![Page 1: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/1.jpg)
SFSU Center for Computing for Life Sciences - CCLS
Dragutin Petkovic1, Chris Smith2,3, Mike Wong1,3
1 - SFSU Department of Computer Science
2- SFSU Department of Biology
3 - SFSU Center for Computing for Life Sciences
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.QuickTime™ and a
TIFF (Uncompressed) decompressorare needed to see this picture.
![Page 2: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/2.jpg)
Outline
• About Center for Computing for Life Sciences (CCLS) at SFSU – cs.sfsu.edu/ccls/index.html
• What is computing for life sciences?
• CCLS Dell Cluster Computer and its usage
• Chris Smith - Turning Processor Cycles into Research-Based Teaching
![Page 3: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/3.jpg)
cs.sfsu.edu/ccls/index.html
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
![Page 4: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/4.jpg)
Mission• CCLS addresses the emerging trend of integration of life sciences and
computational and mathematical sciences. It involves faculty, researchers, and students from the SFSU departments of Biology, Biochemistry, Computer Science, Mathematics, and Physics and other SFSU departments.
• The broad research program of the center emphasizes investigations in topics varying from Bioinformatics and Computational Drug Discovery to complex data visualization and development of new paradigms for data modeling, user interfaces and web-engineering in contexts involving life sciences.
• The CCLS provides an environment for faculty to cooperate, for students to work on multidisciplinary projects including those involving culmination degrees and for collaboration with industrial and academic partners. The center also hosts a number of external advisors and collaborators.
ccls.lab.sfsu.edu
![Page 5: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/5.jpg)
5
CCLS: An Interdisciplinary Collaboration Space
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
![Page 6: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/6.jpg)
Areas addressed by CCLS projects – they are broad by design
Bioinformatics but also…
• Use of Machine Learning or analysis and classifications of genotypes• Data management for biology and drug development• Data visualization• Mathematical modeling of genetic structures• Advanced WWW applications and user interfaces• Serious games in health education• Sensor networks for biological and environmental applications• Data mining of biological data• High performance clusters and SW tools for computing for life sciences
……whatever is next
![Page 7: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/7.jpg)
Range of Activities
• Broad, but focused on fostering research, not direct teaching
– Projects and theses– Research and publications– External grants– Collaboration with industry and academia– Hosting seminar visitors– Helping faculty with grants and travel– IT and high performance computing support– Also incubators for high tech
![Page 8: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/8.jpg)
CCLS Accomplishments• 20+ faculty
– COSE (CS. Math, Biology, Chemistry and Biochemistry)– Health and Human Services, Industrial design, Philosophy
• Over 19 MS Theses in CCLS area since 2004
• Over 28 refereed publications in CCLS area since 2003. – One best paper award & one second best paper award– Several top awards at COSE science fairs
• NSF Career Grant to Prof. R. Singh for proposed research in CCLS area– Data management and search for chemical data
• Funding:– External sources - NSF, CSUPERB, Microsoft, Sun/Agilent, NIH– Support for CCLS investigators - Three rounds of mini grant and travel grants funded by CCLS:
• 30+ faculty and students funded (about $ 150 K in three years)
• External Collaborators: UCSF, UC Davis, SUN/Agilent, Microsoft, Washington University Genome Center, Lawrence Berkeley National Lab
• Core Computing Resources– Dell High performance cluster computer – Teaching Cluster & shared application servers– Climate and power control for independent research groups
![Page 9: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/9.jpg)
CCLS Computing Resources• A cluster is
– Multiple computers offer high compute power
– Work closely together such that they can be viewed as a single computer.
– Network/WWW accessible– Small footprint
• Applications include– Predicting molecular structure (e.g.
protein folding)– Gene sequence searches (e.g.
BLAST searches)– Genetic similarity comparison
between species (e.g. PAUP phylogentics analysis).
– Predicting RNA secondary structures
CCLS DELL PowerEdge 1955 Quad-Processor Compute Nodes
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
Mike Wong M.S.Researcher Programmer
![Page 10: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/10.jpg)
CCLS ClusterComputing Program
• Purpose:– To support computational biology education and
computationally expensive biology research by developing and teaching skills and procuring equipment necessary for high-performance cluster computing (HPCC)
• CCLS HPCC DELL Technical Specifications:– 40 CPUs Intel Xeon 2.0 GHz– 40 GB RAM– 4.0 Terabytes storage– Gigabit Ethernet– Dell PowerEdge and Apple XServe technology
• CCLS Instructional Cluster (not shown)– Provides an educational environment where biology
and computer science students can get hands-on experience with clusters
– Isolated from HPCC research cluster
![Page 11: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/11.jpg)
CCLS HPCCEarly Contributions and Results
• CCLS HPCC serves 5 research labs at SFSU and is expanding
– Enables Smith Lab to perform thousands of BLAST searches per hour
– Enables Spicer Lab to find a consensus of hundreds of maximum-likelihood phylogeny trees within a day
– Enables Stillman lab to perform protein function prediction on EST datasets
• CCLS HPC cluster and instructional cluster provide a rich environment for biology research and education
CCLS Usage Report (via Ganglia): Smith Lab experiment designed to find genes orthologs responsible for observed behaviors in insects
![Page 12: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/12.jpg)
Summary• CS and math are becoming a critical tool for future advances in
biotechnology and is exciting area for research and teaching• CSU must address this area adequately• CCLS at SFSU is one example of a working model of
Biology/Chemistry/CS/Math/Life Sciences collaboration• CCLS advocates addressing this area very broadly, NOT only
as bioinformatics• Critical need for infrastructure support: technical support, admin,
people, space, networking, SW, HW (NOT ONLY HW)
![Page 13: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/13.jpg)
![Page 14: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/14.jpg)
Turning Processor Cycles into Research-Based Teaching
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
• Annotation Background
• Genomics Education Partnership
• CCLS Genome Annotation Pipeline
• Biol638/738: Student Genome Annotation
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
© SmithLab 2007
![Page 15: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/15.jpg)
Given Some Raw Sequence? G
GTATCTTATTCGCCATCGAAGCGGTCACACTGGGTGCCGCCGCCAACTTCACTCTTTCCGTTCTGTGAGCGAAAACCGAAAAGTCTGTGCTTTGGTAAGTGTTGCTAAAAGTTCGGAATAATGTTGCATCCCGAGCATTTTCGGGTACATAACTGTTCCACGGCGGTGGTCCAGCAAAGACTAATCGTTATCACGCCTTTCGCAGTTCTTAAATTCACCCGACGAGTCCCTAATACACAATTAAAATGGTTAGGGAGAACAAGGCAGCGTGGAAGGCTCAGTACTTCATCAAGGTTGTGGTAAGTATAGAACCTTATAGAATTCGCTCACTAGCTGGCGCCTGGCTTATGCTGTTAACTGATCCCTCCTCCAGGAACTGTTCGATGAGTTCCCAAAGTGCTTCATCGTGGGCGCCGACAACGTGGGCTCCAAGCAGATGCAGAACATCCGTACCAGCCTGCGTGGACTGGCCGTCGTGCTTATGGGCAAGAACACCATGATGCGCAAGGCCATCCGCGGTCATCTGGAGAACAACCCGCAGCTGGAGAAGCTGCTACCCCACATCAAGGGCAACGTGGGATTCGTGTTCACCAAGGGCGATCTCGCCGAGGTGCGCGACAAGCTGCTGGAGTCCAAGGTGCGCGCCCCCGCCCGTCCCGGCGCTATTGCCCCTCTGCACGTCATCATCCCGGCGCAGAACACCGGCTTGGGACCCGAGAAGACCAGTTTCTTCCAGGCCCTGTCCATCCCGACCAAAATTTCCAAGGGAACAATTGAAATCATCAACGATGTGCCCATCCTGAAGCCTGGCGACAAGGTCGGCGCCTCCGAGGCGACACTGCTCAACATGTTGAACATCTCGCCCTTCTCGTACGGTCTGATTGTCAACCAGGTCTACGACTCCGGCTCGATCTTTTCGCCGGAGATCCTGGACATCAAGCCCGAGGATCTGCGCGCCAAGTTCCAACAGGGAGTGGCCAACTTGGCCGCCGTTTGTTTGTCCGTGGGCTACCCCACCATCGCCTCGGCCCCGCACAGCATTGCCAACGGATTCAAGAATCTGCTGGCCATTGCTGCCACCACCGAGGTGGAGTTCAAGGAGGCGACCACCATCAAGGAGTACATCAAGGACCCCAGCAAGTTCGCCGCAGCTGCTTCGGCTTCGGCTGCCCCCGCGGCCGGCGGAGCTACCGAGAAGAAGGAGGAGGCCAAGAAGCCCGAGTCCGAATCAGAGGAGGAGGACGATGATATGGGTTTCGGTCTGTTCGACTAAGCTGGATCCCGATTGCAGAATGCCCTCTGCGGCGCCCGCGAACCATCGCTTCCGCTTTCGGCGTTTACCCACTAAGACCCTTTGTTATGTT
![Page 16: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/16.jpg)
What Does The Sequence Encode? G
GTATCTTATTCGCCATCGAAGCGGTCACACTGGGTGCCGCCGCCAACTTCACTCTTTCCGTTCTGTGAGCGAAAACCGAAAAGTCTGTGCTTTGGTAAGTGTTGCTAAAAGTTCGGAATAATGTTGCATCCCGAGCATTTTCGGGTACATAACTGTTCCACGGCGGTGGTCCAGCAAAGACTAATCGTTATCACGCCTTTCGCAGTTCTTAAATTCACCCGACGAGTCCCTAATACACAATTAAAATGGTTAGGGAGAACAAGGCAGCGTGGAAGGCTCAGTACTTCATCAAGGTTGTGGTAAGTATAGAACCTTATAGAATTCGCTCACTAGCTGGCGCCTGGCTTATGCTGTTAACTGATCCCTCCTCCAGGAACTGTTCGATGAGTTCCCAAAGTGCTTCATCGTGGGCGCCGACAACGTGGGCTCCAAGCAGATGCAGAACATCCGTACCAGCCTGCGTGGACTGGCCGTCGTGCTTATGGGCAAGAACACCATGATGCGCAAGGCCATCCGCGGTCATCTGGAGAACAACCCGCAGCTGGAGAAGCTGCTACCCCACATCAAGGGCAACGTGGGATTCGTGTTCACCAAGGGCGATCTCGCCGAGGTGCGCGACAAGCTGCTGGAGTCCAAGGTGCGCGCCCCCGCCCGTCCCGGCGCTATTGCCCCTCTGCACGTCATCATCCCGGCGCAGAACACCGGCTTGGGACCCGAGAAGACCAGTTTCTTCCAGGCCCTGTCCATCCCGACCAAAATTTCCAAGGGAACAATTGAAATCATCAACGATGTGCCCATCCTGAAGCCTGGCGACAAGGTCGGCGCCTCCGAGGCGACACTGCTCAACATGTTGAACATCTCGCCCTTCTCGTACGGTCTGATTGTCAACCAGGTCTACGACTCCGGCTCGATCTTTTCGCCGGAGATCCTGGACATCAAGCCCGAGGATCTGCGCGCCAAGTTCCAACAGGGAGTGGCCAACTTGGCCGCCGTTTGTTTGTCCGTGGGCTACCCCACCATCGCCTCGGCCCCGCACAGCATTGCCAACGGATTCAAGAATCTGCTGGCCATTGCTGCCACCACCGAGGTGGAGTTCAAGGAGGCGACCACCATCAAGGAGTACATCAAGGACCCCAGCAAGTTCGCCGCAGCTGCTTCGGCTTCGGCTGCCCCCGCGGCCGGCGGAGCTACCGAGAAGAAGGAGGAGGCCAAGAAGCCCGAGTCCGAATCAGAGGAGGAGGACGATGATATGGGTTTCGGTCTGTTCGACTAAGCTGGATCCCGATTGCAGAATGCCCTCTGCGGCGCCCGCGAACCATCGCTTCCGCTTTCGGCGTTTACCCACTAAGACCCTTTGTTATGTT
5’ UTR START CODING EXON STOP 3’UTR
![Page 17: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/17.jpg)
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Genome Annotation
The Problem: Too many genomes, not many reliably annotated. Bad gene models make it harder to clone genes and use genomic data in the lab. Reliance on automated annotations means that many analyses are ‘quick & dirty’
www.genomesonline.org/Liolios et al. NAR 2006 (DOI:10.1093/NARGKJ145)© SmithLab 2007
![Page 18: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/18.jpg)
The World is Filled with Non-Model Organisms
• Only a few model organisms annotated, only 5 done ‘well’• Most new genomes are automatically annotated, if at all• Human curation is poorly funded or not funded• Little infrastructure exists for normal people to do
bioinformatics analyses in their own organisms
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
© SmithLab 2007
![Page 19: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/19.jpg)
Typical Automated Genome Annotation Pipeline
1-2 Gene Predictions Programs
ESTs if you are lucky
Protein coding gene models that are largely incorrect
Rarely other features (miRNA, ncRNA, etc)
• Comparative genomics difficult without high-quality genes
• General frustration by user community to access data, understand it, or manipulate it in novel ways
© SmithLab 2007
![Page 20: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/20.jpg)
Automated Annotation is Better Than Some Methods*…
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
theredsrocket.blogspot.com/2007/04/finals.html
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
* Methods have not been actually tested
• Web tools & common formats enable distributed annotation• Easier technology puts annotation in grasp of students
© SmithLab 2007
![Page 21: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/21.jpg)
• Student Driven Community Genome Annotation• Collaborators (34 US Universities)
• Smith Lab @ SFSU• Jim Youngblom @ CSU Stanislaus• Anya Goodman @ California Poly • Catherine Coyle-Thompson @ CSU Northridge
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
• Use real research data as a teaching tool
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
© SmithLab 2007
![Page 22: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/22.jpg)
A Student Pathway to Publication
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Raw Sequence Project Coordination
Course Integration
Computational Analysis
Student AnnotatorsBiol638 / Biol738Public Archiving
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
© SmithLab 2007
![Page 23: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/23.jpg)
Students perform analysis and annotation in class
• Biol638/Biol738– Paired Undergraduate/Graduate Genome
Annotation Workshop– 1 Semester, 4 units– Fall 2007 20 enrolled, 14 finished– Taught in SFSU SEGA Teaching Lab
• 20 iMac G4’s• Students can also use their own computer
• Each student annotates 50kb of sequence– Finds repeat, genes, protein functions, promoters– Learn basic UNIX, command-line programs
• Pre- and Post-Course Assessment Surveys
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
All subjects & ages under
one roof
© SmithLab 2007
![Page 24: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/24.jpg)
CCLS Genome Annotation Pipeline
Genomic sequence
Repeat Identification Transposable Elements Satellite Sequence Tandem Repeats
Alignment of EST/cDNA
Complete cDNA Partial EST GenBank mRNA
Alignment of Protein Data
SwissProt Known Fly Peptides GenBank Peptides
Programs: RepeatMasker, RepeatRunner TRF4, PILER-DF
Programs: SIM4,BLASTN
ncRNA Predictions tRNA miRNA snoRNAs
Programs: BLASTX
Gene Orthology Data
CGL Orthologs InParanoid Orthologs 1
OrthoMCL
Programs: M-Fold, CARNAC, INFERNAL, tRNA-scan, BLASTN
Programs: SIM4, TBLASTN, BLASTX
RAW results CustomizedCCLS Parsers
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
© SmithLab 2007
![Page 25: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/25.jpg)
Students Annotate Genes in Multiple Species
Release 5.1Annotation
Smith et. al. Science 316, 1586 (2007)© SmithLab 2007
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
![Page 26: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/26.jpg)
Accurate Genome Annotations are the Basis for Comparative Genomics
Splice Variant B
Protein-coding geneSplice Variant A
start stop 3’ UTR5’ UTR
• Any feature region of interest that can be associated to a sequence
tRNA
microRNA
rRNA
Non-Protein-coding RNA
pseudogene
DNA Transposon Retrotransposon (AAGAGAG)n
Satellite Arrays
• Annotation types can match interests of your own researchers• Comparing annotations between species is highly informative© SmithLab 2007
![Page 27: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/27.jpg)
Multiple Fly Genomes Give Student Access to Cutting Edge Research Data• Currently 12 Drosophlid
genomes
• Several more insect genomes
• Possible to do in-depth comparative genomic analyses– Conserved promoters– Rates of gene evolution– New/Lost genes– Much much more…
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
229 Annotation authors including C.D. Smith Nature 2007 450 (8),25-40.© SmithLab 2007
![Page 28: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/28.jpg)
Comparative Genomic Analysis
From Biol738 Final Report of Jennifer PlacekBad D. mojavensis annotation!
D. erecta D. melanogaster
© SmithLab 2007
![Page 29: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/29.jpg)
RNA Structure Motifs Conserved Across Species Are Candidates for Further Study
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
From Biol638 Report by Lucas Hanscom Spring 2007© SmithLab 2007
![Page 30: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/30.jpg)
CCLS Injects Computing in Biology Courses
• Standardized core facilities that are actively maintained
• Advanced software installation and support
• Custom software development for individual researchers
• Access to faculty and students from other disciplines
• Comfortable collaborative meeting space
• Engaged staff who meets the needs of researchers
![Page 31: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/31.jpg)
Conclusions
1) I write hacky error ridden code2) CCLS Mike Wong fixes my code
Adapted to clusterError handlingScalabilityNew analyses & features
Pre-CCLS Code screenshot Post-CCLS Code screenshot
CCLS People Make the Difference
#!/bin/csh set query = /home/cdsmith/resultscd $queryforeach file (*fst) current directory blastx Pfam-A.fasta $file > $query.resultsend
#!/share/apps/bin/perl -w
use Datastore::MD5;use File::Path qw( mkpath );use Statistics::Descriptive;use Proc::Daemon;Proc::Daemon::Init; # This script will continue running after you log out
# ===== INITIALIZE VARIABLES# It's important to use absolute paths; Proc::Daemon::Init requires itour $prefix = "/home/mikewong/research/stillmanlab"; # CHANGE THIS VARIABLEour $path = { results => "$prefix/JGI_Project/results", queries => "$prefix/JGI_Project/queries",};
my $job_name = 'anu_blast';my $species = '/share/apps/data/blastdb/GenBank_v159_aa.fasta';my $datastore = new Datastore::MD5( root => $path->{ results }, depth => 2 );mkdir $path->{ results } unless -e $path->{ results };
# ===== READ THE QUERY DIRECTORY FOR FST FILESopendir DIR, $path->{ queries };my @files = sort grep { /\.fst$/ } readdir DIR;closedir DIR;my $job_processing_times = new Statistics::Descriptive::Full();open LOG, ">>$prefix/JGI_Project/log";# ===== GENERATE THE COMMAND FOR EACH FILE/SPECIES COMBINATIONforeach my $file (@files) { my $results_path = $datastore->id_to_dir( $file ); mkpath $results_path unless -e $results_path; my $db = $species; my $results = "$results_path/$file.blastx"; my $errors = "$results_path/$file.err"; my $command = "bsub -J $job_name -e $errors blastx $db $path->{ queries }/$file -o $results " . "topcomboN=1 hspsepsmax=100000 wordmask=seg+xnu -B1 -V1 -E0.00001 W=5 T=25 kap"; # ===== SUBMIT THE COMMAND UNLESS THE RESULTS FILE EXISTS unless( -e $results ) { `$command`; my $delay = int( $job_processing_times->median()); sleep( $delay ); $delay = cluster_throttle_control( $job_name, $delay ); print LOG scalar( localtime() ) . " Analyzing protein '$file' with delay $delay s-- $command\n"; $job_processing_times->add_data( $delay ); }}close LOG;#========================================================sub cluster_throttle_control { my $job_name = shift; my $delay = shift; my $jobs = int( `bjobs | grep $job_name | wc -l` ); my $wait = 1; while( $jobs > 100 ) { $delay += $wait; sleep( $wait ); if( $delay > 20 ) { $wait = 5; } elsif( $delay > 60 ) { $wait = 15; } elsif( $delay > 120 ) { $wait = 30; } elsif( $delay > 300 ) { $wait = 60; } $jobs = int( `bjobs | grep $job_name | wc -l` ); } return $delay;}
© SmithLab 2007
![Page 32: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/32.jpg)
Acknowledgements
• Bioinformatics & Genome Annotation Class Fall 2007– Tobias Sayre (Graduate Assistant)
• CCLS Pipeline - Mike Wong• SFSU COSE Hardware Support - Alan Der• SFSU COSE Network Support - Tina Easter
Ari A. Ramsey M. Amy S.
Joseph B. Vy N. Elinor V.
Eugenel E. Jennifer P. Tyler W.
Henry H. Bhamini P. Mike W.
Jay K. Marvin S. Lucas H. (S07)
© Smithlab 2007
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
![Page 33: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/33.jpg)
fin
![Page 34: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/34.jpg)
Using the Semantic Web to Link Genes and Behaviors
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
• Took 200 known behavior genes from flies• Used CCLS cluster to identify orthologs in ants and bees• Designed primers to find in new ant species• Created networks of genes linked to behaviors
© SmithLab 2007
![Page 35: SFSU Center for Computing for Life Sciences - CCLS Dragutin Petkovic 1, Chris Smith 2,3, Mike Wong 1,3 1 - SFSU Department of Computer Science 2- SFSU](https://reader035.vdocument.in/reader035/viewer/2022062518/56649e165503460f94b0058d/html5/thumbnails/35.jpg)
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
1-Student, 1-Gene Independent Project• Romeo-Smith HIV Project
– HIV is known to suppress host immune system genes
– HIV Tar RNA secondary structure may act to inhibit through RNAi
• Screen all human genes & genome for novel Tar targets
– Human genes may also adopt Tar-like shapes
• Use CCLS cluster + RNA folding tools to fold all 30,000 human genes
www.mcld.co.uk© SmithLab 2007