Exfoliation glaucoma - LOXL1Biomarker study on GlaucomaCongenital Hereditary Endothelial Dystrophy - SLCA411Fush’s Dystsrophy - COLA2Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF
RAGE, ALR2,ERO Oculocutaneous and Ocular Albinism - TYR, P, MC1R , TYRP1, MATP, GPCR143BPES - FOXL2Retinoschisis - RS1FEVR - FZD4 LCA - CRX, RPE65, LHON - MCA – GDR6RP - RPE65 Duane Syndrome - SALL4Congenital Rubella Syndrome - E2
![Page 18: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/18.jpg)
Disease Gene No.of variations identifiedAniridia PAX6 14
Primary open angle glaucoma (POAG) MYOC 9
OPTN 1
OPTC 4
CYP1B1 3
Congenital glaucoma CYP1B1 12
Congenitaland cataract GJA3 2
GJA8 2
Age related cataract EPHA2 3
ARMS2 2
HTRA1 2
Microphthalmia,Anaphthalmia,Coloboma (MAC) GDF3 1
GDF6 2
Oculocutaneous Albinism TYR 20
P 4
MC1R 7
TYRP1 1
MATP 3
Ocular Albinism GPR143 1
Blepharophimosis Ptosis Epicanthus inversus Syndrome FOXL2 12
Diabetic retinopathy (DR) VEGF 4
eNOS 1
PEDF 4
RAGE 3
CFH 2
HTRA1 1
ARMS2 1
ALR2/AKRIBI 3
EDN1 1
ICAM-1 1
HFE 0
EPO 1
Leber's hereditary optic neuropathy (LHON) ND1 0
ND4 2
ND6 1
Leber's congenital amaurosis (LCA) RPE65 2
X-linked retinoschisis RS1 10
Familial exudative vitreoretinopathy FZD4 3
Age related macular degeneration (AMD) CFH 1
Congenital hereditary endothelial dystrophy (CHED) SLC4A11 17
Fuchs endothelial corneal dystrophy (FECD) COL8A2 5
SLC4A11 5
Keratoconus VSX1 4
Pseudoexfoliation LOXL1 2
Total 179
![Page 19: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/19.jpg)
Indian Genetic Disease Database
• Eye Disorders
• (www.igdd.iicb.res.in).
![Page 20: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/20.jpg)
2. Fragment genomic DNA 3. Capture target sequences
4. Elute target-enriched
sample
5. Perform next
generation
sequencing
~10 million reads
6. Align reads to
reference
sequenceTACATTTGGGAAAAGTAAATTTGCTGAAAATAATCCCGGT
AAGAAAGAAACACTTTTCATGTAATTAGCTTTTTTACATC
AAACTTCAGAACCCAAAGTCATTGAGAATATTAGGGATCA
CAGAACCACATGAGTCAGAATCATCAGAATATCCCACCAA
AGGAGAAGGAAGGAGCAGAGGATTCAAAAGGAAATGGAAT
GATGAATATGAAGAAATGTCAGAAATGAAAGAAGGGAAAG
GAAATTGAATTCGATGAAATAAATGATACTTGCTTATCTG
...
...
16 fold coverage
1. Collect sample
![Page 21: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/21.jpg)
Next Generation Sequencing Challenges
![Page 22: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/22.jpg)
Highlight the use of NGS technology
the problem,
choice of technology,
how the technology helped
![Page 23: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/23.jpg)
Genetic Basis for Ocular Health and Disease?
Refractive Error
Concomitant and Non-Concomitant Strabismus
Corneal Disorders
• Anterior Segment Dysgenesis
• Corneal Dystrophies
Glaucoma• PCG•JOAG•PDS/PG
•PXF•POAG•NTG•CCT
Lens
• Congenital Cataract
•Age related cataract
•Subluxation/Dislocation
Vitreous
•Stickler
•Wagner
•FEVR
Retinal Degeneration
• Retinal Dystrophy
•Macular Dystrophy
•AMD
Optic Nerve
Degeneration
• Optic Atrophy
•LHON
Phakomatosis
• NF1/2
•Tuberous Sclerosis
•VHL
![Page 24: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/24.jpg)
SLC4A11
100 KDa
R7
55
W, R
75
5Q
891 aa1
SLC4A11
K1
18
Tfs
X1
1
R1
25
C, R
12
5H
R1
58
Pfs
X3
A1
60
T
C2
18
Kfs
X4
9A
26
9V
C3
86
R
R6
05
X
P7
73
L
Q8
36
X
R8
69
CL8
73
P
A8
87
P
GC box
A1
35
A
R1
61
RS2
13
S
N5
53
N
V6
58
V
Congenital Hereditary Endothelial Dystrophy
20p13
![Page 25: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/25.jpg)
Mutations in sodium-borate cotransporter SLC4A11
cause recessive congenital hereditary endothelial
dystrophy (CHED2).
*Vithana EN, *Morgan P, *Sundaresan P, Ebenezer ND, Tan
DT, Mohamed D, Anand S, Khine KO, Venkataraman D,
Yong VH, Salto-Tellez M, Venkatraman A, Guo K, Hemadevi
B, Srinivasan M, Prajna V, Khine M, Casey JR, Inglehearn
CF, Aung T.
Nature Genetics. 2006 Jul;38(7):755-7.
* These authors contributed equally to this work
![Page 26: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/26.jpg)
Genetic loci linked to glaucoma
Chromosomal GenBankLocus location OMIM no. Gene accession no. Reference
____________________________________________________________________________________________________
GLC1A (JOAG1) 1q 21-31 137750 Myocilin NM 000261 Sheffield et al. 1993
GLC1B 2cen-q31 606689 - - Stoilova et al. 1996 GLC1C 3q 21-24 601682 - - Wirtz et al. 1997 GLC1D 8p 23 602429 - - Trifan et al. 1998 GLC1E 10p 15-14 602432 Optineurin NM 021980 Sarfarazi et al. 1998 GLC1F 7q 35-q36 603383 - - Wirtz et al. 1999 GLC1G 5q 22.1 609887 WDR36 NM 139281 Monemi et al. 2005 GLC1H 14q11-q13 611276 - - Suriyapperuma et al. 2007
GLC1I 15q11-13 609745 - - Allingham et al. 2005 GLC1J (JOAG2) 9q22 608695 - - Wiggs et al. 2004
GLC1K (JOAG3) 20p12 608696 - - Wiggs et al. 2004
GLC1L (JOAG4) 3p21-22 137750 - - Baird et al. 2005 GLC1M (JOAG5) 5q22.1-q32 610535 - - Pang et al. 2006 GLC1N (JOAG6) 15q22-q24 61274 - - Wang et al. 2006b
- 19q12 - - - Wiggs et al. 2000 - 17q25.1-17q25.3 - - - Wiggs et al. 2000 - 14q11.1-14q11.2 - - - Wiggs et al. 2000 - 14q21.1-q21.3 - - Wiggs et al. 2000 - 17p13 - - - Wiggs et al. 2000 - 10p12.33-p12.1 - - - Nemesure et al. 2003 - 2q33.1-q33.3 - - Nemesure et al. 2003 - 2p14 - - - Wiggs et al. 2000 - 2p15-16 - - Lin et al. 2008 - 1p 32 - - - Charlesworth et al. 2005
- 10q 22 - - - Charlesworth et al. 2005
![Page 27: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/27.jpg)
Genes reported to be associated with POAG• Gene symbol Gene name OMIM no. Chromosomal location Reference • AGTR2 Angiotensin II receptor, type 2 300034 Xq22-q23 Hashizume et al. 2005• APOE Apolipoprotein E 107741 19q13.2 Copin et al. 2002• IL1A Interluekin 1 alpha 147760 2q14 Wang et al. 2006a • EDNRA Endothelin receptor, type A 131243 4q31.2 Ishikawa et al. 2005 • GSTM1 Glutathione S-transferase, mu-1 138350 1p13.3 Juronen et al. 2000 • IGF2 Insulin-like growth factor II 147470 11p15.5 Tsai et al. 2003 • IL1B Interluekin 1 beta 147720 2q14 Lin et al. 2003b • MTHFR 5,10-methylenetetra-hydrofolate reductase 607093 1p36.3 Junemann et al. 2005 • NOS3 Nitric oxide synthase 3 163729 7q36 Tunny et al. 1998 • NPPA Natriuretic peptide precursor A 108780 1p36.2 Tunny et al. 1996 • OCLM Oculomedin 604301 1q31.1 Fujiwara et al. 2003 • OLFM2 Olfactomedin 2 - 19p13.2 Funayama et al. 2006 • OPA1 Optic atrophy 1 605290 3q28-q29 Aung et al. 2002 • TAP1 Transporter, ATP-binding cassette, major 1170260 6p21.3 Lin et al. 2004 • histocompatibility complex, • TNF Tumour necrosis factor 191160 6p21.3 Lin et al. 2003a • TP53 Tumour protein p53 191170 17p13.1 Lin et al. 2002 • OPTC Opticin 605127 1q32.1 Acharya et al. 2007 • CYP2D6 Cytochrome P450, Subfamily IID, Polypeptide 124030 22q13.1 Yang et al. 2009 • 6 • PON1 Paraoxonase 1 168820 7q21.3 Inagaki et al. 2006a • CDH-1 Cadherin 1 192090 16q22.1 Lin et al. 2006 • LMX1B Lim Homeobox Transcription Factor 1 602575 9q34.1 Park et al. 2009 • ANP Atrial natriuretic polypeptide 108780 1p36.2 Tunny et al. 1996 • P21 P21 116899 6p21.2 Tsai et al. 2004 • HSPA1A Heat shock 70 kDa protein 1A 140550 6p21.3 Tosaka et al. 2007 • TLR4 Toll-like receptor 4 603030 9q32-q33 Shibuya et al. 2008 • CYP46A1 Cytochrome P450, Family 46, Subfamily A, 604087 14q32.1 Fourgeux et al. 2009 • Polypeptide 1 • PAI-1 plasminogen activator inhibitor-1 173360 7q21.3-q22 Mossbock et al. 2008 • ADRB1 beta-adrenergic receptors 1 109630 10q24-q26 Inagaki et al. 2006b • ADRB2 beta-adrenergic receptors 2 109690 5q32-q34 Inagaki et al. 2006b
![Page 28: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/28.jpg)
Pathways involved in pathogenesis of POAG
![Page 29: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/29.jpg)
Pedigree of the recruited family
![Page 30: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/30.jpg)
![Page 31: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/31.jpg)
![Page 32: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/32.jpg)
Molecular Genetics of Globe
Anomalies in Indian Population
![Page 33: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/33.jpg)
BACKGROUND
![Page 34: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/34.jpg)
• Complex aetiology with chromosomal, monogenic and
environmental causes identified
• Diverse patterns of genetic inheritance and variable
severity due to genetic heterogeneity of ocular
malformations
• Of the large number of genes (> 65), SOX2, OTX2, RAX,
PAX6, CHX10, STRA6, GDF3 and GDF6 are important
candidate genes
MAC: ETIOLOGY
![Page 35: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/35.jpg)
A cluster of ano/micro has been reported from a
small area of Bihar in >45 babies in the year 2009-2010
MICROPHTHALMIA AND ANOPHTHALMIA
CLUSTER FROM BIHAR
![Page 36: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/36.jpg)
Anophthalmia and Microphthalmia
combined : 30 in 100,000 population
Microphthalmia: 11 % of blind children
Coloboma: 3.2-11.2 % of blind children
MAC: Prevalence
Madhya Pradesh 18.80 %
Tamilnadu 20.60 %
Karnataka 28.70 %
Andhrapradesh 18 %
North East 30.60 %
Delhi 27.40 %
Maharashtra 35.00 %
Uttar Pradesh 33 %
![Page 37: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/37.jpg)
To find out the spectrum of genetic variations in candidate
genes in patients with microphthalmia, anophthalmia and
coloboma (MAC) in Indian cohorts
PURPOSE
![Page 38: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/38.jpg)
STUDY SUBJECTS
MAC patients from South Indian cohort clinically
diagnosed at Aravind eye hospital , Madurai and
patients from Bihar state were recruited for the study
Total number of clinically well diagnosed MAC cases
=120 (25 from Bihar state and 95 from South India)
Total number of family members
=200 (including both Bihar and South Indian cohorts)
Total number of healthy control = 100
METHODOLOGY
![Page 39: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/39.jpg)
METHODOLOGY
1. TARGETED RE-SEQUENCING
9 genes screened by targeted re-sequencing in 56 samples
Steps in targeted re-sequencing:
Capture specific regions of interest PCR amplification
Template preparation
Sequencing and imaging By Illumina MiSeq
Data analysis
2. SANGER SEQUENCING
5 genes (SOX2, OTX2, PAX6, RAX & ABCB6 ) were
screened by Sanger sequencing in 64 MAC samples
![Page 40: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/40.jpg)
Custom Target Enrichment and multiplex sequencing
of 9 genes (SOX2, OTX2, CRYBA4, VSX2, FOXE3,
GDF3, BMP4, STRA6 and GDF6) for 56 DNA samples
Custom amplicon seq. on Illumina MiSeq platform
2 μg of purified genomic DNA
Total number of primer probes designed to amplify
targeted regions (9 genes) = 181(100% coverage)
1. TARGETED RE-SEQUENCING
![Page 41: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/41.jpg)
Library Preparation:
Amplicon Seq. on MiSeq
Bar-coded samples
Paired end Seq.
![Page 42: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/42.jpg)
Analysis Pipeline
Quality Check &
Filter
Variant Annotation
Alignment
Variant Calling
Quality Check and Filter
Average Q30 score was used as a
cutoff to remove low quality bases
Alignment
The filtered reads were aligned to
the reference genome
(GRCh37/hg19) using BWA
program
![Page 43: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/43.jpg)
Variant Calling
Samtools mpileup program
The variants with quality score >= 50 and read depth of at
least 5 were taken further for annotation
Annotation
The variants found in the sample were annotated using in-
house pipeline (VariMAT)
The variants found were compared with various databases
including OncoMD (www.scigenom.com), OMIM, ClinVar
(http://www.ncbi.nlm.nih.gov/clinvar) and SNPedia for
identifying clinically relevant variants
![Page 44: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/44.jpg)
![Page 45: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/45.jpg)
![Page 46: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/46.jpg)
![Page 47: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/47.jpg)
Gene
# of
sample change
Amino
Acid
Change
Variant
Class Phenotype
VSX2 1 G>A p.G289D Missense
RE- micro with cyst, LE-
normal
STRA6 1 A>C p.L645R Missense RE- clinical anop, LE- micro
STRA6 2 A>T p.L152M Missense
1.Micro & ON coloboma 2.
Micro & CR coloboma
STRA6 1 T>C p.Y374C
Missense
BE- Microphthalmos
CRYBA4 2 T>A p.F25L Missense BE- microphthalmos
GDF6 1 C>T p.A242T Missense Clinical anophthalmos
OTX2 1 Ins C
Frame
shift Insertion BE- anophthalmos
Targeted re-sequencing: List of variations
![Page 48: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/48.jpg)
Identification of Mutations in SOX2, OTX2, RAX, PAX6
& ABCB6
2. SANGER SEQUENCING
DNA isolation Direct sequencing ClustalW
64 MAC samples (20 from Bihar and 44from South India)were screened for mutations in SOX2, OTX2, RAX, PAX6 andABCB6 genes
PCR Blast Functional analysis of ABCB6 mutation
![Page 49: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/49.jpg)
S.N. Gene Location Type of variation Phenotype1 RAX Exon-2 Novel Homozygous subs
p. Arg 179 TrpBilateral
anophthalmos2 OTX2 Exon-3 Novel Compound
heterozygous mutation
p. Gln104 X, p. Gln106 His
RE :Micro. with irregular pupil
3 OTX2 Exon-3 Novel heterozygous frame shift Mutation (deletion)
p. Thr186 Fs
RE: anop., LE: microphthalmos
4ABCB6 Exon1 Novel Heterozygous
Mutation (subs)p. Ala 57 Thr
coloboma
5PAX6 Intron 5
c.141+4heterozygous substitution
Splicing errorLens coloboma &
aniridia
Sanger sequencing: List of variations
![Page 50: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/50.jpg)
Gene Mutation PolyPhen SIFT
RAX p.R179W PROBABLY
DAMAGING (1.00)
AFFECT PROTEIN
FUNCTION (0.00)
OTX2 p.Q106H PROBABLY
DAMAGING (0.970)
AFFECT PROTEIN
FUNCTION (0.01)
ABCB6 p.A57T BENIGN (0.001) AFFECT PROTEIN
FUNCTION (0.00)
VSX2 p.G289D BENIGN (0.040) TOLERATED (0.59)
STRA6 p.L645R PROBABLY
DAMAGING (0.999)
AFFECT PROTEIN
FUNCTION (0.00)
STRA6 p.Y374C PROBABLY DAMAGING
(0.999)
AFFECT PROTEIN
FUNCTION (0.00)
GDF6 p.A242T BENIGN (0.047) TOLERATED (0.94)
PolyPhen and SIFT score for missense mutations
![Page 51: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/51.jpg)
Novel p. Ala57Thr Mutation in ABCB6
![Page 52: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/52.jpg)
Morpholino Knockdown of abcb6 in
Zebrafish and Rescue Studies
The abcb6 transcripts are expressed in the developing
CNS tissue, including that of the eyes, suggesting a
function for abcb6 in eye development
To test the hypothesis that disruption of the normal
function of ABCB6 can cause coloboma, zebrafish model
was developed to study eye development
![Page 53: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/53.jpg)
MO knockdown by using two specific antisense
oligonucleotides targeting..
abcb6 ATG-inhibition (5’-CACAGAAACTCTTCATCTCCACCAT-3’)(abcb6MO1),
abcb6 splice-blocking (5’-TGCTACCAGCAAGCGTACCTGTTGC-3’) (abcb6MO2)
and standard control (5’-CCTCTTACCTCAGTTACAATTTATA-3’)
morpholinos injected into the egg yolk of 1–2-cell-stage embryos
For rescue studies, MOs were coinjected into 1–2-cell-
stage zygotes with either wild type (WT) or mutant ABCB6
mRNA
![Page 54: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/54.jpg)
Morpholino Knockdown of abcb6 Rescue Studies
![Page 55: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/55.jpg)
Graph depicting the proportions of embryos with coloboma associated with the
injection of either abcb6MO1 or abcb6MO2 and the proportions rescued by
coinjection of MOs with WT and mutant ABCB6 mRNA
![Page 56: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/56.jpg)
![Page 57: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/57.jpg)
CONCLUSIONS
All pathogenic mutations identified in South Indian population
No mutations identified in Bihar patient (strongly suggests
the involvement of teratogens in Bihar A/M cluster)
This study identified 12 mutations (9 novel) in 12 genes as; 3
in OTX2, 3 in STRA6, 1 in RAX, 1 in PAX6, 1 in VSX2, 1 in
ABCB6, 1 in CRYBA4 and 1 in GDF6.
Seven Mutations were identified by NGS technique whereas
five mutations by Sanger sequencing
Mutations in SOX2 are rare in Indian population (as no
mutations were identified in 120 MAC cases)
![Page 58: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/58.jpg)
First report of association of ABCB6 gene with globe anomalies
The phenotype caused by disruption of ABCB6 can be
explained by haploinsufficiency
- Mutation identified in ABCB6 is heterozygous
- Decreased mRNA expression caused by morpholino
knockdown in zebrafish replicates the coloboma
phenotype
- Knockdown phenotype can be corrected with the
coinjection of MOs with WT mRNA, but not with
mutant ABCB6 mRNA
CONCLUSIONS
![Page 59: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/59.jpg)
Establishment of Human Retinal
Mitoscriptome Gene Expression Signature
for Diabetic Retinopathy and Diabetic
Using Human Cadaver Eye
![Page 60: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/60.jpg)
* A circular molecule
* Genome size: ~16569bp
* Maternally inherited
* Genes:
-2 rRNAs
-22 tRNAs
-13 proteins
* Only non-coding region is d-loop
* Other proteins encoded by nuclear DNA!
mtDNA: Genome & Organization
![Page 61: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/61.jpg)
Complex I
Complex II
Complex IIIComplex IV
Complex V
Apoptosis
Lipid Metabolism
Nucleotide Metabolism
Amino Acid Metabolism
Carbohydrate Metabolism
Electron Transport Chain
RNA Polymerase
Ribosome
tRNAs
Nucleus
Mitochondria
CELL
Variations
? ?
http://blog.openhelix.com/wp-content/uploads/2008/11/nhgri_cnv_cyndy_post2.jpghttp://spittoon.23andme.com/wp-content/uploads/2009/09/prostatemen.jpg
mtDNA variations: Structural and Functional complexity
Genotype-Phenotype correlation
![Page 62: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/62.jpg)
Mitochondria & COMPONENTS
22 tRNAs
2 rRNAs
13 proteins
NOT SUFFICIENT FOR OPTIMAL FUNCTIONS
![Page 63: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/63.jpg)
HAS TO BE IMPORTEDAS PER REQUIREMENT
>1500 proteins
5S rRNA
tRNAs
ncRNA.....smallRNAs??
![Page 64: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/64.jpg)
Objectives
To under the role of Mitochondria’s involvement in development of Diabetic Retinopathy
• To obtain the retinal mitoscriptome gene expression
signature using “Agilent - microarray” for diabetic
and diabetic retinopathy human cadaver eye
![Page 65: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/65.jpg)
Methodology:
I. Clinical Characterization -Cadaver Eye Dr. R. Kim – AEH, Madurai
Dr. S.R.Karthick – AEH, Madurai
Stereomicroscope examination
Digitised images
III. Custom based Microarray
AMADID number: G2509F_045815
RNA extraction
cRNA Conversion
Performed Microarray (Agilent – 8*15K platform ) – Around 1500 mitoscriptome gene
probes (GSE53257)
III. Microarray data - Validation AMRF, Madurai
Taqman Relative quantification - Real time PCR
Genotypic Pvt Limited, Bengaluru, India
![Page 66: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/66.jpg)
Experimental Design
In present study, we have compared three biological conditions to obtain
human mitoscriptome gene expression signature for DR and diabetes
Each group includes 4 biological replicates with additional technical
replicate to validate the microarray experiment
Comparison was carried out between retinas of:
DR (n=6) and age matched normal control (n=5) groups
Diabetic (n=5) and age matched normal control (n=5) groups
DR (n=6) and diabetic (n=5) groups
![Page 67: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/67.jpg)
Hierarchical cluster shows differentially expressed genes among postmortem DR, Diabetic and age matched normal control group retinas
Notes: The red color indicates up- regulated genes and the greencolor indicates down regulated genes
![Page 68: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/68.jpg)
Results-Gene expression analysisDifferences in human mitoscriptome gene expression between DR and age
matched normal control groups
• Among 1100 genes 59 genes were differentially expressed in DR cadaver retinas as compared to normal control group retinas
• In those 59 genes, 8 (≥0.6) were up regulated and 51 (≤0.6) were down regulated
Differences in human mitoscriptome gene expression between diabetic and age matched normal control groups
• Among 1100 genes 39 genes were differentially expressed in diabetic cadaver retinas as compared to normal control retina
• In those 39 genes, 8 were up regulated and 31 were down regulated
Differences in human mitoscriptome gene expression between DR and diabetic groups
• Among 1100 genes 39 genes were differentially expressed in DR cadaver retinas as compared to diabetic control retina
• In those 39 genes, 3 were up regulated and 36 were down regulated
![Page 69: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/69.jpg)
Expected Outcome
• Understand the role of Mitochondria’s involvement in
development of DR
• Identification of valuable biomarkers in health and disease
condition
• Developing new diagnostic methods and therapeutic
approaches to their prevention and treatment
![Page 70: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/70.jpg)
• Performing molecular diagnosis for
• Aniridia ,
• Oculocutanous & ocular albinism and
• LHON patients
![Page 71: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/71.jpg)
• Understanding the outcome of the project
• Pooling the samples
• Reseqencing
• Positive control
• validation
• Huge data
• Pathway analysis
• Sample size and cost
![Page 72: Recent findings from NGS studies in eye diseases · 2014. 9. 19. · Fush’sDystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous](https://reader036.vdocument.in/reader036/viewer/2022071417/6114b8694ab8d12f7c445f63/html5/thumbnails/72.jpg)
Thank you