![Page 1: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/1.jpg)
Page 1
Supplementary Note: Detailed information
Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed to spring
growth habit and environmental adaptation in cultivated barley
Jordi Comadran1*
, Benjamin Kilian2*
, Joanne Russell1, Luke Ramsay
1, Nils Stein
2, Martin
Ganal3, Paul Shaw
1, Micha Bayer
1, William Thomas
1, David Marshall
1, Pete Hedley
1,
Alessandro Tondelli4, Nicola Pecchioni
5, Enrico Francia
5, Viktor Korzun
6, Alexander
Walther7and Robbie Waugh
1**
The Supplementary information has been arranged into the following sections.
1. Supplementary note ……………………………………………………………...(page 3)
1.1.Development of the 9K iSelect platform ……………………………………(page 3)
1.2.Determination of marker order by linkage mapping Morex x Barke derived
RILs……………………………………………………………………………(page 6)
1.3.Divergent selection and known loci............................................................... (page 7)
1.4.QTL mapping of flowering time in the Nure x Tremois (NT) population...(page 8)
1.5.Expression analysis of HvCEN in Nure and Tremois................................. (page 10)
1.6.Diversity analysis........................................................................................... (page 11)
2. Supplementary Figures ...................................................................................... (page 15)
Supplementary Figure 1: Multi-environment QTL scan of the time to flowering.
Supplementary Figure 2: Expression of barley HvCEN and VRN-H1 genes (HvBM5A).
Supplementary Figure 3: MJ network derived from resequenced DNA haplotypes and
conservation of synteny searches in sequenced model grass genomes among Triticeae
species.
Supplementary Figure 4: Pleiotropic effects of MAT-C mutant alleles on (a) height (in
millimetres) and (b) grains per ear.
Supplementary Figure 5: GIS-based topographic maps of Ala-135 and Pro-135
containing haplotypes.
3. Supplementary Tables......................................................................................... (page 20)
Supplementary Table 1. Read numbers and read lengths for all samples used.
Supplementary Table 2. GigaBayes parameter values used in the primary SNP
detection run.
Supplementary Table 3. Breakdown of failure categories.
Supplementary Table 4. Numbers of SNPs during the incremental filtering procedure.
Supplementary Table 5. Validation rates for the Illumina read mappings.
Supplementary Table 6: Barley 9K iSelect marker platform (Separate Excel File).
Supplementary Table 7: Germplasm used for Divergent selection.
![Page 2: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/2.jpg)
Page 2
Supplementary Table 8 Regions under strong divergent selection.
Supplementary Table 9 Analyses of variance for Days to Heading (DtH), Grain yield
(Yield) and Thousand grain weight (Tgw) traits
Supplementary Table 10: Characterisation of putative mat-c mutants
Supplementary Table 11: Geo-referenced wild, landrace and cultivated lines (Separate
Excel File)
Supplementary Table 12: Haplotypes observed in germplasm surveyed......(page X)
Supplementary Table 13 Nucleic state at alignment position 531 (P135A: Pro-135/Ala-
135) for Triticeae species ......(page X)
![Page 3: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/3.jpg)
Page 3
1. Supplementary note:
1.1. Development of the 9K iSelect platform
Barley material and RNA extraction
Seeds were germinated from each of 10 barley varieties (Barke, Betzes, Bowman, Derkado,
Intro, Morex, Optic, Quench, Sergeant and Tocada) on filter paper moistened with sterile
water in petri dishes. Following 4 days incubation in the dark at 20oC, developing radicle (c.
10-20 mm) and embryo tissues were dissected and flash frozen in liquid nitrogen. Total RNA
was extracted from c. 200 mg mixed tissue from each genotype using 2 ml TriReagent
(Sigma) as recommended, with two additional phenol-chloroform purification steps. RNAs
were quality checked using the RNA 6000 Nano kit as instructed on a 2100 Bioanalyzer
(Agilent), with all RNA samples having an RNA Integrity Number (RIN) >8.
Transcriptome sequencing
Total RNA samples were submitted to The Sir Henry Wellcome Functional Genomics
Facility, University of Glasgow, for RNA-seq processing using standard recommended
Illumina GAII procedures. For each sample, one lane of Single-End 54 nt or 76 nt RNA-seq
was performed, generating between c. 6M and 27M reads respectively (Supplementary Table
1).
Read preparation
The raw Illumina reads were obtained in two separate sequencing runs carried out more than
a year apart, and as a result reads obtained in the earlier run were significantly shorter (54 nt)
than those from the latter run (76 nt) as Illumina read lengths continue to increase
significantly. All raw reads were quality trimmed to a quality score (phred equivalent) of 20
or greater. This removes stretches of sequence from either read end where the base qualities
are consistently below the threshold. Read numbers and read lengths are detailed in
Supplementary Table 1. This step significantly reduces the risk of obtaining false positives
during SNP discovery.
Read mapping
The trimmed reads were mapped to the Harvest 35 unigene sequences (http://www.harvest-
web.org/hweb/bin/wc.dll?hwebProcess~hmain~&versid=5) using the Mosaik read mapping
tool (http://bioinformatics.bc.edu/marthlab/Mosaik) using a separate run for each sample.
Due to the varying length of the trimmed reads a mismatch percentage was used (2%
mismatches allowed). The mapping was carried out using the “-m unique” parameter setting
which causes reads to be discarded that could be mapped to more than one location in the
reference sequence. The SNP sequences from BOPA 1 and 2 (Close et al. 2009) were also
mapped to the Harvest35 unigenes using the same parameters.
The Illumina reads mapped to 41,484 out of a total of 50,938 unigenes (81.4%). 112,721,213
out of a total of 191,210,425 reads were mapped successfully to the reference sequences
(58.9%). 2,079 of the BOPA manifest sequences mapped to unigenes in the Harvest 35
assembly, which represents only 67.6% of the total of 3,072 BOPA manifests. The shortfall is
![Page 4: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/4.jpg)
Page 4
likely due to the fact that the BOPA SNPs were designed using a previous version of the
Harvest assembly (Harvest 21).
All the individual mappings were then merged using the MosaikMerge utility, and the
resulting file was used for SNP discovery as well as for generating sam and bam files.
SNP discovery
The initial round of SNP discovery was carried out using the GigaBayes tool
(http://bioinformatics.bc.edu/marthlab/GigaBayes). The parameter values used for this are
listed in Supplementary Table 2. A deliberately relaxed set of parameters was used which
captures a wide range of putative SNPs but also detects a large number of false positives.
This was followed by a second round of filtering with custom written code because there is
significant variation of read coverage between and within unigenes (due to the nature of the
transcriptome data), and therefore a simple filter based on absolute numbers such as that used
by GigaBayes is inadequate for eliminating a sufficient number of false positives.
We then extracted SNP manifest sequences from the full set of SNPs from the GigaBayes run
(n = 240,119), which contained IUPAC ambiguity codes for any neighbouring SNPs in the
extracted flanking regions. These were submitted to the Illumina Assay Design Tool (ADT)
in order to assess the suitability of the SNPs for the assay.
Out of the total of 240,119 SNPs submitted, 92,063 passed the ADT run and out of these
76,831 had a final design score of >= 0.6 (Illumina‟s recommended threshold for high-
confidence design). A large number of SNPs failed (n = 148,056, 61.6% of the total), mostly
because of the presence of other SNPs in the flanking regions (Supplementary Table 3). This
is likely a consequence of the full, unfiltered set containing numerous false positives.
SNP filtering
The initial set of SNPs discovered by the GigaBayes tool was then filtered further
(Supplementary Table 4). First, all SNPs with a final design score of less than 0.6 were
removed, leaving 76,831 of 240,119. Then, all SNPs on unigenes that contained BOPA SNPs
were removed to maximize the unigene coverage of the whole SNP set.
This left 64,474 SNPs which were then filtered further to remove SNPs containing reads from
apparently heterozygous samples. The samples used were assumed to come from completely
homozygous individuals, so any observed heterozygosity should be attributable to one or
more of the following:
Mismapped regions where two different overlapping sets of reads have been mapped,
one of which has been assigned to the wrong location
Cases where misassembly seems to have taken place due to the Harvest 35 unigene
itself having been misassembled (chimaerism)
Cases where there are very few reads of the minor allele of the sample, suggesting
read errors
To separate “genuine” heterozygotes from those caused by read errors we extracted for each
SNP a statistic which we refer to as the “heterozygosity index” here. This is the maximum
![Page 5: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/5.jpg)
Page 5
value observed in any one sample x SNP combination (within a SNP) of the proportion of its
minor allele count relative to its total allele count. This has the effect of removing SNPs
featuring heterozygote samples where the allele proportion indicates misassembly, whilst
retaining SNPs with homozygous samples only, as well as SNPs where sample
heterozygosity is due to a small proportion of presumed read errors. The value used for this
was 0.01 (1%) or less, which is approximately the same as the published error rate for
Illumina sequencing.
A combination of sorting and filtering was then used to obtain the final shortlist of SNPs.
This consisted of the following steps:
1. Filter by the number of samples which had the genotype of the minor allele at the
SNP location, using a cutoff of >=2.
2. Sort the data by unigene name (ascending), then, in descending order, by minimum
number - out of all samples in a SNP - of reads that were counted towards the actual
genotype of the sample, i.e. in homozygous samples the major (and only) allele count
and in heterozygous samples the minor allele count (here referred to as “minimum
read replication”)
3. Remove duplicates so that only a single SNP remains per unigene. This left 7,905
SNPs.
4. Sort the remaining SNPs again, first by the number of reads that were counted
towards the actual genotype of the sample as above (descending), then by the minor
allele frequency (descending). This puts the most robust SNPs topmost.
5. Select the top SNPs from this list.
This approach is a compromise between sample diversity in a SNP and robustness of support
for the SNP, with sample diversity being given a relatively greater weight.
The 5,010 topmost SNPS were selected from this final sorted list for inclusion on the chip. In
addition, a set of 2,832 SNPs used for the existing BOPA (Barley Oligo Pooled Assay) on the
Illumina Golden Gate genotyping platform was included together with 22 SNPs from
resequencing studies, giving a total of 7,864 SNP assays on the chip.
Validation of Illumina mappings
Mappings were initially inspected visually using the Tablet assembly viewer (Milne et al
2010). To ascertain the validity of the Illumina read mappings the SNP discovery was based
on, custom written code was used to compare genotype calls extracted from the Illumina read
mappings at the BOPA SNP positions with existing genotype data for the same samples
obtained with the Illumina Golden Gate genotyping assay.
To harmonize the SNP filtering protocol and the validation procedure the code was
parameterized with two of the critical parameters also used in filtering – the heterozygosity
index and the minimum read replication (see above). When the code was executed with
values of 0.01 and 1 for these parameters, respectively, validation rates were in the region of
approx. 93-95% (Supplementary Table 5). When the minimum read replication value was
![Page 6: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/6.jpg)
Page 6
increased to 2 and 3, the average validation rates increase to approx. 97% and 98%,
respectively.
It appears that the incorrectly called instances of SNP x sample combinations are mainly due
to heterozygotes that have not been filtered out (because the cutoff of 1% cannot complete
filter out all instances of heterozygotes caused by read errors), and to a lesser extent cases
where read coverage is low.
All markers, including their locations according to the Morex x Barke map are included in the
„Supplementary Table 6‟.
References
Close T, Bhat P, Lonardi S, Wu Y, Rostoks N, Ramsay L, Druka A, Stein N, Svensson J,
Wanamaker S, Bozdag S, Roose M, Moscou M, Chao S, Varshney R, Szucs P, Sato K, Hayes
P, Matthews D, Kleinhofs A, Muehlbauer G, DeYoung J, Marshall D, Madishetty K, Fenton
R, Condamine P, Graner A, Waugh R (2009) Development and implementation of high-
throughput SNP genotyping in barley. BMC Genomics 10:582
Milne, I., Bayer, M., Cardle, L., Shaw, P., Stephen, G., Wright, F. and Marshall, D. 2010.
Tablet - next generation sequence assembly visualization. Bioinformatics 26(3), 401-402.
1.2.Determination of marker order by linkage mapping Morex X Barke derived RILs
A large population of 2407 F8 recombinant inbred lines (RILs) was constructed by single
seed descent from a cross between the cultivars Morex and Barke. A random subset of 367
RILs was taken and DNA was isolated from each RI line by standard procedures and
genotyped using the barley 9K iSelect (7864 SNPs) chip as described in the materials and
methods. Allele scores extracted directly from the Illumina GenomeStudio software were
checked manually and monomorphic and questionable data removed. This left a total of
3973 high quality and robust co-dominant SNP markers that were polymorphic in the
population. Seven individual lines were dropped from further analysis due to quality
concerns leaving a mapping population of 360 RILs. Out of 1,430,280 markers scored,
26,535 (1.43%) were considered heterozygous. These were almost entirely within maintained
tracts of heterozygosity/heterogeneity that were present in 299 (83%) of the RILs sampled.
Mapping was performed with three different software packages. These were JoinMap 4.0
(Kyazma B.V., Wageningen, Netherlands), Map Manager QTXb20 (Manly et al., 2001,
www.mapmanager.org) and MapChart 2.2 (Plant Research International BV, Wageningen,
Netherlands). Initially, the genotyping data were transformed into a mapping data format
(“ABH”, A = genotype parent 1, B = genotype parent 2, H = heterozygous). JoinMap 4.0
(Van Ooijen, 2006) was employed for the linkage mapping, for verification of the segregation
patterns, the formation of linkage groups and the preliminary position of the markers on the
chromosomes with the default grouping settings and the mapping algorithm ML (maximum
likelihood). The final map position of the markers as well as the genetic distances between
![Page 7: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/7.jpg)
Page 7
the markers were subsequently optimized manually with respect to the number of crossovers
(as low as possible) and the length of the linkage group (as short as possible) using the ABH
mapping data file in Excel and MapManager QTX (settings: linkage evaluation RIX, search
linkage criterion P=0.05, map function Kosambi, cross type line cross). Ultimately this
allowed all 3973 markers to be located to each of the seven barley chromosomes (411 on 1H,
700 on 2H, 596 on 3H, 346 on 4H, 802 on 5H, 558 on 6H and 560 on 7H). The genetic map
totalled 990.5 cM with the very distal end of 4HL being monomorphic presumably due to
past selection in both parental lines for spring habit at the VRN-H2 vernalization locus
(Dubcovsky et al, 2005). The mean distance between pairs of genetic markers was 0.249 cM
though there remain a small number of intervals >5 cM relating to regions of higher
recombination rate or identity by state. The final map was drawn using MapChart 2.2 (R.E.
Voorrips, 2002). The mapped markers and their locations are indicated in the iSelect marker
assay file given in Supplementary Table 6 and downloadable from
http://bioinf.hutton.ac.uk/waugh/iselect.
References
Dubcovsky, J, Chen, C, Yan, L. (2005) Molecular characterization of the allelic variation at
the VRN-H2 vernalization locus in barley. Molecular Breeding 15:395-407.
Manly KF, Cudmore Jr RH, Meer JM (2001) Map Manager QTX, cross platform software for
genetic mapping. Mamm Genome 12: 930-932
Van Ooijen, J.W. (2006). JoinMap 4
, Software for the calculation of genetic linkage maps in
experimental populations. Kyazma B.V., Wageningen, Netherlands
Voorrips, R.E. (2002). MapChart: Software for the graphical presentation of linkage maps
and QTLs. The Journal of Heredity 93: 77-78
1.3.Divergent selection and known loci.
SNP markers with ФPT values higher than 0.9 (ФPT 10
> 0.35) delimited 9 genomic regions
with strong putative divergent selection footprints. Manual examination revealed that
alternative alleles at these regions are close to fixation in the divergent germplasm pools.
Known loci were assigned to 6 of the 9 genomic regions (see Supplementary Table 8) where
the causative gene is known or very strong gene candidates have been cited in the literature.
The genes known as DENSO (sdw-1) and PPD-H2 have not been cloned in barley but the
regions containing these genes have been shown to contribute to differences in flowering
time between spring and winter barley genepools. The top SNP in the DENSO region (ФPT =
0.938) is 1.13 cM (MxB map) from the strong candidate gene Ga20ox for sdw-1 (41 / 24
gene models in rice / Brachypodium respectively). In the case of PPD-H2 5 SNPs in
complete LD with ФPT values of 0.986 delimitate a region of 2.77 cM encompassing 56 rice
genes (from LOC_Os05g44100 to LOC_Os05g44760). The candidate gene for PPD-H2
![Page 8: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/8.jpg)
Page 8
(OsFTL10, LOC_Os05g44180) is 5 / 3 gene models away in rice / Brachypodium
respectively from the closest amongst the top SNPs.
In the case of frost resistance locus FR-2, the top SNP with ФPT value of 0.947 hits
OSU_HvCBF4A. CBF (C-repeat/DRE-Binding Factor) genes has been shown to induce the
expression of some cold-regulated genes, increase freezing tolerance and play a major role in
winter hardiness in cereals. OSU_HvCBF4A is a SNP in one of a cluster of CBF genes and
may not be the causal gene - but it is linked to functional structural changes in the CBF
cluster.
For VRN-H2, flanking SNPs (ФPT > 0.9) are 51/42 and 34/38 gene models away in rice /
Brachypodium respectively and for VRN-H1 the top flanking SNPs (ФPT > 0.9) are 119/100
and 87/36 gene models away in rice / Brachypodium respectively. Large linkage blocks
around these two regions that are maintained by high LD (especially around VRN-H1) have
already been described in the literature (von Zitzewitz et al. 2011). For the latter two
examples, we are conscious that there may be some ascertainment issues in the marker
platform as the majority of SNPs were derived from the spring gene pool (only one winter
genotype was included in selecting 6000 of the 9000 SNPs).
ФPT values around PPD-H1 and VRN-H3 did not reach the threshold of ФPT > 0.9. VRN-H3
is close to fixation in the spring germplasm cluster (MAF = 0.07) but still segregates in the
winter germplasm (MAF = 0.41). Fixation of VRN-H3 in the spring cluster caused a local
moderate increase of the Fst values in the region. The top SNP "i_SCRI_RS_172761" (ФPT =
0.46) is located 21 / 22 gene models away in rice / Brachypodium respectively from VRN-H3.
In relation to PPD-H1, a moderately high ФPT value for SNP "i_SCRI_RS_153798" (ФPT
>0.8), 0.99 cM from HvPRR7, provides evidence of an ongoing selection sweep in the region.
Physical distance could not be inferred as the SNP "i_SCRI_RS_153798" is not in a
conserved syntenic position in rice or Brachypodium. The SNP allele fixed in the spring
germplasm pool is segregating at relatively low frequency in the winter germplasm pool
(MAF = 0.18).
Reference
von Zitzewitz, J., A. Cuesta-Marcos, F. Condon, A. J. Castro, S. Chao et al. 2011 The
genetics of winterhardiness in barley: perspectives from genomw-wide association mapping.
The Plant Genome 4: 76-91.
1.4.QTL mapping of flowering time in the Nure x Tremois (NT) population
The "NT" Doubled Haploid (DH) population was derived by anther culture from the F1 of
the cross between the winter, two-rowed Italian variety Nure - [(„Fior 40‟ x „Alpha‟2) x
„Baraka‟] - and the spring, two-rowed French malting cultivar Tremois - [(„Dram‟ x
„Aramir‟) x „Berar‟]. One hundred and eighteen DH lines have been genotyped with 542
markers (396 DArT) in order to build a genetic linkage map with an average resolution of one
![Page 9: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/9.jpg)
Page 9
marker every 2.8 cM (Tondelli et al., unpublished; Aghnoum et al., 2010). Replicated field
trials were conducted in 13 environments of six countries around the Mediterranean basin for
two harvest seasons, with different sowing dates ranging from the beginning of November
(autumn sowing) to the end of December (winter sowing), till march 21 (spring sowing)
(Francia et al., 2011). Time to flowering, grain yield and other phenological and yield
component traits were recorded. Phenotypic data were analyzed in GenStat version 14 (Payne
2009) in order to generate both Best Linear Unbiased Estimates (BLUEs) for each NT line,
and for multi-environment QTL analyses through Composite Interval Mapping (CIM).
The most significant time to flowering QTL was detected in the centromeric region of
chromosome 2H, BIN_07.2 , in a genomic region that corresponds to EPS2. The QTL
position for EPS2 (Supplementary Figure 1) is based on the P135A polymorphism within
HvCEN, that cosegregates with BOPA 12_30265, a marker showing strong divergent
selection in winter vs. spring barleys. HvCEN was resequenced in all individuals of the Nure
x Tremois population and the polymorphism leading to P135A was the most highly
associated marker in QTL analysis. The QTL thus explains precisely how much of the total
phenotypic variation is accounted for by HvCEN alleles at this locus. Regression analyses
considering marker alleles at four main loci involved in barley phenology and segregating in
the NT population (PPD-H2 on chromosome 1H, EPS2 on 2H, VRN-H2 on 4H and VRN-H1
on 5H) revealed that EPS2 explains 66% of the genotypic component of heading date across
the 13 environments (Supplementary Table 9). The Nure allele at HvCEN conferred early
maturity in 12 out of 13 environments, under different photoperiod and temperature regimes,
with an average effect on flowering of - 4.7 days. The same allele was pleiotropically
associated with grain yield in 5 environments, with an average effect of + 0.26 t ha-1, and to
thousand grain weight in 9 environments (average effect of + 3.8 grams). EPS2 accounted for
30% and 64% of the genetic variation for yield and thousand grain weight, respectively
(SupplementaryTable 9). This dataset confirmed that in environments characterized by
terminal drought the best adapted genotypes in the Nure x Tremois population were those
capable of fine tuning their life cycle, by advancing time to flowering in order to set seed and
increase seed weight in a wetter period.
In addition to the Nure x Tremois population, in 2011 we similarly examined the pleiotropic
effects of 10 of the mutant mat-c alleles on both height and grains per ear (Supplementary
Figure 4). Plants were planted in a randomized complete block design with ten replicates and
grown under natural long-day conditions in Dundee, Scotland. Data for each line are based on
the average values of the five main tillers of the plant (SupplementaryTable 10).
References:
Aghnoum R, Marcel TC, Johrde A, Pecchioni N, Schweizer P, Niks RE (2010) Basal host
resistance of barley to powdery mildew: connecting quantitative trait loci and candidate
genes. Mol Plant-Microbe Interact 23:91–102
Francia E, Tondelli A, Rizza F, Badeck FW, Li Destri O, Akar T, Grando S, Al-Yassin A,
Benbelkacem A, Thomas WTB, van Eeuwijk F, Romagosa I, Stanca AM, Pecchioni N (2011)
![Page 10: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/10.jpg)
Page 10
Determinants of barley grain yield in a wide range of Mediterranean environments. Field
Crop Res 120:169–178
Payne R W (2009). "GenStat". Wiley Interdisciplinary Reviews: Computational Statistics 1
(2): 255–258
1.5.Expression analysis of HvCEN in Nure and Tremois
Nure and Tremois plants were grown in a Sanyo Gallenkamp SGC970 growth chamber under
different controlled conditions: Long Day (16h light, 20°C / 8h dark, 18°C), or Short Day (8h
light, 20°C / 16h dark, 18°C), with or without vernalization (4 week at 3°C day, 1°C night, in
short or long day as above). Vernalization was performed in SD but also in LD because most
of the sampling points fell into this period. In fact, for each experimental condition, tissues
were collected at the first leaf stage (fls), followed by 4 samplings –at 10, 20, 30 and 50 days.
For the vernalized experiments, last sampling was performed after returning plants to
20°C/18°C. Since microdissection of apex was not possible for very young plants, at each
time point 3 plants were pooled from each genotype, by sampling 2 cm of tissue surrounding
the meristematic apex. Two independent replicates of the whole experiment were performed.
For quantitative RT-PCR analysis, total RNA was extracted using TRI reagent® (Ambion)
and three μg of total RNA of each sample were reverse transcribed using oligo (dT)18-primer
with M-MLV Reverse Transcription Reagents (Promega) according to manufacturer‟s
instructions. The cDNAs were quantified using Qubit™ fluorometer (Invitrogen), diluted and
used for qPCR amplifications with gene specific primers. qRT-PCR analyses were performed
on 7300 Real-Time PCR System (Applied Biosystems) with the SYBR® Green PCR Master
Mix (Applied Biosystems), in three technical replications. The barley housekeeping reference
gene Actin was chosen for normalization of the cDNA, by amplifying it with the primer
combination described by Yan et al. (2006). Primer combinations for the target genes HvCEN
(F: 5‟-tttggaagggaggtggtgag-3‟; R: 5‟-gaagtagacggcagcgacagand-3‟) and HvBM5A (i.e. VRN-
H1) (F: 5‟-aactgaaggcgaaggttgaga-3‟; R: 5‟-tgcataagttggttcttcctgg-3‟; Yan et al., 2006) were
chosen in order to amplify fragments of comparable sizes, with one of the primer being
designed on an exon-intron junction, to avoid amplification from residual genomic DNA.
Expression values for the target genes are reported with respect to the expression of the
housekeeping gene Actin (Supplementary Figure 2). As expected, HvBM5A, the gene
promoting the transition of the apex from the vegetative to the reproductive stage, gradually
increased its expression in the winter genotype Nure under both inductive vernalization and
short day conditions. HvBM5A was constitutively expressed in the spring genotype Tremois.
On the other hand, HvCEN is neither induced nor repressed in any condition during the time
window examined, but its expression is always higher in Tremois than in Nure. Based on
these results, HvCEN is not influenced by the photoperiod and vernalization conditions used,
allowing us to hypothesize that it plays a role in maintenance of the vegetative state.
![Page 11: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/11.jpg)
Page 11
Reference:
Yan L, Fu D, Li C, Blechl A, Tranquilli G, Bonafede M, Sanchez A, Valarik M, Yasuda S,
Dubcovsky J (2006) The wheat and barley vernalization gene VRN3 is an orthologue of FT.
Proc Natl Acad Sci USA 103:19581–19586
1.6.Diversity analysis
Allele mining
The plant material used in this study is listed in Supplementary Table 11. Details on
accession names, their HvCEN haplotypes, taxonomic designations, status, growth habit, row
type and collection sites of 1143 re-sequenced accessions are given. We studied 215 wild
barleys (H. vulgare subsp. spontaneum) from the whole natural distribution range (17
countries), 108 wild barley accessions from recent collection trips were considered together
with 107 wild barley accessions obtained from genebanks; 184 barley landraces (H. vulgare
subsp. vulgare; 44 countries), 739 barley cultivars (51 countries, including 346 lines also
included in the „divergent selection‟ panel) and five H. vulgare agriocrithon accessions. We
defined the growth habit for wild barley based on phenotypic information gathered in 2007,
2009 and 2010 (not shown). The term “winter habit” refers to autumn-sown vernalization-
depended/responsive genotypes while “spring” types are not vernalization-responsive.
Extraction of genomic DNA, generation of PCR primers and PCR amplification
Genomic DNA was isolated from silica-dried single leaves of each line with the Qiagen
DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturers
instructions. The Primer3 online software (primer3_www.cgi v 0.2, Whitehead Institute for
Biomedical Research, Cambridge, UK) (Rozen and Skaletsky 2000) was used to design
primers. Oligonucleotides were purchased from Eurofins MWG Operon, Ebersberg,
Germany. We used a single primer pair that covers the last 3 exons and 2 introns for the
diversity analysis: CENbL1 (forward): GATCCATACCTGAGGGAGCA and CEN1bR2
(reverse): TGATGCAAACAATCAGCCAT. Total amplified fragment size was 689 bp. This
region covered three SNPs that distinguish Nure (winter) from Tremois (spring), including
that leading to the P135A amino acid change. The spring allele has one non‐synonymous
change in the coding region & two SNPs in the introns.
![Page 12: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/12.jpg)
Page 12
DNA amplifications were performed in a 25 µl volume. The reaction mix contained about
100 ng of genomic DNA:
n=1 (µl)
5*buffer 5
0,1mM dNTP's 3
CENbL1 0,5
CEN1bR2 0,5
H2O 13,875
Promega GoTaq 0,125
DNA 2
The reactions were incubated in a SensoQuest labcycler with the following cycling
conditions:
95°C 3 min
95°C 30 sec
65°C 30sec 7 cycles ( -1°C/cycle)
72°C 1 min
95°C 30 sec
57°C 30 sec 32 cycles
72°C 1 min
72°C 10 min
12°C forever
PCR products were separated by agarose gels.
Purification and sequencing of PCR products
PCR products from 1143 accessions were purified by NucleoFast 96 PCR plates (Macherey-
Nagel, Düren, Germany; add to each sample 150 µl water, set the samples on a NucleoFast
96 PCR Plate, use the vacuum station until the membrane is dry, add to each well 12 µl
water, shake for 15 min at room temperature) and were sequenced directly on both strands on
an Applied Biosystems (Weiterstadt, Germany) ABI Prism 3730xL sequencer using BigDye
terminators (4µl sample + 1µl primer 5µmol).
SNP-detection
DNA sequences were processed with AB DNA Sequencing Analysis Software 5.2 and later
manually edited by Bio-Edit version 7.0.9.0 (Hall 1999). Sequence alignments were
generated with ClustalW, and the allelic haplotypes were defined by DNASP 5.10.01
(Librado and Rozas 2009). All singletons have been confirmed afterwards by additional three
independent amplifications and sequencing. One heterozygous sequence was excluded from
the analysis. Of the sequenced 689 bp fragment, 657 bp were considered for the multiple
alignment. 14 SNPs have been detected that defined 13 haploytpes (Supplementary Table 12)
![Page 13: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/13.jpg)
Page 13
Median-Joining Networks
Median-Joining (MJ) Networks (Bandelt et al. 1999) were constructed with the software
programs DNA Alignment 1.3.1.1, Network 4.6.1.0 and Network publisher 1.3.0.0 (Fluxus
Technology Ltd., Clare, Suffolk, UK). Nine haplotypes were found in wild barley, seven in
landraces and six in cultivars. Six haplotypes are unique for wild barley whereas four are
unique for domesticated barley (unique for cultivars: -; unique for landraces: 1). Three major
haplotypes are shared between wild, landraces and cultivars. Four major haplotypes exist in
wild barley in nature (Figure 4 main text).
Haplotype distribution maps
ArcGIS 10 software from ESRI was used to draw the topographic maps. The GTOPO30
global digital elevation dataset developed by USGS was used as a basemap
(http://eros.usgs.gov/#/Find_Data/Products_and_Data_Available/gtopo30_info). The original
30-arc-second resolution (~1km) was aggregated to a coarser 10-km resolution, which is
sufficient for global scale mapping purposes still showing main topographical features. GPS
coordinates for collected and genebank materials are given in Supplementary Table 11. For
accessions obtained from genebank, where the precise collection site is unknown, the capital
state of the source country was arbitrarily chosen as collection site. European elite cultivars
were considered and arbitrarily plotted at the capital state of the source country were this
variety was released. The number of individuals collected at every location was counted and
is indicated using circles of different size. The unweighted geographical mean of the sample
locations was calculated and marked with a black cross in each map.
Natural distribution of Ala-135 and Pro-135 containing haplotypes
In order to address the biology behind the P135A change, we have plotted all accessions
harbouring Ala-135 and Pro-135 haplotypes, respectively – together into one GIS-based
distribution map each (Supplementary Figure 5). It is evident that the „Tremois G, Ala-135‟
allele (730 accessions; wild, landraces and cultivars) = the „spring‟ allele, predominates in
domesticated barley north of the Mediterranean Basin. This „spring‟ allele confers an
advantage in cool seasons because it is later flowering – allowing more time for grain fill and
ripening under optimal well-watered conditions.
The „Nure C, Pro-135)‟ allele (together 413 accessions) = the „winter‟ allele, predominates
e.g. in landraces originating south of the Mediterranean Sea (Morocco, Algeria, Libya,
Egypt) or from the Arabian Peninsula (Yemen, Oman). Here under hot, dry summer
conditions, the „winter‟ allele confers an advantage because it accelerates development and
thereby provides a mechanism to escape early season terminal drought.
![Page 14: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/14.jpg)
Page 14
Phylogenetic analysis of HvCEN
We selected early, mid and late flowering individuals of thirteen additional Triticeae species
based on phenotypic information gathered in 2010 and 2011 (not shown). DNA isolated from
101 single seed from Hordeum, Triticum and Aegilops individuals were resequenced at
HvCEN (multiple sequence alignment length: 614 bp) – 23 individuals of T. urartu (wheat
genome A donor); 14x Ae. speltoides (wheat genome B donor); 7x Ae. tauschii (wheat
genome D donor); 7x Ae. bicornis; 3x Ae. longissima; 4x Ae. sharonensis; 2x Ae. searsii; 3x
Ae. markgrafii; 3x Ae. umbellulata and 33x T. boeoticum; 1x H. murinum ssp. glaucum; 1x
H. californicum and 1x H. cordobense. Conservation of synteny searches were performed for
rye and wheat genomes. We found that Pro-135 is ancient at alignment position 531 (P135A)
and Ala-135 derived only in the H. vulgare lineage from haplotype IX which we only found
in wild barley. Two haplotype clades have been detected in the H. vulgare lineage. Clade 1
consists of major haplotype II (Nure), and haplotypes IV, VI and XI, whereas Clade 2
consists of haplotypes IX, X, XIII, major haplotype III (Tremois), VIII, V, XII, major
haplotype I (Bowman) and VII.
References
Bandelt H-J, Forster P, Röhl A (1999) Median-joining networks for inferring intraspecific
phylogenies. Mol Biol Evol 16:37–48
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symp Ser. 41:95–98
Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies.
Mol Biol Evol 23:254–267
Librado P and Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA
polymorphism data. Bioinformatics 25:1451-1452
Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist
programmers. Methods Mol Biol 132:365-386
![Page 15: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/15.jpg)
Page 15
2. Supplementary Figures:
Supplementary Figure 1: Multi-environment QTL scan of the time to flowering trait
measured in the Nure X Tremois DH population.
Supplementary Figure 1: Multi-environment QTL scan of the time to flowering trait
measured in the Nure X Tremois DH population. A genetic linkage map of chromosome 2H
from the NT population, showing the position of HvCEN and HvPPD-H1. Distances are in
Kosambi cM.
![Page 16: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/16.jpg)
Page 16
Supplementary Figure 2: Expression of barley HvCEN and VRN-H1 genes (HvBM5A).
Supplementary Figure 2: Expression of barley HvCEN and VRN-H1 genes (HvBM5A).
Experiments were carried out in the winter cultivar Nure and the spring cultivar Tremois,
grown under different photoperiod and vernalization conditions: a) Long Days, not
Vernalized; b) Long Days, Vernalized; c) Short Days, not Vernalized; d) Short Days,
Vernalized. Each mRNA was quantified relative to Actin mRNA. Data were standardized over
two independent experiments (means ± SE). The numbers at the bottom indicate the number
of days after the complete emergence of the first leaf.
![Page 17: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/17.jpg)
Page 17
Supplementary Figure 3: MJ network derived from resequenced DNA haplotypes and
conservation of synteny searches in sequenced model grass genomes among Triticeae
species.
Supplementary Figure 3: MJ network derived from resequenced DNA haplotypes and
conservation of synteny searches in sequenced model grass genomes among Triticeae
species. Thirty-four haplotypes were found (every haplotype has been considered only one
time, thus one haplotype can be shared between several individuals and species). The
distance in nucleotide substitutions between haplotypes is indicated by numbers. Two clades
of haplotypes within the Hordeum vulgare lineage were found. Haplotypes highlighted in
green are Ala containing haplotypes at position 531 (P135A) (Supplementary Table 11). All
other haplotypes harbor Pro at this position. The 13 haplotypes within the H. vulgare lineage
are indicated by Roman numerals as in Figure 4 in the main text and Supplementary Table
11. Hor-mur-glau – Hordeum murinum subsp. glaucum, Hor-cordob – H. cordobensis, Hor-
calif – H. californicum, AES-A – Triticum aestivum genome A, BOE – T. boeoticum, LOG –
Aegilops longissima, MAR – Ae. markgrafii, MON – T. monococcum, SEA – Ae. searsii,
SHA – Ae. sharonensis, SPE – Ae. speltoides, TAU – Ae. tauschii, UMB – Ae. umbellulata
and URA – T. urartu. Genbank accession numbers of resequenced DNA haplotypes are
JX855806-JX855826 (http://www.ncbi.nlm.nih.gov/genbank).
![Page 18: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/18.jpg)
Page 18
Supplementary Figure 4: Pleiotropic effects of MAT-C mutant alleles on (a) height (in
millimetres) and (b) grains per ear.
Supplementary Figure 4: Pleiotropic effects of MAT-C mutant alleles on (a) height (in
millimetres) and (b) grains per ear. Data presented are from the two wild types and the ten
mutant lines and are shown as means +/- s.e.m.
500600700800900
100011001200
he
igh
t (m
m)
05
1015202530
grai
ns
pe
r e
ar
a
b
![Page 19: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/19.jpg)
Page 19
Supplementary Figure 5: GIS-based topographic maps of Ala-135 and Pro-135
containing haplotypes.
Supplementary Figure 5: GIS-based topographic maps of Ala-135 and Pro-135 containing
haplotypes. a) All wild and domesticated barley accessions harboring the ‘Tremois G, Ala-
135), spring allele’ (haplotypes I, III, V, VII, VIII, XII) were plotted together. b) All
accessions harboring the ‘Nure C, Pro-135, winter allele’ (haplotypes I II, IV, VI, IX, X, XI,
XIII) were plotted together. See Figure 4 and Supplementary Table 12i for more details. The
number of individuals collected at each particular site is indicated by the key at upper left.
The geographical mean is indicated by a black cross.
![Page 20: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/20.jpg)
Page 20
3. Supplementary Tables:
Supplementary Table 1: Read numbers and read lengths for all samples used.
sample read numbers
untrimmed
read numbers
trimmed
mean trimmed read
length
Barke 25,663,186 25,538,142 72
Betzes 22,204,022 22,118,902 72.5
Bowman 7,257,869 7,251,430 48.8
Derkado 5,932,230 5,930,692 39.8
Intro 6,066,180 6,064,803 40.4
Morex 26,664,480 26,292,853 68.9
Optic 23,252,182 23,164,817 71.5
Quench 26,946,706 26,795,748 69.8
Sergeant 24,480,462 24,288,466 72.1
Tocada 23,868,881 23,764,572 72.2
Total 192,336,198 191,210,425 62.8
![Page 21: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/21.jpg)
Page 21
Supplementary Table 2: GigaBayes parameter values used in the primary SNP
detection run.
--CRL 6 minimum read coverage = 6
--CAL 3 minimum number of instances of an allele required = 3
--PSL 0.5 minimum likelihood of SNP being genuine = 0.5
![Page 22: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/22.jpg)
Page 22
Supplementary Table 3: Breakdown of failure categories and counts of SNPs returned
by the Illumina Assay Design Tool (ADT), out of a total of 240,119 raw SNPs submitted.
Error explanation # failed
106;101 Degenerate nucleotide(s) in assay design region;Flanking sequence is
too short
2,536
360 Low score warning 637
106 Degenerate nucleotide(s) in assay design region 144,429
103 Top/Bot strand cannot be determined 454
total failed 148,056
![Page 23: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/23.jpg)
Page 23
Supplementary Table 4. Numbers of SNPs during the incremental filtering procedure.
SNP set # SNPs
unfiltered (after GigaBayes) 240,119
after removal of SNPs with final design score
of less than 0.6
76,831
after removal of unigenes containing BOPA
SNPs
64,474
after filtering for heterozygosity 31,616
![Page 24: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/24.jpg)
Page 24
Supplementary Table 5: Validation rates for the Illumina read mappings by sample,
compared to existing benchmark genotype data from the Illumina Golden Gate
genotyping assay (values of 0.01 and 1 for heterozygosity index and the minimum read
replication respectively).
Sample Incorrec
tly
called
Correctly
called
SNP not
present
No
NGS
data
No
benchmark
data
Tota
l
%
correctly
called
Betzes 115 1776 1020 132 29 3072 93.92
Bowman 72 1390 1020 338 252 3072 95.08
Intro 40 699 1020 541 772 3072 94.59
Morex 24 573 1020 306 1149 3072 95.98
Optic 47 884 1020 125 996 3072 94.95
Sergeant 129 1782 1020 123 18 3072 93.25
Tocada 119 1795 1020 117 21 3072 93.78
Derkado 75 1433 1020 532 12 3072 95.03
Barke 103 1842 1020 93 14 3072 94.70
Quench 64 870 1020 107 1011 3072 93.15
![Page 25: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/25.jpg)
Page 25
Supplementary Table 7: Germplasm used for Divergent selection
Serial number
JHI iSelect
lines
Accession name Taxonomy Genetic cluster Divergent
pools
Included in the
1143 set
1 ACAPELLA Hordeum vulgare elite spring 2r S-2R
2 ACROBAT Hordeum vulgare elite spring 2r S-2R
3 ADONIS Hordeum vulgare elite spring 2r S-2R +
4 AGENDA Hordeum vulgare elite spring 2r S-2R +
5 AKITA Hordeum vulgare elite spring 2r S-2R
6 ALABAMA Hordeum vulgare admixted excluded +
7 ALLIOT-2 Hordeum vulgare elite spring 2r S-2R
8 ALUMINIUM Hordeum vulgare elite spring 2r S-2R +
9 AMOURETTE Hordeum vulgare elite spring 2r S-2R
10 ANACONDA Hordeum vulgare elite spring 2r S-2R
11 ANAIS Hordeum vulgare admixted excluded
12 ANNABELL Hordeum vulgare elite spring 2r S-2R +
13 APPALOOSA Hordeum vulgare elite spring 2r S-2R +
14 ARAMIR Hordeum vulgare admixted excluded +
15 ARDILA Hordeum vulgare elite spring 2r S-2R
16 ASB 04-18 Hordeum vulgare elite spring 2r S-2R +
17 ASPEN Hordeum vulgare elite spring 2r S-2R +
18 ASTORIA Hordeum vulgare elite spring 2r S-2R
19 ATEM Hordeum vulgare admixted excluded +
20 ATHENA Hordeum vulgare admixted excluded
21 AVEC Hordeum vulgare elite spring 2r S-2R +
22 AZURE Hordeum vulgare elite spring 2r S-2R
23 B83-12-21-5 Hordeum vulgare admixted excluded
24 BEATRIX Hordeum vulgare elite spring 2r S-2R +
25 BEKA Hordeum vulgare admixted excluded
26 BERAC Hordeum vulgare admixted excluded +
27 BERWICK Hordeum vulgare elite spring 2r S-2R +
28 BETZES Hordeum vulgare admixted excluded
29 BLENHEIM Hordeum vulgare admixted excluded
30 BRAEMAR-2 Hordeum vulgare elite spring 2r S-2R
31 BRAHMS Hordeum vulgare elite spring 2r S-2R +
32 BRAZIL-2 Hordeum vulgare elite spring 2r S-2R
33 BREWSTER Hordeum vulgare elite spring 2r S-2R
34 BRISE Hordeum vulgare elite spring 2r S-2R
35 BERYLLIUM Hordeum vulgare elite spring 2r S-2R +
36 CALICO Hordeum vulgare elite spring 2r S-2R +
37 CAMARGUE Hordeum vulgare old spring 2r excluded +
38 CAMPALA Hordeum vulgare elite spring 2r S-2R +
39 CANASTA Hordeum vulgare elite spring 2r S-2R +
40 CATALINA Hordeum vulgare elite spring 2r S-2R
41 CECILIA Hordeum vulgare admixted excluded
42 CELEBRA Hordeum vulgare admixted excluded +
43 CENTURION Hordeum vulgare elite spring 2r S-2R +
44 CENTURY Hordeum vulgare elite spring 2r S-2R +
45 CHALICE Hordeum vulgare elite spring 2r S-2R +
46 CHARIOT Hordeum vulgare elite spring 2r S-2R +
![Page 26: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/26.jpg)
Page 26
47 CHARM Hordeum vulgare elite spring 2r S-2R
48 CHASER Hordeum vulgare elite spring 2r S-2R +
49 CHEVALLIER-
TYSTOFTE
Hordeum vulgare admixted excluded
50 CHIEFTAIN Hordeum vulgare elite spring 2r S-2R +
51 CHIME Hordeum vulgare elite spring 2r S-2R +
52 CINDY Hordeum vulgare admixted excluded
53 CLARITY Hordeum vulgare admixted excluded +
54 CLASS Hordeum vulgare elite spring 2r S-2R +
55 COLADA Hordeum vulgare elite spring 2r S-2R +
56 COOPER-2 Hordeum vulgare elite spring 2r S-2R
57 CORK Hordeum vulgare elite spring 2r S-2R +
58 COUNTY Hordeum vulgare elite spring 2r S-2R
59 CPBT B76 Hordeum vulgare elite spring 2r S-2R +
60 CPBT B80 Hordeum vulgare elite spring 2r S-2R +
61 CRIBBAGE Hordeum vulgare admixted excluded
62 CRUSADER Hordeum vulgare elite spring 2r S-2R
63 DALLAS Hordeum vulgare elite spring 2r S-2R +
64 DECANTER Hordeum vulgare elite spring 2r S-2R +
65 DELIBES Hordeum vulgare elite spring 2r S-2R
66 DERKADO Hordeum vulgare elite spring 2r S-2R
67 DEW Hordeum vulgare elite spring 2r S-2R +
68 DRAUGHT Hordeum vulgare elite spring 2r S-2R +
69 DRAY Hordeum vulgare elite spring 2r S-2R +
70 DRUM Hordeum vulgare elite spring 2r S-2R
71 DOYEN Hordeum vulgare elite spring 2r S-2R +
72 EXTRACT Hordeum vulgare elite spring 2r S-2R
73 FAIRYTALE Hordeum vulgare elite spring 2r S-2R +
74 FELICIE Hordeum vulgare admixted excluded
75 FELTWELL Hordeum vulgare elite spring 2r S-2R +
76 FERMENT Hordeum vulgare elite spring 2r S-2R +
77 FONTANA Hordeum vulgare elite spring 2r S-2R +
78 FOXTROT Hordeum vulgare elite spring 2r S-2R +
79 FRACTAL Hordeum vulgare admixted excluded
80 FRANKLIN Hordeum vulgare admixted excluded
81 GEORGIE Hordeum vulgare admixted excluded +
82 GLEN Hordeum vulgare admixted excluded
83 GLOBAL Hordeum vulgare elite spring 2r S-2R +
84 GOLDIE Hordeum vulgare admixted excluded +
85 GRANTA Hordeum vulgare elite spring 2r S-2R +
86 GRAPHIC Hordeum vulgare admixted excluded
87 GUNDEL Hordeum vulgare admixted excluded
88 HANKA-2 Hordeum vulgare elite spring 2r S-2R
89 HARRIOT Hordeum vulgare elite spring 2r S-2R +
90 HART Hordeum vulgare admixted excluded
91 HEATHER Hordeum vulgare admixted excluded +
92 HENLEY Hordeum vulgare elite spring 2r S-2R +
93 HENNI Hordeum vulgare admixted excluded
94 HERON Hordeum vulgare admixted excluded
95 HOPPER Hordeum vulgare elite spring 2r S-2R +
96 HORIZON Hordeum vulgare elite spring 2r S-2R +
97 HOST Hordeum vulgare elite spring 2r S-2R +
98 HYDRA Hordeum vulgare elite spring 2r S-2R +
99 INDOLA Hordeum vulgare elite spring 2r S-2R +
100 ISABELLA Hordeum vulgare elite spring 2r S-2R +
![Page 27: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/27.jpg)
Page 27
101 JIVE Hordeum vulgare admixted excluded
102 JUNO Hordeum vulgare admixted excluded
103 KARAT Hordeum vulgare winter 2r W-2R
104 KASSIMA Hordeum vulgare elite spring 2r S-2R +
105 KLAXON Hordeum vulgare admixted excluded +
106 KYM Hordeum vulgare admixted excluded +
107 LANDLORD Hordeum vulgare elite spring 2r S-2R +
108 LINA Hordeum vulgare admixted excluded
109 LINDEN Hordeum vulgare elite spring 2r S-2R +
110 LITHIUM Hordeum vulgare elite spring 2r S-2R +
111 LIVET Hordeum vulgare elite spring 2r S-2R
112 LOGAN Hordeum vulgare admixted excluded
113 MACARENA Hordeum vulgare elite spring 2r S-2R +
114 MACAW Hordeum vulgare elite spring 2r S-2R +
115 MADRAS Hordeum vulgare elite spring 2r S-2R +
116 MANDOLIN-1418 Hordeum vulgare admixted excluded +
117 MAYPOLE Hordeum vulgare elite spring 2r S-2R +
118 MELITTA Hordeum vulgare elite spring 2r S-2R +
119 MELTAN Hordeum vulgare admixted excluded +
120 MIKADO Hordeum vulgare admixted excluded +
121 MINSTREL Hordeum vulgare elite spring 2r S-2R
122 MONIKA Hordeum vulgare elite spring 2r S-2R +
123 NATASHA Hordeum vulgare elite spring 2r S-2R +
124 NERUDA Hordeum vulgare elite spring 2r S-2R +
125 NIMBUS Hordeum vulgare elite spring 2r S-2R
126 NOMAD Hordeum vulgare admixted excluded
127 NOVELLO Hordeum vulgare elite spring 2r S-2R +
128 NSL 95-1257 Hordeum vulgare elite spring 2r S-2R +
129 NSL 97-4552 Hordeum vulgare elite spring 2r S-2R +
130 NSL 98-5065 Hordeum vulgare elite spring 2r S-2R +
131 NSL 99-5363 Hordeum vulgare elite spring 2r S-2R +
132 ONYX Hordeum vulgare admixted excluded +
133 OPTIC Hordeum vulgare elite spring 2r S-2R +
134 PARAMOUNT Hordeum vulgare elite spring 2r S-2R +
135 PENTHOUSE Hordeum vulgare elite spring 2r S-2R
136 PEWTER Hordeum vulgare elite spring 2r S-2R +
137 PITCHER Hordeum vulgare elite spring 2r S-2R +
138 POKER Hordeum vulgare elite spring 2r S-2R +
139 POLYGENA Hordeum vulgare elite spring 2r S-2R +
140 PONGO Hordeum vulgare admixted excluded
141 POTTER Hordeum vulgare admixted excluded +
142 POWER Hordeum vulgare elite spring 2r S-2R +
143 PRAGUE Hordeum vulgare elite spring 2r S-2R +
144 PRESTIGE Hordeum vulgare elite spring 2r S-2R +
145 PRIMERA Hordeum vulgare admixted excluded
146 PRISMA Hordeum vulgare elite spring 2r S-2R +
147 PUBLICAN Hordeum vulgare elite spring 2r S-2R +
148 QUARTET Hordeum vulgare elite spring 2r S-2R +
149 QUENCH Hordeum vulgare elite spring 2r S-2R +
150 RAGTIME Hordeum vulgare admixted excluded
151 RAINBOW Hordeum vulgare elite spring 2r S-2R +
152 RAKAIA Hordeum vulgare elite spring 2r S-2R +
153 RANGOON Hordeum vulgare elite spring 2r S-2R +
154 REBECCA Hordeum vulgare admixted excluded
155 REGGAE Hordeum vulgare admixted excluded +
![Page 28: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/28.jpg)
Page 28
156 RENATA Hordeum vulgare old spring 2r excluded +
157 RIA Hordeum vulgare elite spring 2r S-2R +
158 RIVET-PERTH Hordeum vulgare elite spring 2r S-2R
159 RUMMY Hordeum vulgare elite spring 2r S-2R +
160 SABEL Hordeum vulgare elite spring 2r S-2R +
161 SACHA Hordeum vulgare elite spring 2r S-2R +
162 SALOON Hordeum vulgare elite spring 2r S-2R +
163 SCANDIUM Hordeum vulgare elite spring 2r S-2R +
164 SCARLETT Hordeum vulgare admixted excluded +
165 SEBASTIAN Hordeum vulgare elite spring 2r S-2R +
166 SHAKIRA Hordeum vulgare elite spring 2r S-2R +
167 SILICON Hordeum vulgare elite spring 2r S-2R +
168 SKAGEN Hordeum vulgare elite spring 2r S-2R +
169 SKITTLE Hordeum vulgare elite spring 2r S-2R +
170 SPEY Hordeum vulgare elite spring 2r S-2R +
171 SPIKE Hordeum vulgare elite spring 2r S-2R +
172 SPIRAL Hordeum vulgare admixted excluded
173 SPIRE Hordeum vulgare elite spring 2r S-2R +
174 SPLASH Hordeum vulgare elite spring 2r S-2R +
175 STARLIGHT Hordeum vulgare elite spring 2r S-2R +
176 STATIC Hordeum vulgare elite spring 2r S-2R +
177 SW 2808 Hordeum vulgare elite spring 2r S-2R +
178 SW MACSENA Hordeum vulgare elite spring 2r S-2R +
179 SW SCANIA Hordeum vulgare admixted excluded +
180 SW STELLA Hordeum vulgare elite spring 2r S-2R +
181 TABORA Hordeum vulgare elite spring 2r S-2R +
182 TANKARD Hordeum vulgare elite spring 2r S-2R +
183 TAPHOUSE Hordeum vulgare elite spring 2r S-2R +
184 TARDUS Hordeum vulgare elite spring 2r S-2R +
185 TARTAN Hordeum vulgare elite spring 2r S-2R +
186 TAVERN Hordeum vulgare elite spring 2r S-2R +
187 THISTLE Hordeum vulgare elite spring 2r S-2R
188 THRIFT Hordeum vulgare admixted excluded
189 TIMORI Hordeum vulgare admixted excluded
190 TIPPLE Hordeum vulgare elite spring 2r S-2R +
191 TOBY Hordeum vulgare elite spring 2r S-2R +
192 TOCADA Hordeum vulgare elite spring 2r S-2R +
193 TODDY Hordeum vulgare elite spring 2r S-2R +
194 TOKEN Hordeum vulgare elite spring 2r S-2R +
195 TORUP Hordeum vulgare admixted excluded +
196 TOUCAN Hordeum vulgare elite spring 2r S-2R +
197 TRINIDAD Hordeum vulgare elite spring 2r S-2R
198 TRINITY Hordeum vulgare elite spring 2r S-2R +
199 TRIUMPH Hordeum vulgare elite spring 2r S-2R +
200 TROON Hordeum vulgare elite spring 2r S-2R
201 TROSA Hordeum vulgare elite spring 2r S-2R +
202 TUCSON Hordeum vulgare elite spring 2r S-2R +
203 TURNBERRY Hordeum vulgare elite spring 2r S-2R +
204 TYNE Hordeum vulgare admixted excluded
205 URSA Hordeum vulgare elite spring 2r S-2R +
206 VEGAS Hordeum vulgare elite spring 2r S-2R +
207 VELVET Hordeum vulgare elite spring 2r S-2R +
208 VILLA Hordeum vulgare admixted excluded
209 VISKOSA Hordeum vulgare elite spring 2r S-2R +
210 VIVENDI Hordeum vulgare elite spring 2r S-2R +
![Page 29: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/29.jpg)
Page 29
211 VORTEX Hordeum vulgare elite spring 2r S-2R
212 WAGGON Hordeum vulgare elite spring 2r S-2R +
213 WEITOR Hordeum vulgare admixted excluded
214 WESTMINSTER Hordeum vulgare elite spring 2r S-2R +
215 WICKET Hordeum vulgare elite spring 2r S-2R +
216 WIDRE Hordeum vulgare admixted excluded
217 WIKINGETT Hordeum vulgare elite spring 2r S-2R +
218 WREN Hordeum vulgare admixted excluded +
219 Z91-103-21 Hordeum vulgare elite spring 2r S-2R +
220 CAJA Hordeum vulgare old spring 2r excluded
221 AAPO Hordeum vulgare old spring 2r excluded
222 ABACUS Hordeum vulgare admixted excluded
223 ABAVA Hordeum vulgare old spring 2r excluded
224 AKCENT Hordeum vulgare elite spring 2r S-2R
225 ALEXIS Hordeum vulgare elite spring 2r S-2R
226 ALIS Hordeum vulgare elite spring 2r S-2R
227 ALLIOT Hordeum vulgare elite spring 2r S-2R
228 ALVA Hordeum vulgare old spring 2r excluded
229 AMETYST Hordeum vulgare admixted excluded
230 ANLA Hordeum vulgare old spring 2r excluded
231 ANNI Hordeum vulgare admixted excluded
232 ANSIS Hordeum vulgare admixted excluded
233 APEX Hordeum vulgare admixted excluded
234 ARMELLE Hordeum vulgare admixted excluded
235 ARVO Hordeum vulgare old spring 2r excluded
236 ATHOS Hordeum vulgare admixted excluded
237 ATLAS Hordeum vulgare admixted excluded
238 ATRIBUT Hordeum vulgare elite spring 2r S-2R
239 AURIGA Hordeum vulgare elite spring 2r S-2R
240 BALDER Hordeum vulgare old spring 2r excluded
241 BALDER_J Hordeum vulgare old spring 2r excluded
242 BALGA Hordeum vulgare admixted excluded
243 BARABAS Hordeum vulgare elite spring 2r S-2R
244 BARKE Hordeum vulgare elite spring 2r S-2R
245 BARONESSE Hordeum vulgare admixted excluded
246 BERENICE Hordeum vulgare admixted excluded
247 BINDER Hordeum vulgare old spring 2r excluded
248 BIRGITTA Hordeum vulgare admixted excluded
249 BIRKA Hordeum vulgare old spring 2r excluded
250 BONUS Hordeum vulgare old spring 2r excluded
251 BRAEMAR Hordeum vulgare elite spring 2r S-2R +
252 BRAZIL Hordeum vulgare elite spring 2r S-2R +
253 BRITTA Hordeum vulgare old spring 2r excluded
254 CABARET Hordeum vulgare elite spring 2r S-2R
255 CALGARY Hordeum vulgare admixted excluded
256 CAMEO Hordeum vulgare admixted excluded
257 CAMINANT Hordeum vulgare elite spring 2r S-2R
258 CAMIR Hordeum vulgare admixted excluded
259 CARLSBERG Hordeum vulgare old spring 2r excluded
260 CARVILLA Hordeum vulgare old spring 2r excluded
261 CELLAR Hordeum vulgare elite spring 2r S-2R +
262 CEYLON Hordeum vulgare elite spring 2r S-2R
263 CHAMANT Hordeum vulgare elite spring 2r S-2R
264 CHERI Hordeum vulgare elite spring 2r S-2R
265 CICERO Hordeum vulgare elite spring 2r S-2R
![Page 30: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/30.jpg)
Page 30
266 CILLA Hordeum vulgare old spring 2r excluded
267 CLARET Hordeum vulgare admixted excluded
268 CLAUDE Hordeum vulgare elite spring 2r S-2R
269 CLEOPATRA Hordeum vulgare admixted excluded
270 COOPER Hordeum vulgare elite spring 2r S-2R +
271 CORGI Hordeum vulgare elite spring 2r S-2R
272 CRISTALIA Hordeum vulgare elite spring 2r S-2R
273 CROYDON Hordeum vulgare admixted excluded
274 DANDY Hordeum vulgare admixted excluded
275 DANUTA Hordeum vulgare elite spring 2r S-2R
276 DEBA_ABED Hordeum vulgare old spring 2r excluded
277 DELTA Hordeum vulgare old spring 2r excluded
278 DIALOG Hordeum vulgare admixted excluded
279 DIAMANT Hordeum vulgare admixted excluded
280 DIGERSANO_(NAKE
D)
Hordeum vulgare admixted excluded
281 DINA Hordeum vulgare admixted excluded
282 DOMEN Hordeum vulgare admixted excluded
283 DOUBLET Hordeum vulgare admixted excluded
284 DRAKE Hordeum vulgare admixted excluded
285 DROST Hordeum vulgare old spring 2r excluded
286 EGMONT Hordeum vulgare admixted excluded
287 ELANTRA Hordeum vulgare admixted excluded
288 ELO Hordeum vulgare admixted excluded
289 EMIR Hordeum vulgare old spring 2r excluded
290 ESME Hordeum vulgare admixted excluded
291 EUNOVA Hordeum vulgare admixted excluded
292 FAMIN Hordeum vulgare elite spring 2r S-2R
293 FAVORIT Hordeum vulgare admixted excluded
294 FELICITAS Hordeum vulgare elite spring 2r S-2R
295 FORMULA Hordeum vulgare admixted excluded
296 FORUM Hordeum vulgare admixted excluded
297 FREJA Hordeum vulgare admixted excluded
298 GALAN Hordeum vulgare elite spring 2r S-2R
299 GANT Hordeum vulgare admixted excluded
300 GATE Hordeum vulgare elite spring 2r S-2R
301 GERKRA Hordeum vulgare old spring 2r excluded
302 GITANE Hordeum vulgare admixted excluded
303 GIZMO Hordeum vulgare elite spring 2r S-2R
304 GOLDEN_PROMISE Hordeum vulgare old spring 2r excluded
305 GOLF Hordeum vulgare admixted excluded
306 GORM Hordeum vulgare old spring 2r excluded
307 GULL Hordeum vulgare old spring 2r excluded
308 Unknown 4 Hordeum vulgare admixted excluded +
309 HANA Hordeum vulgare admixted excluded
310 HANKA Hordeum vulgare elite spring 2r S-2R +
311 HANNA_(W273368) Hordeum vulgare old spring 2r excluded
312 HASSAN Hordeum vulgare old spring 2r excluded
313 HELLAS Hordeum vulgare old spring 2r excluded
314 HELMI Hordeum vulgare admixted excluded
315 HERIS Hordeum vulgare admixted excluded
316 HYDROGEN Hordeum vulgare elite spring 2r S-2R
317 IDA Hordeum vulgare old spring 2r excluded
318 IDUMEJA Hordeum vulgare admixted excluded
319 IMBER Hordeum vulgare old spring 2r excluded
![Page 31: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/31.jpg)
Page 31
320 IMIDIS Hordeum vulgare elite spring 2r S-2R
321 IMPALA Hordeum vulgare old spring 2r excluded
322 IMULA Hordeum vulgare admixted excluded
323 INARI Hordeum vulgare admixted excluded
324 INGRID Hordeum vulgare old spring 2r excluded
325 ISARIA Hordeum vulgare admixted excluded
326 JAREK Hordeum vulgare admixted excluded
327 DASIO Hordeum vulgare admixted excluded
328 KARAT-2 Hordeum vulgare admixted excluded
329 KARRI Hordeum vulgare old spring 2r excluded
330 KENIA Hordeum vulgare old spring 2r excluded
331 KEOPS Hordeum vulgare elite spring 2r S-2R
332 KORAL Hordeum vulgare admixted excluded
333 KRISTAPS Hordeum vulgare admixted excluded
334 KRONA Hordeum vulgare admixted excluded
335 KRYSTAL Hordeum vulgare admixted excluded
336 LADIK Hordeum vulgare elite spring 2r S-2R
337 LATVIJAS_VIETEJIE Hordeum vulgare admixted excluded
338 LEENI Hordeum vulgare elite spring 2r S-2R
339 LENTA Hordeum vulgare old spring 2r excluded
340 LINGA Hordeum vulgare old spring 2r excluded
341 LUD Hordeum vulgare admixted excluded
342 LUX Hordeum vulgare elite spring 2r S-2R
343 LYSIBA Hordeum vulgare admixted excluded
344 LYSIMAX Hordeum vulgare admixted excluded
345 MAJA Hordeum vulgare old spring 2r excluded
346 MALA Hordeum vulgare old spring 2r excluded
347 MALVA Hordeum vulgare admixted excluded
348 MARESI Hordeum vulgare elite spring 2r S-2R
349 MARIS_MINK Hordeum vulgare admixted excluded
350 MARS Hordeum vulgare admixted excluded
351 MARTHE Hordeum vulgare elite spring 2r S-2R
352 MAURITIA Hordeum vulgare elite spring 2r S-2R
353 DUCHESS Hordeum vulgare winter 2r W-2R
354 MELTAN-2 Hordeum vulgare admixted excluded
355 MENTOR Hordeum vulgare admixted excluded
356 MIDAS Hordeum vulgare admixted excluded
357 NATHALIE Hordeum vulgare elite spring 2r S-2R
358 NEMEX Hordeum vulgare old spring 2r excluded
359 NORDAL Hordeum vulgare old spring 2r excluded
360 NOVUM Hordeum vulgare admixted excluded
361 ODESSA Hordeum vulgare admixted excluded
362 OKOS Hordeum vulgare admixted excluded
363 ORBIT Hordeum vulgare admixted excluded
364 ORZA Hordeum vulgare admixted excluded
365 OTIS Hordeum vulgare admixted excluded
366 OTTO Hordeum vulgare admixted excluded
367 PALLAS Hordeum vulgare old spring 2r excluded
368 PALOMA Hordeum vulgare elite spring 2r S-2R
369 PASADENA Hordeum vulgare elite spring 2r S-2R
370 PERUN Hordeum vulgare admixted excluded
371 PRIEKULU_60 Hordeum vulgare old spring 2r excluded
372 PRIMUS Hordeum vulgare admixted excluded
373 PROCTOR Hordeum vulgare old spring 2r excluded
374 PROSA Hordeum vulgare admixted excluded
![Page 32: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/32.jpg)
Page 32
375 PUBLICAN-2 Hordeum vulgare elite spring 2r S-2R
376 QUARTZ Hordeum vulgare admixted excluded
377 QUENCH-2 Hordeum vulgare elite spring 2r S-2R
378 RAPID Hordeum vulgare admixted excluded
379 RASA Hordeum vulgare admixted excluded
380 RIKA Hordeum vulgare old spring 2r excluded
381 RIVIERA Hordeum vulgare admixted excluded
382 ROLAND Hordeum vulgare old spring 2r excluded
383 ROMI Hordeum vulgare old spring 2r excluded
384 ROXANA Hordeum vulgare elite spring 2r S-2R
385 RUBIN Hordeum vulgare elite spring 2r S-2R
386 RUJA Hordeum vulgare admixted excluded
387 RUPAL Hordeum vulgare old spring 2r excluded
388 SAANA Hordeum vulgare admixted excluded
389 SAFIR Hordeum vulgare admixted excluded
390 SALKA Hordeum vulgare old spring 2r excluded
391 SALVE Hordeum vulgare admixted excluded
392 SCARLETT-2 Hordeum vulgare admixted excluded
393 SENAT Hordeum vulgare old spring 2r excluded
394 SENCIS Hordeum vulgare admixted excluded
395 SIMBA Hordeum vulgare admixted excluded
396 SIMON Hordeum vulgare old spring 2r excluded
397 SMILLA Hordeum vulgare elite spring 2r S-2R
398 SPARTAN Hordeum vulgare admixted excluded
399 STATIC-2 Hordeum vulgare elite spring 2r S-2R
400 STEFFI Hordeum vulgare admixted excluded
401 STEINA Hordeum vulgare admixted excluded
402 STELLA Hordeum vulgare spring 6r excluded
403 STENDES Hordeum vulgare old spring 2r excluded
404 SULTAN Hordeum vulgare old spring 2r excluded
405 TARM92 Hordeum vulgare admixted excluded
406 TERNO Hordeum vulgare admixted excluded
407 THURINGIA Hordeum vulgare admixted excluded
408 TREMOIS Hordeum vulgare admixted excluded +
409 TRIUMPH-2 Hordeum vulgare elite spring 2r S-2R
410 TYRA Hordeum vulgare old spring 2r excluded
411 UNION Hordeum vulgare admixted excluded
412 URSEL Hordeum vulgare admixted excluded
413 VADA Hordeum vulgare admixted excluded
414 VALTICKY Hordeum vulgare admixted excluded
415 VANKKURI Hordeum vulgare old spring 2r excluded
416 VEGA Hordeum vulgare old spring 2r excluded
417 VIIVI Hordeum vulgare admixted excluded
418 VOLLA Hordeum vulgare admixted excluded
419 WELAM Hordeum vulgare old spring 2r excluded
420 WING Hordeum vulgare old spring 2r excluded
421 WISA Hordeum vulgare admixted excluded
422 ZENIT Hordeum vulgare admixted excluded
423 ZEPHYR Hordeum vulgare admixted excluded
424 HARRY Hordeum vulgare old spring 2r excluded
425 MONTANA Hordeum vulgare old spring 2r excluded
426 12337 ZH Hordeum vulgare winter 2r W-2R +
427 201157 A Hordeum vulgare elite spring 2r S-2R +
428 410/3E Hordeum vulgare winter 2r W-2R +
429 961374 Hordeum vulgare winter 2r W-2R +
![Page 33: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/33.jpg)
Page 33
430 AC 97-H2406-10 Hordeum vulgare winter 2r W-2R +
431 AC 99-077-2 Hordeum vulgare winter 2r W-2R +
432 ACTRICE Hordeum vulgare winter 2r W-2R +
433 ACCRUE Hordeum vulgare winter 2r W-2R +
434 ANGORA Hordeum vulgare winter 2r W-2R +
435 ANTELOPE Hordeum vulgare winter 2r W-2R +
436 ANTIGUA Hordeum vulgare winter 2r W-2R +
437 ANTONIA Hordeum vulgare winter 2r W-2R
438 ANVIL Hordeum vulgare winter 2r W-2R +
439 ARCHIMEDES Hordeum vulgare winter 2r W-2R +
440 ARTIST Hordeum vulgare winter 2r W-2R +
441 AVENUE Hordeum vulgare winter 2r W-2R +
442 AYANA Hordeum vulgare admixted excluded +
443 ALPHA Hordeum vulgare winter 6r excluded +
444 BARCELONA Hordeum vulgare winter 2r W-2R +
445 BATON Hordeum vulgare winter 2r W-2R +
446 BECKET Hordeum vulgare winter 2r W-2R +
447 BISTRO Hordeum vulgare winter 2r W-2R +
448 BLYTHE Hordeum vulgare winter 2r W-2R +
449 BOREALE Hordeum vulgare winter 2r W-2R +
450 BREEZE Hordeum vulgare winter 2r W-2R +
451 BRONZE Hordeum vulgare winter 2r W-2R +
452 CALCUTTA Hordeum vulgare winter 2r W-2R +
453 CALLIOPE Hordeum vulgare winter 2r W-2R
454 CAMION Hordeum vulgare winter 2r W-2R +
455 CAMPANILE Hordeum vulgare winter 2r W-2R +
456 CAMPION Hordeum vulgare winter 2r W-2R +
457 CANDY Hordeum vulgare winter 2r W-2R +
458 CANNOCK Hordeum vulgare winter 2r W-2R +
459 CAPTION Hordeum vulgare winter 2r W-2R +
460 CASSATA Hordeum vulgare winter 2r W-2R
461 CATHAY Hordeum vulgare winter 2r W-2R +
462 CEBECO 02215-05 Hordeum vulgare winter 2r W-2R +
463 CEDAR Hordeum vulgare winter 2r W-2R +
464 CELEBRITY Hordeum vulgare winter 2r W-2R +
465 CELLINA Hordeum vulgare admixted excluded +
466 CELSIUS Hordeum vulgare winter 2r W-2R +
467 CHAMOMILE Hordeum vulgare winter 2r W-2R +
468 CHARLESTON Hordeum vulgare winter 2r W-2R +
469 CHESTNUT Hordeum vulgare winter 2r W-2R +
470 CHICANE Hordeum vulgare admixted excluded +
471 CHINTZ Hordeum vulgare winter 2r W-2R +
472 CHORD Hordeum vulgare winter 2r W-2R +
473 CINNAMON Hordeum vulgare winter 2r W-2R +
474 CLARINE Hordeum vulgare winter 2r W-2R +
475 COBALT Hordeum vulgare winter 2r W-2R +
476 CONCEPT Hordeum vulgare winter 2r W-2R +
477 CONNOISSEUR Hordeum vulgare winter 2r W-2R +
478 CORIOLIS Hordeum vulgare winter 2r W-2R +
479 CPBT B20 Hordeum vulgare winter 2r W-2R +
480 CPBT B66 Hordeum vulgare winter 2r W-2R +
481 CPBT-B75 Hordeum vulgare elite spring 2r S-2R
482 CPBT B78 Hordeum vulgare winter 2r W-2R +
483 CREDO Hordeum vulgare winter 2r W-2R +
484 CRESCENDO Hordeum vulgare winter 2r W-2R +
![Page 34: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/34.jpg)
Page 34
485 TAMISE Hordeum vulgare elite spring 2r S-2R +
486 CWB 5663-1 Hordeum vulgare winter 2r W-2R +
487 CWB 97-6 Hordeum vulgare admixted excluded +
488 CYNTHIA Hordeum vulgare winter 2r W-2R +
489 CYPRESS Hordeum vulgare winter 2r W-2R +
490 CARSTEN-2-ROW Hordeum vulgare admixted excluded
491 DIAMOND Hordeum vulgare admixted excluded +
492 DIGBY Hordeum vulgare admixted excluded +
493 DOLPHIN Hordeum vulgare winter 2r W-2R +
494 DRUID Hordeum vulgare winter 2r W-2R +
495 EAGLE Hordeum vulgare winter 2r W-2R
496 ELECTRON Hordeum vulgare admixted excluded +
497 EMERAUDE Hordeum vulgare admixted excluded +
498 FAHRENHEIT Hordeum vulgare winter 2r W-2R +
499 FANFARE Hordeum vulgare winter 2r W-2R +
500 FARADAY Hordeum vulgare winter 2r W-2R +
501 FIGHTER Hordeum vulgare admixted excluded +
502 FIREFLY Hordeum vulgare winter 2r W-2R +
503 FLUTE Hordeum vulgare winter 2r W-2R +
504 FROLIC Hordeum vulgare admixted excluded +
505 GAZELLE Hordeum vulgare winter 2r W-2R +
506 GLINT Hordeum vulgare winter 2r W-2R +
507 GOLDMINE Hordeum vulgare winter 2r W-2R +
508 GOLDRUSH Hordeum vulgare winter 2r W-2R +
509 GYPSY Hordeum vulgare admixted excluded +
510 HAKA Hordeum vulgare winter 2r W-2R +
511 HALIFAX Hordeum vulgare winter 2r W-2R +
512 HANNA Hordeum vulgare admixted excluded +
513 HARLAND Hordeum vulgare winter 2r W-2R +
514 HARUNA-NIJO Hordeum vulgare admixted excluded
515 HELIGAN Hordeum vulgare winter 2r W-2R +
516 HERMIA Hordeum vulgare winter 2r W-2R +
517 HONEY Hordeum vulgare winter 2r W-2R +
518 HOUSTON Hordeum vulgare winter 2r W-2R +
519 HURRICANE Hordeum vulgare winter 2r W-2R +
520 Beauty Hordeum vulgare winter 2r W-2R +
521 IGRI Hordeum vulgare winter 2r W-2R +
522 IMOGEN Hordeum vulgare admixted excluded +
523 INTRO Hordeum vulgare winter 2r W-2R +
524 JESSICA Hordeum vulgare winter 2r W-2R +
525 JET Hordeum vulgare winter 2r W-2R +
526 JEWEL Hordeum vulgare winter 2r W-2R +
527 JONATHAN Hordeum vulgare winter 2r W-2R +
528 KARISMA Hordeum vulgare admixted excluded +
529 KESTREL Hordeum vulgare winter 2r W-2R +
530 KINGSTON Hordeum vulgare winter 2r W-2R +
531 KITE Hordeum vulgare winter 2r W-2R +
532 LABEA Hordeum vulgare winter 2r W-2R +
533 LAMBADA Hordeum vulgare winter 2r W-2R +
534 LARK Hordeum vulgare winter 2r W-2R +
535 LAUREL Hordeum vulgare winter 2r W-2R +
536 LOUISE Hordeum vulgare winter 2r W-2R
537 LP1124-8-98 Hordeum vulgare elite spring 2r S-2R
538 MADRIGAL Hordeum vulgare winter 2r W-2R +
539 MAGNOLIA Hordeum vulgare winter 2r W-2R
![Page 35: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/35.jpg)
Page 35
540 MAHOGANY Hordeum vulgare admixted excluded
541 MALWINTA Hordeum vulgare winter 2r W-2R +
542 MARINER Hordeum vulgare winter 2r W-2R +
543 MARITEM Hordeum vulgare winter 2r W-2R +
544 MASAI Hordeum vulgare winter 2r W-2R +
545 MASQUERADE Hordeum vulgare winter 2r W-2R +
546 MEAD Hordeum vulgare winter 2r W-2R +
547 MEDOC Hordeum vulgare winter 2r W-2R +
548 MELANIE Hordeum vulgare winter 2r W-2R +
549 MELUSINE Hordeum vulgare admixted excluded +
550 MERODE Hordeum vulgare winter 2r W-2R +
551 MHHX011 Hordeum vulgare winter 2r W-2R +
552 MILENA Hordeum vulgare winter 2r W-2R
553 MILLENA Hordeum vulgare admixted excluded
554 MOLLY Hordeum vulgare winter 2r W-2R +
555 MONTAGE Hordeum vulgare winter 2r W-2R +
556 MOONSHINE Hordeum vulgare winter 2r W-2R +
557 MORTIMER Hordeum vulgare winter 2r W-2R +
558 MUSETTE Hordeum vulgare winter 2r W-2R +
559 MYSTIQUE Hordeum vulgare winter 2r W-2R +
560 NECTARIA Hordeum vulgare winter 2r W-2R +
561 NOCTURNE Hordeum vulgare winter 2r W-2R +
562 INGMAR Hordeum vulgare elite spring 2r S-2R +
563 FLAMINA Hordeum vulgare winter 2r W-2R +
564 Belgravia Hordeum vulgare elite spring 2r S-2R +
565 NSL 97-6002 Hordeum vulgare winter 2r W-2R +
566 OPAL Hordeum vulgare winter 2r W-2R +
567 OUTLOOK Hordeum vulgare winter 2r W-2R
568 OXBRIDGE Hordeum vulgare elite spring 2r S-2R
569 PARASOL Hordeum vulgare admixted excluded +
570 PASTORAL Hordeum vulgare winter 2r W-2R +
571 PEARL Hordeum vulgare winter 2r W-2R +
572 PEDIGREE Hordeum vulgare winter 2r W-2R +
573 PERIDOT Hordeum vulgare winter 2r W-2R +
574 PILOT Hordeum vulgare admixted excluded +
575 PIPPA Hordeum vulgare admixted excluded
576 PORTRAIT Hordeum vulgare winter 2r W-2R +
577 POSAUNE Hordeum vulgare winter 2r W-2R
578 PRELUDE Hordeum vulgare winter 2r W-2R +
579 PUFFIN Hordeum vulgare winter 2r W-2R +
580 PUNCH Hordeum vulgare winter 2r W-2R +
581 PIONEER Hordeum vulgare admixted excluded
582 PIPKIN Hordeum vulgare admixted excluded
583 RATTLE Hordeum vulgare winter 2r W-2R +
584 RAVEL Hordeum vulgare winter 2r W-2R +
585 REGINA Hordeum vulgare old spring 2r excluded
586 RETRIEVER Hordeum vulgare winter 2r W-2R
587 RHYTHM Hordeum vulgare winter 2r W-2R +
588 RICARDA Hordeum vulgare admixted excluded +
589 RIFLE Hordeum vulgare winter 2r W-2R +
590 SAFFRON Hordeum vulgare winter 2r W-2R +
591 SAPPHIRE Hordeum vulgare admixted excluded +
592 SCYLLA Hordeum vulgare winter 2r W-2R +
593 SELECTION Hordeum vulgare winter 2r W-2R +
594 SERGEANT Hordeum vulgare admixted excluded
![Page 36: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/36.jpg)
Page 36
595 SEVILLA Hordeum vulgare winter 2r W-2R
596 SILVERSTONE Hordeum vulgare winter 2r W-2R +
597 SOMBRERO Hordeum vulgare winter 2r W-2R +
598 SONIC Hordeum vulgare winter 2r W-2R +
599 SONJA Hordeum vulgare winter 2r W-2R
600 SPECTRUM Hordeum vulgare winter 2r W-2R
601 SPICE Hordeum vulgare winter 2r W-2R +
602 SPINNER Hordeum vulgare winter 2r W-2R +
603 SPIRIT Hordeum vulgare winter 2r W-2R
604 STEEPLE Hordeum vulgare winter 2r W-2R
605 SUMO Hordeum vulgare winter 2r W-2R +
606 SUNRISE Hordeum vulgare winter 2r W-2R +
607 SW 165 Hordeum vulgare winter 2r W-2R +
608 SW ALISON Hordeum vulgare winter 2r W-2R +
609 SW FARRIER Hordeum vulgare winter 2r W-2R +
610 SW HILLARY Hordeum vulgare winter 2r W-2R +
611 SW NORMA Hordeum vulgare winter 2r W-2R +
612 SW-SIENNA Hordeum vulgare admixted excluded
613 SWALLOW Hordeum vulgare winter 2r W-2R +
614 SWIFT Hordeum vulgare winter 2r W-2R
615 TABETHA Hordeum vulgare winter 2r W-2R +
616 TALLICA Hordeum vulgare winter 2r W-2R +
617 TARGET Hordeum vulgare winter 2r W-2R +
618 TEMPO Hordeum vulgare admixted excluded
619 THALIA Hordeum vulgare winter 2r W-2R +
620 TIFFANY Hordeum vulgare admixted excluded +
621 TIPSTER Hordeum vulgare winter 2r W-2R +
622 TOFFEE Hordeum vulgare winter 2r W-2R +
623 TOKYO Hordeum vulgare admixted excluded +
624 TORRENT Hordeum vulgare admixted excluded +
625 TOSCA Hordeum vulgare winter 2r W-2R +
626 TUCKER Hordeum vulgare winter 2r W-2R +
627 TUDOR Hordeum vulgare admixted excluded +
628 TURINE Hordeum vulgare winter 2r W-2R +
629 TSCHERMAKS Hordeum vulgare admixted excluded
630 VANILLA Hordeum vulgare winter 2r W-2R
631 VILNA Hordeum vulgare winter 2r W-2R
632 VOLLEY Hordeum vulgare winter 2r W-2R +
633 WB 031031 Hordeum vulgare winter 2r W-2R +
634 WEAVER Hordeum vulgare winter 2r W-2R +
635 WHISPER Hordeum vulgare winter 2r W-2R
636 WIGWAM Hordeum vulgare winter 2r W-2R
637 WILLOW Hordeum vulgare winter 2r W-2R +
638 WINNER Hordeum vulgare elite spring 2r S-2R
639 WIZARD Hordeum vulgare winter 2r W-2R +
640 WOMBAT Hordeum vulgare winter 2r W-2R +
641 WINTMALT Hordeum vulgare winter 2r W-2R +
642 ZULU Hordeum vulgare winter 2r W-2R +
643 CLARA Hordeum vulgare winter 2r W-2R
644 FLAGON Hordeum vulgare winter 2r W-2R +
645 KIRA Hordeum vulgare winter 2r W-2R +
646 SCRI-S-0000638 Hordeum vulgare winter 2r W-2R
647 SCRI-S-0000658 Hordeum vulgare winter 2r W-2R
648 SCRI-S-0000687 Hordeum vulgare winter 2r W-2R
649 SCRI-S-0004248 Hordeum vulgare winter 2r W-2R
![Page 37: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/37.jpg)
Page 37
650 SCRI-S-04349 Hordeum vulgare winter 2r W-2R
651 SCRI-S-04351 Hordeum vulgare winter 2r W-2R
652 ACI Hordeum vulgare admixted excluded
653 AQUARELLE Hordeum vulgare winter 2r W-2R
654 PLAISANT Hordeum vulgare winter 6r excluded
655 PLATINE Hordeum vulgare winter 2r W-2R
656 PONENTE Hordeum vulgare winter 6r excluded
657 PRINCESS Hordeum vulgare winter 6r excluded
658 ROBUR Hordeum vulgare winter 6r excluded
659 SAIGON Hordeum vulgare winter 2r W-2R
660 SENTA Hordeum vulgare winter 6r excluded
661 SONJA-2 Hordeum vulgare admixted excluded
662 ARDA Hordeum vulgare winter 2r W-2R
663 SONORA Hordeum vulgare winter 6r excluded
664 SPRITE Hordeum vulgare winter 2r W-2R
665 TAPIR Hordeum vulgare admixted excluded
666 TARGET-2 Hordeum vulgare old spring 2r excluded
667 TEA Hordeum vulgare old spring 2r excluded
668 TIFFANY-2 Hordeum vulgare admixted excluded
669 TORRENT-2 Hordeum vulgare winter 6r excluded
670 TRASIMENO Hordeum vulgare winter 6r excluded
671 TREBBIA Hordeum vulgare old spring 2r excluded
672 TRIA Hordeum vulgare admixted excluded
673 VANESSA Hordeum vulgare old spring 2r excluded
674 VERTICALE Hordeum vulgare winter 2r W-2R
675 VICTORY Hordeum vulgare old spring 2r excluded
676 VOGELSANGER_GO
LD
Hordeum vulgare winter 6r excluded
677 ZACINTO (NAKED) Hordeum vulgare winter 2r W-2R
678 ZOE Hordeum vulgare winter 6r excluded
679 AGNETA Hordeum vulgare spring 6r excluded
680 ARMA Hordeum vulgare winter 6r excluded
681 AKKA_(W_6039) Hordeum vulgare admixted excluded
682 ASSO Hordeum vulgare admixted excluded
683 Unknown 1 Hordeum vulgare admixted excluded +
684 ARRA Hordeum vulgare spring 6r excluded
685 ARTTURI Hordeum vulgare spring 6r excluded
686 ASTRID Hordeum vulgare old spring 2r excluded
687 ASPLUND Hordeum vulgare spring 6r excluded
688 ATHENE Hordeum vulgare winter 6r excluded
689 AYDANHANIM Hordeum vulgare admixted excluded
690 Unknown 2 Hordeum vulgare spring 6r excluded +
691 BOTNIA Hordeum vulgare spring 6r excluded
692 EX178 Hordeum vulgare admixted excluded
693 BALAKI Hordeum vulgare winter 6r excluded
694 BALDA Hordeum vulgare winter 6r excluded
695 CLARA_(W5690) Hordeum vulgare old spring 2r excluded
696 AIACE Hordeum vulgare admixted excluded
697 BARAKA Hordeum vulgare winter 6r excluded
698 DIOMEDE Hordeum vulgare admixted excluded
699 CANORO Hordeum vulgare winter 6r excluded
700 DRUVIS Hordeum vulgare admixted excluded
701 EDDA Hordeum vulgare spring 6r excluded
702 EERO Hordeum vulgare spring 6r excluded
703 CARAT Hordeum vulgare winter 2r W-2R +
![Page 38: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/38.jpg)
Page 38
704 ERKKI Hordeum vulgare spring 6r excluded
705 CAROLA Hordeum vulgare winter 6r excluded
706 FRISIA Hordeum vulgare admixted excluded
707 HANKKIJA_673 Hordeum vulgare spring 6r excluded
708 CHESS Hordeum vulgare admixted excluded
709 HATIF_DE_GRIGNO
N
Hordeum vulgare admixted excluded
710 HERSE Hordeum vulgare spring 6r excluded
711 CLARA-2 Hordeum vulgare winter 2r W-2R
712 JADAR Hordeum vulgare admixted excluded
713 JARLE Hordeum vulgare spring 6r excluded
714 JYVÄ Hordeum vulgare admixted excluded
715 KAJSA Hordeum vulgare spring 6r excluded
716 KILTA Hordeum vulgare spring 6r excluded
717 AIRONE Hordeum vulgare admixted excluded
718 DEA Hordeum vulgare winter 6r excluded
719 DIADEM Hordeum vulgare winter 2r W-2R
720 LISE Hordeum vulgare spring 6r excluded
721 DOLMEN Hordeum vulgare winter 2r W-2R
722 MASKIN Hordeum vulgare spring 6r excluded
723 EX334 Hordeum vulgare old spring 2r excluded
724 TIPPLE-2 Hordeum vulgare elite spring 2r S-2R
725 DUET Hordeum vulgare admixted excluded
726 NIINA Hordeum vulgare spring 6r excluded
727 OLLI Hordeum vulgare admixted excluded
728 DURA Hordeum vulgare winter 6r excluded
729 OTRA Hordeum vulgare spring 6r excluded
730 PAAVO Hordeum vulgare admixted excluded
731 ESTEREL Hordeum vulgare winter 6r excluded
732 POHTO Hordeum vulgare admixted excluded
733 POKKO Hordeum vulgare spring 6r excluded
734 POMO Hordeum vulgare old spring 2r excluded
735 POTRA Hordeum vulgare spring 6r excluded
736 PRIORA_(NAKED) Hordeum vulgare admixted excluded
737 EXPRESS Hordeum vulgare winter 6r excluded
738 ROLFI Hordeum vulgare old spring 2r excluded
739 RONDO_(NAKED) Hordeum vulgare admixted excluded
740 FANFARE-2 Hordeum vulgare winter 2r W-2R
741 ALCE Hordeum vulgare admixted excluded
742 FEDERAL Hordeum vulgare winter 6r excluded
743 SILJA Hordeum vulgare spring 6r excluded
744 SUVI Hordeum vulgare admixted excluded
745 TAMMI Hordeum vulgare spring 6r excluded
746 TEELE Hordeum vulgare spring 6r excluded
747 TEEMU Hordeum vulgare spring 6r excluded
748 FINESSE Hordeum vulgare winter 2r W-2R
749 TELLUS_(W_5897) Hordeum vulgare old spring 2r excluded
750 TIDONE Hordeum vulgare admixted excluded
751 FRANKA Hordeum vulgare winter 6r excluded
752 VAIROGS Hordeum vulgare spring 6r excluded
753 VARDE Hordeum vulgare spring 6r excluded
754 FRIDERICUS Hordeum vulgare winter 6r excluded
755 FROST Hordeum vulgare winter 6r excluded
756 STEPTOE Hordeum vulgare admixted excluded
757 MOREX Hordeum vulgare admixted excluded +
![Page 39: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/39.jpg)
Page 39
758 GERBEL Hordeum vulgare winter 6r excluded
759 GLEAM Hordeum vulgare winter 2r W-2R
760 GLENAN Hordeum vulgare winter 6r excluded
761 GRETE Hordeum vulgare winter 6r excluded
762 ALDEBARAN Hordeum vulgare winter 6r excluded
763 HALCYON Hordeum vulgare admixted excluded
764 HASSO Hordeum vulgare winter 6r excluded
765 HELIGAN-2 Hordeum vulgare winter 2r W-2R
766 HEREFORDIA Hordeum vulgare winter 6r excluded
767 HOPPEL Hordeum vulgare winter 6r excluded
768 ISA Hordeum vulgare winter 6r excluded
769 JAIDOR Hordeum vulgare admixted excluded
770 KASKADE Hordeum vulgare admixted excluded
771 ALFEO Hordeum vulgare winter 2r W-2R
772 KELIBIA Hordeum vulgare winter 2r W-2R
773 KETOS Hordeum vulgare winter 6r excluded
774 LAVERDA Hordeum vulgare winter 6r excluded
775 LEONIE Hordeum vulgare winter 2r W-2R
776 LONNI Hordeum vulgare winter 6r excluded
777 LORENA Hordeum vulgare winter 6r excluded
778 LUDMILLA Hordeum vulgare winter 2r W-2R
779 LUTECE Hordeum vulgare winter 6r excluded
780 ALISEO Hordeum vulgare admixted excluded
781 MALTA Hordeum vulgare admixted excluded
782 MANITOU Hordeum vulgare winter 6r excluded
783 MANOLIA Hordeum vulgare winter 6r excluded
784 MARADO Hordeum vulgare winter 6r excluded
785 MARINKA Hordeum vulgare admixted excluded
786 MARIS OTTER Hordeum vulgare winter 2r W-2R
787 MARIS TROJAN Hordeum vulgare winter 2r W-2R
788 MATTINA Hordeum vulgare winter 6r excluded
789 AMILLIS Hordeum vulgare admixted excluded
790 MIRCO Hordeum vulgare winter 6r excluded
791 MIRRA Hordeum vulgare winter 6r excluded
792 MURCIE Hordeum vulgare winter 2r W-2R
793 MUSCAT Hordeum vulgare winter 6r excluded
794 NAOMIE Hordeum vulgare winter 6r excluded
795 NURE Hordeum vulgare admixted excluded +
796 ONICE Hordeum vulgare admixted excluded
797 OPAL-2 Hordeum vulgare winter 2r W-2R
798 OSIRIS Hordeum vulgare admixted excluded
799 PANDA Hordeum vulgare admixted excluded
800 PASSPORT Hordeum vulgare winter 6r excluded
801 PATRICIA Hordeum vulgare winter 6r excluded
802 PILASTRO Hordeum vulgare admixted excluded
803 PIRATE Hordeum vulgare winter 6r excluded
804 PIRKKA Hordeum vulgare spring 6r excluded
![Page 40: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/40.jpg)
Page 40
Supplementary Table 8: Regions under strong divergent selection (Fst > 0.9).
chromosome
genetic interval in
MxB population
(cM)
Putative
locus
1H 90.29-93.06 PPD-H2*
2H 57.43-62.46 EPS-2
2H 97.38-97.38 ?*
2H 117.99-120.96 ?*
3H 17.35-17.35 ?*
3H 116.36-116.99 DENSO*
4H 107.36-114.94 VRN-H2
5H 95-95 FR-2
5H 121.25-152.36 VRN-H1
* not cloned
![Page 41: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/41.jpg)
Page 41
Supplementary Table 9: Analyses of variance for Days to Heading (DtH), Grain yield
(Yield) and Thousand grain weight (Tgw) traits.
Supplementary Table 9: Analyses of variance for Days to Heading (DtH), Grain yield (Yield)
and Thousand grain weight (Tgw) traits. Genotypic effects are partitioned using marker
alleles at the four main loci regulating barley phenology segregating in the Nure X Tremois
mapping population
Trait Source of variation d.f. Sum of squares R2 Mean squares Variance ratio p -Value -Log(p )
DtH Total 1338 1888858.7
Environment 12 1872542.0 99.14 156045.2 29232.9 <0.001 >>100
Genotype 102 9783.0 0.52 95.9 18.0 <0.001 177.3
Ppd-H2 1 814.7 8.33 814.7 34.3 <0.001 7.6
Eam6 1 6479.5 66.23 6479.5 273.2 <0.001 30.2
Vrn-H2 1 54.7 0.56 54.7 2.3 0.083 1.1
Vrn-H1 1 109.6 1.12 109.6 4.6 0.019 1.7
Residual G 98 2324.6 23.76 23.7 4.4 <0.001 33.7
Residual 1224 6533.7 0.35 5.3
Yield Total 1338 3771.0
Environment 12 3297.7 87.45 274.8 830.7 <0.001 >100
Genotype 102 68.5 1.82 0.7 2.0 <0.001 6.1
Ppd-H2 1 2.7 3.94 2.7 5.9 0.009 2.0
Eam6 1 20.2 29.49 20.2 43.9 <0.001 9.2
Vrn-H2 1 0.5 0.73 0.5 1.1 0.222 0.7
Vrn-H1 1 0.1 0.07 0.1 0.2 0.948 0.0
Residual G 98 45.1 65.84 0.5 1.4 0.127 0.9
Residual 1224 404.9 10.74 0.3
Tgw Total 1025 46017.2
Environment 9 35287.6 76.68 3920.8 720.8 <0.001 >100
Genotype 102 5758.1 12.51 56.5 10.4 <0.001 95.1
Ppd-H2 1 34.2 0.59 34.2 1.7 0.134 0.9
Eam6 1 3681.7 63.94 3681.7 178.8 <0.001 23.8
Vrn-H2 1 14.8 0.26 14.8 0.7 0.328 0.5
Vrn-H1 1 9.6 0.17 9.6 1.8 0.124 0.9
Residual G 98 2017.8 35.04 20.6 3.8 <0.001 24.3
Residual 914 4971.5 10.80 5.4
![Page 42: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/42.jpg)
Page 42
Supplementary Table 10 Characterisation of putative mat-c mutants
We obtained seed for 29 of 31 putative mat-c mutants available in the Nordgen Genebank. For two of these, we had no wild type seed for comparison so they
were not considered further. In 2011 DNA was isolated from germinating seedlings of all 27 remaining accessions. 10 independent accessions were
line Putative MAT-C mutants line idwild type
days to flower (2011)
relative to wild type:
sowing 1/5/2011 s.e.
days to flower (2012)
relative to wild type:
sowing 15/5/2012 s.e.
mutation event: 1978 bp sequenced
including 376 bp upstream (promotor +
enhancer region) and 633 bp downstream comments
WT bonus 73 59
WT foma 73 59
WT kristina No parental seed
WT semira - 58
WT Sv Vg74233 No parental seed
1 mat-c.32 bonus -5.50 0.16 - - non conservative aa change
2 mat-c.93 bonus -3.69 0.63 - - non conservative aa change
3 mat-c.94 bonus -9.11 0.26 -8.30 0.18 splice site
4 mat-c.770 bonus -7.25 0.36 - - alternative transcription start site?
5 mat-c.907 bonus -8.81 0.50 - - non conservative aa change
6 mat-c.913 bonus -4.63 0.42 - - non conservative aa change
7 mat-c.943 bonus -6.25 0.58 - - non conservative aa change
8 mat-c.966 bonus -7.25 0.60 - - non conservative aa change
9 mat-c.400 foma -6.50 0.54 - - non conservative aa change
10 mat-c.1114 foma -8.93 0.61 - - splice site
11 mat-c.16 bonus - - -4.38 0.38 none detected
12 mat-c.19 bonus - - -3.75 0.31 none detected
13 mat-c.758 bonus - - -0.32 0.20 none detected Does not show early flowering phenotype
14 mat-c.760 bonus - - -2.46 0.47 none detected Weak phenotype: flowering < 3 days earlier relative to wild type
15 mat-c.865 bonus - - -2.25 0.87 none detected Weak phenotype: flowering < 3 days earlier relative to wild type
16 mat-c.881 bonus - - -2.08 0.56 ATG 436 bp outside the CDS Weak phenotype: flowering < 3 days earlier relative to wild type
17 mat-c.910 bonus - - 0.25 0.32 none detected Does not show early flowering phenotype
18 mat-c.926 bonus -0.13 0.56 none detected Does not show early flowering phenotype
19 mat-c.101 foma - - -0.03 0.22 none detected Does not show early flowering phenotype
20 mat-c.122 foma - - -0.25 0.44 none detected Distinct phenotype - Short plants and large amount of secondary tillers.
Not early flowering
21 mat-c.1107 foma - - -5.90 0.55 none detected
22 mat-c.1108 foma - - -6.38 0.55 none detected
23 mat-c.1109 foma - - -5.90 0.61 single bp deletion
24 mat-c.1115 foma - - -7.00 0.37 non conservative aa change
25 mat-c.1102 semira - - -7.10 0.61 template didnt amplify from genomic DNA Distinct phenotype. Extreme mutant lines - Shorter than c.94. Very low
internode number per tiller and extremelly short spike.
26 mat-c.1118 semira - - -8.93 0.67 template didnt amplify from genomic DNA Distinct phenotype. Extreme mutant lines - Shorter than c.94. Very low
internode number per tiller and extremelly short spike.
27 mat-c.1120 semira - - -5.80 0.60 template didnt amplify from genomic DNA Distinct phenotype. Extreme mutant lines - Shorter than c.94. Very low
internode number per tiller and extremelly short spike.
28 mat-c.745 Kristina - - - - ND No wild type seed available
29 mat-c.1091 Sv Vg74233 - - - - ND No wild type seed available
30 mat-c.1111 - - - - ND No seed available
31 mat-c.1096 - - - - ND No seed available
![Page 43: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/43.jpg)
Page 43
identified that harboured mutations and these were phenotyped for flowering time. The data for these lines is given in Figure 3b, main text. The remainder
were not considered further in 2011. In 2012 multiple individuals from the 17 accessions not considered in 2011 (plus controls) were subsequently grown for
phenotypic and genotypic analysis. For eleven no mutations were detected. Of these, seven flowered less then 2.5 days earlier than wild type and were not
considered early flowering mutants while four accessions remain classified as early flowering. One accession (mat-c 881) had a mutation downstream of the
coding region but also flowered <2.5 days earlier than WT and was not classified as early flowering. Of the remaining five accessions, two were
heterogeneous for flowering time (mat-c1109 and mat-c1115) (i.e. early flowering clearly segregated in different seed from a single accession).
Resequencing HvCEN in the early flowering individuals identified a 1bp deletion (mat-c 1109) and a non-conservative amino acid change (mat-c 1115) in
these accessions. For the last three accessions (mat-c 1102, 1118 and 1120) we were unable to amplify HvCEN. However amplifications from their parental
line was successful suggesting these lines putatively contained deletions of the entire locus. Interestingly, all three had a distinct morphological phenotype in
addition to being early flowering. Therefore, in summary 15 of the 27 mutants examined contained lesions that were associated with early flowering. 8 of
the 27 flowered within 2.5 days of their parental lines, did not contain mutations and were re-classified as WT for MAT-C. For the remaining 4 of the 27 early
flowering lines we failed to detect any lesions in the resequenced amplicons. Thus we identified lesions in 15 out of 19 early flowering and putative MAT-C
mutants.
![Page 44: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/44.jpg)
Page 44
Supplementary Table 12: Haplotypes observed in germplasm surveyed.
Hap_I CACTATTTGCCCGC
Hap_II ..T.G..AT...C.
Hap_III ..T.G.........
Hap_IV ..T.G..AT.T.C.
Hap_V ..T.G......T..
Hap_VI ..T.G..AT...CT
Hap_VII .........T....
Hap_VIII ..TCG.........
Hap_IX ..T.G.......C.
Hap_X ..T.GC......C.
Hap_XI .GT.G..AT...C.
Hap_XII G.T.G.........
Hap_XIII ..T.G.C.....C.
Supplementary Table 12: Haplotypes observed in germplasm surveyed. SNP positions in the
657bp fragment are: 48 – 50 – 63 – 65 – 93 – 119 – 177 – 229 – 252 – 271 – 390 – 498 –
531 (Pro-135-Ala) – 599. SNPs in coding regions are highlighted in red. The Nure C,
Pro/Tremois G, Ala– SNP (P135A) is highlighted in red and bold. Only this SNP in the
coding region (last exon of HvCEN) led to an amino acid change (P135A). Haplotypes
harboring Pro-135 (CCT) are II, IV, VI, IX, X, XI and XIII. Haplotypes I, III, V, VII, VIII and
XII harbor Ala-135 (GCT).
![Page 45: Supplementary Note: Detailed information · 2012-12-11 · Page 1 Supplementary Note: Detailed information Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed](https://reader035.vdocument.in/reader035/viewer/2022070811/5f0a345f7e708231d42a8482/html5/thumbnails/45.jpg)
Page 45
Supplementary Table 13: Nucleotide state at alignment position 531 (P135A: Pro-135
(CCT) /Ala-135 (GCT)) for Triticeae species.
Nure (total seven barley haplotypes) vs. Tremois (total: six barley haplotypes) C -> G
Nure vs. Triticum urartu C -> C
Nure vs. Aegilops speltoides C -> C
Nure vs. Aegilops tauschii C -> C
Nure vs. Aegilops bicornis C -> C
Nure vs. Aegilops longissima C -> C
Nure vs. Aegilops sharonenis C -> C
Nure vs. Aegilops searsii C -> C
Nure vs. Aegilops markgrafii C -> C
Nure vs. Aegilops umbellulata C -> C
Nure vs. Triticum boeoticum C -> C
Nure vs. Triticum monococcum C -> C
Nure vs. Triticum aestivum genome A C -> C
Nure vs. Triticum aestivum genome B C -> C
Nure vs. Triticum aestivum genome D C -> C
Nure vs. Hordeum murinum ssp. glaucum C -> C
Nure vs. Hordeum californicum C -> C
Nure vs. Hordeum cordobense C -> C
Nure vs. Secale cereale C -> C