-
The Cleavage Mode of the Cre Recombinase
A.C. Shaikh
A thesis submitted in conformity with the requirements for the Degree of Doctor of Philosophy
Graduate Department of Molecular and Medical Genetics University of Toronto
O Copyright by A.C. Shaikh, 2000.
-
National Library I*I of Canada Biblioîhdque nationale du Canada Acquisitions and Acquisitions et Bibliographie Services services bbliographiques 395 Wellington Street 395. nre Wdlington OrmwaON K l A W CRtawaON K 1 A W canada canada
The authar has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sell copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fkom it may be printed or othenvise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, preter, distribuer ou vendre des copies de cette thèse sous la fome de microfiche/film, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
-
A.C. Shaikh The Cleavage Mode of the Cre Recombinase Doctor of Philosophy 2000 Graduate Department of Molecular and Medical Genetics University of Toronto
Abstract
The Cre protein, encoded by the bacteriophage P 1, and the Flp protein,
encoded by the 2 p M plasmid found in budding yeast, belong to the fntegrase family
of site-specific recombinases. Cre and Flp recombinases each bind specifically to
recombination targets comprised of inverted repeats of their cognate DNA binding
sites, the lox and FRT syrnmetry elements, respectively, that flank a central 8 bp
spacer region. Like al1 integrases, both recombinases cleave one strand of the target
site through a nucleophilic attack of the scissile phosphate by a conserved catalytic
tyrosine residue. Cleavage generates a covalent attachrnent of the tyrosine to the 3'-
phosphate and a free S'-OH end. Association of two recombinase-bound target sites
that have been cleaved into a synaptic complex provides the framework for the
exchange of the crossing (cleaved) strands. The 3'-covalent linkage is subsequently
destroyed by the nucleophilic attack of the incoming %end and the DNA strands
made continuous through a recombinase-mediated Iigation that results in the
formation of a Holliday intermediate. This Holliday junction is resolved into linear
DNA products through a second set of recombinase-mediated cleavages, strand
exchanges and ligations.
-
An important issue in the chemistry of the recombination reaction is the
location of the recombinase molecole that provides the catalytic nucleophile in the
synapse. The mode of cleavage by a recombinase has been denoted as either
occumng in cis, where the cleaving monomer is bound adjacent to the scissile
phosphate. or in tram, where the cleaving monomer is bound elsewhere in the
synaptic cornplex. Studies of a number of integrases have shown that the LInt and
XerC/D proteins cleave in CU, while the Flp recombinase cleaves in t r m s .
1 used half-site complementation to show that Cre cleaves its lox target site in
trans. Following publication of this report, the crystal structure of the Cre synapse
showed cis-cleavage by Cre. To resolve this discrepancy and to answer whether my
use of conditionally active sites and Cre proteins biased the results in favor of tram-
cleavage. 1 constructed novel recombinases, Fre and Clp. that were functional
chimeras of the Cre and Flp proteins. 1 showed that these chimenc proteins had
altered binding specificities compared to their respective native recombinase and
designed novel specific target sites for these chimeric proteins. 1 used hybrid
recombination sites that combined the target sites of a chimeric and native
recombinase to test the mode of cleavage by Cre and Flp in conditions that did not
exclude either cis- or tram-cleavage from occumng. 1 found that consistent with
previous reports, Cre cleaved in cis and Flp cleaved in ms .
-
Table of Contents
Page
Abstract
Table of Contents
List of Figures
List of Tables
List of Abbreviations
Chapter 1 General Introduction.
1. Introduction
2. Consewative Site-Specific Recombination
a) The Resolvuse/l~tvertase Family
b) The Integrme Family
3. Biological Role of Cre Recombinase
4. The Cre Recombinase
5. The fox Target Site
6. Biological Role of Flp Recombinase
7. The Flp Recombinase
ii
iv
vii
X
xi
-
8. The FRT Target Site
9. Steps in Cre- and Flp-Mediated Recombination
a) DNA Binding
i. Model of Cre Interaction with the lox Site
ü. Model of Flp Interaction with the FRT Site
b) DNA Bending
c) Strand Cleavage
d ) Synupsis
e ) Ligation und Strond Exchange
f) Resolution
IO. Thesis Outline 1-44
Chapter II The Cre Recombinase Cleaves the lox Site in T m .
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
11-2
11-3
II- 14
11-24
-
Chapter III Cis- and Trans-Cleavage Modes of Cre and Flp Recombinases Using Functional Chimeras of Cre and Flp.
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
Chapter IV Discussion and Future Experiments.
1. Discussion
2. Future Experiments
References
-
List of Figures
Figure Page
1-1. The effect of general and site specific recombination on Pl plasrnid maintenance.
1-2. Peptide maps of Cre and Flp recom binase.
1-3. The Cre recombinase.
1-4. The lox and FRT target sites.
1-5. The 2 pM plasmid of Saccharomyces cerevisiae.
1-6. Steps in Cre-mediated recom bination.
1-7. Models of binding of Cre to the lox site.
1-8. Tertiary structure mode1 of binding of Cre to the lox site.
1-9. Model of binding of P X and P l 3 peptides of Flp to the FRT site.
1-10. Mode1 of the asymmetry of bending and cleavage witbin a Cre dimer.
1-1 1 Cleavage modes between recombining sites.
1-12. Conformatioas of the eatalytic domains within a Cre dimer.
1-13. Cross-core and synaptic interfaces within a Cre synapse.
- vi i -
-
I l The lox sites used in this study. 11-29
11-2. Covalent attacbment of various Cre proteins to the X25 haif-site, 11-31
11-3. Rationale of the complementation test. II-33
11-4. Trans-complementation by Cre and CreHis. 11-35
11-5. Effect of unlabeled competitor on binding by Cree II-37
1 Influence of full-lox site on cleavage of half-fox site by Cre proteins.
11-7. Assembly of synaptic complexes from half-lox sites.
11-8. Assem bly of synaptic complexes from full- and half-lox sites.
111-1. Complementation tests of the mode of cleavage using hybrid target sites and cbimeric proteins.
111-2. Peptide maps of proteins used in this study and the purification of Fre and Clp.
111-3. The lox- and FRT-based substrates used in this study.
111-4. Binding of Cre- and Flp-derived proteins to the ArkZ su bstrate.
111-5. Binding of Cre- and Flp-derived proteins to the lox and FRT substrates.
111-6. Binding of Cre- and Flp-derived proteias to the ArkP su bstrate.
- viii -
-
111-7. Binding of Cre- and Flpderived proteins to the ArkF substrate.
111-8. Binding of Cre- and Flpderived proteins to the ArkL su bstrate.
111-9. Covalent attachment of Cre and Fre to the ArkP substrate.
111-10. Covalent attachment of Cre and Clp to the ArkF su bstrate. 111-62
111-1 1. Covalent attachment of Flp and Fre to the ArkL su bstrate. UI-64
111-12. Conformations of the catalytic domains in the Cre-Fre mixed dimeric cornplex. In-66
111-13. Conformations of the catalytic domains in the Cre-Clp mixed dimeric cornplex. 111-68
III-14. Conformations of the catalytic domains in the Flp-Fre mixed dimeric cornpiex. 111-70
-
List of Tables
Table
11-1. Cornparison of the activities of Cre and CreHis on the half-sites.
Page
-
List of Abbreviations
bp: base pair(s)
nt : nucleotide(s)
kbp : kilobase pairs
PCR : polymerase chain reaction
kDa : kiloDalton
SDS : sodium dodecyl sulphate
PAGE : polyacrylamide gel electrophoresis
BSA : bovine serum albumin
Note : The nomenclature of mutant proteins is defmed as follows: the number o f the
amino acid in the protein sequence is flanked on the lefi side by a single letter that
specifies the arnino acid present in the wild-type protein and on the right side by a
single letter that designates the amino acid introduced by mutation. For example,
Y324C means that the tyrosine normally present at position 324 in the protein has
been replaced by a cysteine.
-
Chapter 1
General Introduction.
-
The integrase family of conservative site-specific recombinases includes the
Cre protein of the bacteriophage Pl and the Flp protein of the 2 p M plasmid of
Saccharomyces cerevisiae (Blakely and Sherratt, 1996, Nunes-Düby et al., 1998).
The Cre protein resolves multimers of the Pl plasmid that &se fiom general
recombination, thereby ensuring faithfbl partition of the plasmid in the lysogenic life
cycie of the phage (Austin et al., 199 1). Flp is involved in the maintenance of the 2
pM plasmid in yeast by facilitating a plasmid amplification (Futcher, 1986).
A remarkable degree of sirnilarity exists between the Cre and Flp systems. The
compact target sites coupled with the lack of requirement for accessory DNA or
protein components make both proteins ideal for engineering controlled and accurate
rearrangernents of DNA in higher eukaryotic systems (Golic. 199 1, Sauer and
Henderson, 1990, Sadowski, 1993, 1995).
In this chapter, I begin with reviews of conservative site-specific
recombination systems. A more detailed account of the Cre and Flp systems follows
with particular emphasis on Cre since it constitutes the primary focus in Chapters II
and III of this thesis.
-
2. Conse ~ a t i v e Site-Specific Recombina tion
Conservative site-specific recombinases are involved in a number of biological
processes including facilitation of the stability of bacterial replicons (Austin et al.,
1 99 1 ), plasmid amplification (Futcher, l986), integration and excision of
bacteriophagr chromosomes (Landy, 1989), altemating expression of different sets of
genes (Van de Pune and Goosen, 1992) and the resolution of linked CO-integrate
structures (Shenatt, 1989, Stark et al., 1992). These recombinases are characterized
by the formation of covalent protein-DNA complexes upon DNA strand cleavage by
the recombinase. The formation of this covalent intermediate is analogous to a DNA-
topoisomerase reaction where the energy of the phosphodiester bond is conserved in
the protein-DNA linkage for a subsequent protein-mediated rejoining of DNA strands
(Sadowski, 1993). As a result, conservative site-specific recombinases require no net
input of fkee energy for activity. A conservative site-specific recombination event
involves two reciprocal strand cleavage and rejoining events which occur with no
gain or loss of nucleotides (hence, "conservative"). Unlike general recombination
processes, strand exchange by conservative site-specific recombinases requires
relatively little sequence homology between the two recombining DNAs. The
minimal target site of a conservative site-specific recombinase contains two inverted
recombinase-binding sites. These sites flank the sites of cleavage across which strand
exchange occurs. Some target sites include binding sites for accessory proteins
-
- 1 4 -
required for recombination (Van de Putte and Goosen, 1992, Sadowski, 1993).
Conservative site-specific recombinases are divided into two categories by
sequence homology and shared chemistry of the recombination process. The
resolvase/invertase family includes the Tn3 type resolvases and the GinRiin
invertases (Stark et al., 1992, Van de Putte and Goosen, 1992). The second family is
the integrase farnily typified by the archetypical Int protein fkom phage A and the Cre
and Flp recombinases (Landy, 1993, Sadowski, 1995).
a) The Resolvasdnvertase Family
The resolvase/invertase farnily mernben are exempli fied by the Tn3, Tn2 1,
Tn552 and the y 6 resolvases, and the Gin and Hin invertases (Stark et al., 1992).
Members of this class either resolve CO-integrate DNA structures that result from
transposition or alter the expression of genes through an inversion of a DNA segment
(Van de Pune and Goosen, 1992). The members share only 13% overall protein
sequence identity. The members of the resolvase subclass exhibit 30% identity and
invertases have a 60% sequence similarity (Stark et al., 1992, Van de Putte and
Goosen, 1992). Additiondly, the resolvases c m be divided further based on protein
sequence homology and target site consensus. The Tn3 and y6 resolvases can be
differentiated from the resolvases in Tn2 1 and Tn552 transposons (Stark et al., 1992).
-
- 1-5 -
The memben of these subclasses are able to fùnctionally substitute for recombinases
belonging to the same group (Stark et ai., 1992). Similarly, members of the invertase
sub-family are functionally interchangeable (Van de Putte and Goosen, 1992).
Resolvases bind to a res site that is comprised of three similar sub-sites. each
of them a specific binding site for the recombinase. Site 1 is the locus of the DNA
cross-over event and sites II and III facilitate the assembly of a protein-DNA structure
that is required for recombination (Stark et al.. 1992: Soultanas and Halford, 1995).
Invertase-mediated recombination is initiated by the binding of the invertase protein
to specific inverted repeats of DNA. This is followed by the assembly of an
"invertasorne" complex in which a recombinational enhancer DNA element in cis is
occupied by an accessory protein FIS (Factor for Inversion Stimulation) and forms a
multi-protein-DNA complex with the invertase-bound DNA (Van de Putte and
Goosen? 1992. Stark et al., 1992).
The recombinase-DNA complexes are assembled into higher order synaptic
complexes through protein-protein and protein-DNA interactions (Stark et aL , 1992).
In this synaptosome, the recombinase cleaves al1 four DNA strands through double
strand breaks in the DNA. The resulting DNA ends have a two nucleotide protrusion
at the 3'-OH end and a recessed S'-phosphate end that is covalently attached to a
-
-1-6-
conserved serine residue of the recombinase. This phosphoserine linkage is
subsequently ligated to the 3'-OH end of the DNA break in a protein-dependent
manner (Stark et al., 1992). Strand exchange proceeds through the two base pair
overlap region of the DNA break and is thought to be facilitated by protein-mediated
DNA-DNA interactions between the recombining sites in the higher order complex
that rotates one pair of DNA ends through t 80° (Rice and Steitz, 1994, Yang and
Steitz, 1995). Therefore, in addition to being responsible for the chemistry of the
recombination process, the recombinase acts also in the formation and stabilization of
the protein-DNA scaffold where the actual exchange of strands between two
recombining sites occurs.
Resolvases and invertases have strict topological requirements. Substrates
must be supercoiled and the target sites must be arranged on the substrate in a specific
orientation (Stark et al., 1992). Presumably, an additional function of the higher
order assembly is to discem the synapsis topology required for efficient
recombination. Consistent with their function to resolve CO-integrates, resolvases
require their sites to be in direct orientation (Stark et al., 1992). Similarly, as the
invertases catalyze an inversion of DNA segments, the target sites must be in an
inverted orientation with respect to each other (Van de Putte and Goosen, 1992).
-
b) The Integrase Family
The integrase family of conservative site-specific recombinases contains over
100 member (Nunes-Duby et al., 1998). The best characterized members include the
Int protein fiom phage A, the Cre protein fiom bacteriophage P l , the XerC and XerD
proteins of Escherichia coli and the Flp protein from budding yeast. Recombinases
of this type bind specifically to DNA target sites that flank a central cross-over
region. The integrase binding sites are arranged as inverted repeats around the strand
exchange region. However, the complexity of the target site varies with respect to the
organization and location of the binding sites and the inclusion of additional binding
sites for accessory proteins that are required for some integrase-mediated
recombination reactions (Sadowski, 1993, 1995).
Through protein-protein and protein-DNA interactions, integrases assemble a
higher order synaptic complex where the actual exchange of strands occurs. In
contrast to the resolvase/invertase farnily of proteins, the integrases cany out
recombination through two sequential sets of reactions that consist of protein-
mediated events of cleavage, strand exchange and ligation. The fint leads to the
formation of a Holliday intermediate and the second resolves this X-structure to give
recombinant products. The hallmark of an integrase-type reaction is a protein-
mediated cleavage event of one strand of the target site that generates a covalent
-
- 1-8 -
attachent of the protein to the 3'-phosphate and free S'-OH (Sadowski, 1993). The
first strand exchange event proceeds across a 6 to 8 base pair spacer region and is
driven by a nucleophilic attack of the fiee S'-OH end of one cleaved target site to the
3'-covalent linkage at the nick of the partner site. The second set of resolution
reactions also proceeds in a similar protein-dependent fashion (Guo et al., 1997,
Sadowski, 1993,1995).
Some integrases, Iike AInt and the XerC/D proteins, have a specific topology
requirement for recombination (Stark et ai., 1992, Arciszewska and Sherratt, 1995),
while others, such as Cre and Flp, do not (Sadowski, 1993). Integrases cm carry out
both inter- and intra-motecular recombination events. Recombinase-mediated intra-
molecular excision events are accomplished with directly onentated sites and
inversion of DNA segments occur when the sites are inversely orientated (Landy,
1993, Sadowski, 1993).
Members of the integrase fàmily of conservative site-specific recombinases
differ greatly in their amino acid sequence. Despite this, the recent crystal structures
of ÀInt, XerD, HP 1 and Cre proteins (Kwan et al., 1997, Hickman et al., 1997,
Subramanya et al., 1997, Guo et al., 1997, Gopaul and Van Duyne, 1999, Nunes-
Düby et al., 1998) show that the core structure of the COOH-terminal domains of
-
- 1-9 -
these proteins is structurally conserved. In fact, al1 integrase members contain four
absolutely conserved residues that are involved in catalyzing the breaking and
rejoining of DNA strands (Nunes-Düby et al., 1998). In Cre, these residues are
Arg173, His, 289, Arg292 and Tyr324. Each of these residues has been assigned
functions in the recombination pathway through various biochemical studies of
different integrases. Mutation of these residues in an integrase abolishes both in vivo
and in vitro recombination. Alteration of the Arg173 residue in Cre gives a cleavage
defective phenotype (Gopaul et al. , 1998). The equivalent Arg 173 position in Flp has
been found to be critical for strand ligation and is implicated in protein binding to the
target site (Friesen and Sadowski, 1992, Abremski and Hoess, 1992). Both His289
and Arg292 are important in activating the scissile bond for cleavage and ligation
(Prasad el al., 1987. Parsons et al., 1988, Zhu and Sadowski. 1995). The tyrosine
residue is the main catalytic actor involved in the strand cleavage that leads to a
covalent intermediate with the DNA (Evans et al., 1990, Chen et al., 1992). In
addition, a cornparison of the protein sequence of a number of integrase-type proteins
reveals that a small40-50 amino acid region in the COOH-terminal domains of these
proteins is somewhat conserved (about 30%, Nunes-Düby et al., 1998). Coupled
with the presence of the conserved residues in this region and the apparent structural
conservation in the COOH-terminal portions of the solved integrases, this result
emphasizes that a cornmon motif is employed in the catalytic domains of integrase
-
As this thesis is primarily concemed with the Cre and Flp recombinases, 1
focus on these proteins in the following sections, with particular emphasis on the Cre
system.
3. Biological Role of Cre Recombinase
Lysogenic bacteriophage P 1 exists as a circular DNA molecule and is present
in its Escherichia coli host in one or two copies per cell. Even with such a smail copy
number. c u h g of the host cells carrying the P 1 plasmid is rare (Austin et al. 198 1 ).
Wihen the P 1 plasmid is duplicated during replication, general recombination between
the newly replicated P 1 plasmid and the original P 1 plasmid may lead to a dimer of
the P 1 plasmid. This dimer plasmid cannot be equally partitioned during ce11 division
and as a result, only one daughter ce11 will contain a copy o f the Pl plasmid (Austin et
al., 198 1 ), as depicted in Figure 1- 1 a. This curing occurs in only 1 in 10 000 cells,
indicating that an efficient process ensuring effective Pl partitioning is involved.
One component of this mechanism involves the Cre-fox recombination system. As
shown in Figure 1- 1 b, dimeric P 1 DNA can be separated into single copies of P 1
DNA by the action of Cre at its target lox sites present in P 1 DNA. These can be
faithfully partitioned between daughter cells during ce11 division.
-
4. The Cre Recombinase
The Cre recombination system consists of the Cre protein and its cognate
target site, l m , with no ancillary DNA sequences or protein factors. The Cre gene of
the Pl plasmid encodes a 343 arnino acid protein with a predicted molecular weight
of 38.5 kDa (Abremski and Hoess, 1984). As a member of the integase farnily of
site-specific recombinases, Cre accomplishes recombination through four absolutely
conserved catalytic residues: Argl72, His289, k g 2 9 2 and Tyr324.
The Cre protein can be partially proteolyzed into two discrete peptides: a 13.5
kDa NHz-terminal peptide, Cre 13, and a 25 kDa COOH-terminal peptide, Cre25
(Hoess et al., 1990). The Cre 13 domain contains the fmt 1 1 8 arnino acid residues of
Cre, while the remainder of the protein resides in the larger COOH-terminal fragment
(Figure 1-2a). The secondary structure assignent of the Cre recombinase h m the
crystal structure of a Cre synaptic complex shows that this proteolytic division in the
protein occurs in the middle of the E helix (amino acid residues 11 1-126) (Figure 1-3)
(Guo el al., 1997). It is important to note that the division of the NH,- and COOH-
terminal domains of Cre in this assignment occun at amino acid residue 130 in the
intervening region between the E and F helices. However, the original designation of
the NH,- and COOH-terminal domains of Cre was used in developing recombinantly-
derived Cre peptides, in subsequent assays of their activity (Hoess et al., 1990, M.Sc.
-
- 1-12 -
Thesis, A.C. Shaikh-1997) and in the construction of the Cre and Flp chimeras
presented in Chapter III. Therefore, unless otherwise noted, the amino acid 1 18-1 19
dividing mark will be used here in denoting the two portions of the Cre protein.
Cre25 contains al1 four integrase catalytic residues. The COOH-terminal
peptide retains binding specificity for the lox target site. but is deficient in al1 other
steps of the recombination process (Hoess et al., 1990, M.Sc. Thesis, A.C. Shaikh-
1 997). The NH2-terminal domain of Cre shows no activity at al1 in biochemical
assays, but in combination with the COOH-terminal peptide, a Crel3-dependent
stimulation of Cre25 activities is observed in vitro (M.Sc. Thesis, A.C. Shaikh-1997).
The DNA sequences encoding each of the peptides of Cre have been separately
cloned and the peptides purified from a recombinant source (Hoess et al., 1990.
M.Sc. Thesis, A.C. Shaikh-1997).
5. The lox Target Site
The lox site (Figure Ma) is the cognate DNA target site for the Cre
recombinase and is present as a single copy in the Pl plasmid. The 34 base pair site
consists of two identical 13 base pair inverted repeats, the lox symmetry elements.
that are separated by an A-T nch, 8 base pair core region (Hoess and Abremski,
1984). Each symmetry element is a specific site for Cre binding and thus, a fully
-
- 1-13 -
occupied lox site has two monomers of Cre bound to it. Cre binding to the lux site
occurs with high affinity and is highly CO-operative (Hoess and Abremski, 1984.
Ringrose et al., 1998, Guo et al., 1997). (A more detailed description of the
interaction of Cre with its target site is presented in Section 9a : i.)
The only asymmetry in the fox site is present in the core and may be
responsible for the bias in bottom strand cleavage and exchanges observed with Cre
(Hoess et al.? 1987). Cre-mediated cleavage occurs on each strand of the core, one
base pair away from the core-symmetry element junction. Hence, the effective cross-
over region between two synapsed lox sites in a Cre-mediated recombination event is
6 base pairs (Hoess et al., 1987). Cleavage by Cre at the scissile bond generates a
covalent attachment of the conserved tyrosine to the 3'-phosphate and a fiee 5'-OH
end. Recent evidence has shown that in addition to facilitating the interaction with
the NH,-terminal region of the Cre protein, the sequence of the core region was
integral in the recombination process. The first two positions on the right side of the
lox core were essential for the generation of the Holliday intermediate in the first
strand exchange reaction, while the remaining four positions at the left side of the
core were required for the resolution step (Lee and Saito, 1998).
In vitro, Cre does not require supercoiling of the substrate, and is equally
-
- 1-14 -
capable of catalyzing both inversion and excision-type reactions. In addition, Cre
functions eficiently in both inter- and intra-molecular recombination events (Hoess
and Abremski, 1990, Sadowski, 1993).
6. Biological Roie of Flp Recombinase
About 100 copies of an autonomously replicating plasmid, the 2 p M plasmid.
exist in most strains of Sacchromyces cerevisioe yeast (Sadowski, 1995). While the
plasmid confers no apparent advantage to its host, it is highly stable. The 2 pM
plasmid is diagramed in Figure 1-5 and is a circular double stranded DNA of 63 18 bp
in size. Two 599 bp inverted repeats serve to divide the plasmid into two regions'
Large (L) and Small (S). A total of five known open reading fiames exist within
these two regions. Rep 1 and Raf are the products encoded by their respective genes
in L. while Rep2 and the largest coding sequence, Flp are present in S. The fifth
open reading frame has no known assigned gene product associated with it. The
ongin of replication, (Ori), contains an ARS (autonomous replicating sequence) at the
junction of one of the inverted repeats and the L region of the plasmid. This Ori
region is activated only once dunng the ce11 cycle. Two isofonns of the plasmid
exist, the A and B form. Removal of the open reading h e , Flp, or the removal of
inverted repeat sequences, prevented the switch from one isofonn to another. Further
investigation by Broach et al., (1 WU), showed that Flp-mediated recombination was
-
- 1-15 -
site-specific and occurred within a 65 bp region of the 599 bp inverted repeats of the
plasmid. This region was later termed the FRT site (Flp Recognition Target,
McLeod et al., 1986).
The Futcher mode1 explains the role of Flp in 2 p M plasmid amplification.
Briefly, Flp-rnediated recombination between the inverted repeats facilitates multiple
rounds of 2 FM replication fiom one firing of the Ori region in the plasmid. This
amplification generates a multimeric fom of the 2 p M plasmid which is resolved into
single copies of the plasmid by further action by the Flp recombinase (Sadowski,
1995. Futcher. 1986).
7. The Flp Recombinase
The largest open reading h e in the 2 PM plasmid is the Flp gene, which
encodes a 423 arnino acid protein with a predicted molecular weight of 45 kDa. Like
al1 integrases, Flp contains four absolutely conserved catalytic residues: Argl9 1.
His3 05. Arg308 and Tyr343. A Flp-mediated recombination event requires no
accessory proteins or CO-factors in vitro (Sadowski, 1995).
Flp can be divided into two distinct domains through a carefully regulated
digestion of the intact protein with Proteinase K (Pan et al., 199 1). A 13 kDa , NH,-
-
- 1-16 -
terminal peptide, P l 3, and a 32 kDa, COOH-terminal peptide, P32, are generated by
this process (Figure 1-2b). A 2 1 Da, COOH-terminai fiagrnent results fiom further
digestions of the P32 peptide. Both of these COOH-terminal fragments of Flp retain
the DNA binding specificity of the intact protein and include al1 four of the catalytic
residues (Pan et al., 199 1 ). P32 additionally has cleavage and ligation activity and
can also resolve Holliday intermediates. However, the COOH-terminal peptide of Flp
is incapable of full recombination (M.Sc. Thesis, A.C. Shaikh- 1997, Pan et al., 199 1 ).
The smaller P 13 fragment of Flp is thought to have a weak non-specific DNA
binding activity, but no other catalytic activities (M.Sc. Thesis, A.C. Shaikh-1997,
Pan and Sadowski, 1993% Panigrahi and Sadowski, 1994). Combination of Pl3 with
the COOH-terminal peptide effects a stimulation of P32-dependent activities (M.Sc.
Thesis, A.C. Shaikh-1997). The DNA sequences encoding each of the peptides of
Flp have been separately cloned and the peptides purified fiom a recombinant source
(M.Sc. Thesis, A C Shaikh- 1997).
8. The FRT Target Site
The 48 base pair Flp Recognition Target (FRT) site is present in each inverted
repeat of the 2 FM plasmid (Broach el al., 1982, Meyer-Leon et al., 1984). The 8
base pair core region is flanked by three symrnetry elements, a, b, c (Figure 1-4b).
Each element is 13 base pairs long and is the site of binding for one Flp monomer
-
- 1-17 -
(Andrews et al., 1987). Hence, a filled FRT site has three Flp monomers bound to it.
(A more detailed description of the interaction of Flp with its target site is presented
in Section 9a : ii.) Symmetry elements a and b are inverted repeats that are separated
by an 8 bp core region and differ fiom each other at a position one base pair away
from the core-symrnetry element junction. Elements b and c are directly oriented
with respect to each other. As element c has been shown to be dispensable in both NI
vivo and in vitro Flp-mediated reactions (Proteau et al., 1986, Sadowski, 1995). most
DNA substrates used in assays of Flp recombination lack this third symmetry element.
Hence, the minimal FRT site is analogous in both size and organization to the lox
target site of the Cre recombinase system. The FRT core region is A-T rich and the
site has two poly-pyrimidine tracts, one on each DNA strand, that radiate fiom the
core into the symmetry elements. While important for recombination? the exact role
of these tracts is not known (Sadowski, 1995). The major asyrnmetry in the FRT site
occurs in the core region and it is believed that this sequence asymmetry influences
the directionality of the recombination reaction by directing parallel alignment of two
recombining FRT sites (Huffman and Levene, 1999).
Flp-mediated recombination between two paired FRT sites commences with
concerted cleavages at the core-symmetry element junctions on both sides of the core.
A Flp cleavage event establishes a 3'-phosphotyrosine covalent linkage between the
-
- 1-18 - 3'- phosphoryl end of the scissile phosphodiester bond and the conserved tyrosine
residue of the cleaving protein. Flp-mediated strand exchange occurs between the 8
base pair core regions of the two recombining FRT sites. Flp is competent in both
inter- and intra-molecular recombination reactions and can perfonn both inversion
and excision reactions (Sadowski, 1995, H u h a n and Levene, 1999).
9. Steps in Cre- and Flp-Mediated Recombination
The use of purified Cre and Flp proteins in a variety of in vitro assays has been
instrumental in dissecting the entire recornbination process of these two recombinases
into distinct steps. Both Cre and Flp have been found to act similarly in some of
these steps and coupled with the shared chemistry and the similarity in their
respective target sites, a working mode1 of Cre- and Flp-mediated recombination has
evolved (Figure 1-6). The recent crystal structures of Cre-DNA complexes (Guo et
al.. 1997, 1999, Gopaul et al., 1998) also provide a structural insight to the
recombination reaction as a whole. In the following section, steps in the Cre-
mediated recombination pathway will be described with references to the Flp system
where warranted.
-
a) DNA Binding
Both Cre and Flp bind their cognate lox and FRT sites, respectively, in a
sequence-specific manner with hi& affinity. Flp has been observed to bind the FRT
site in an ordered fashion by occupying the b element first, then the a, and finally the
c site. The step-wise binding of Flp to the FRT site results in three distinct protein-
DNA complexes that c m be detected in non-denaturing polyacrylamide gels
(Andrews et al., 1987, Beatty and Sadowski, 1988). The high cooperativity of
binding observed between Cre monomers makes defïning the order of Cre binding to
the lox site difficult (Hoess et ai., 1984, Ringrose et al., 1998). As with Flp, the
binding of one and two Cre monomers to the site can be detected by non-denahiring
PAGE (Hoess and Abremski, 1984, Wierzbicki et al., 1987). Footprinting studies of
fülly-bound lox and FRT sites have shown that both Cre and Flp completely cover
their respective target sites (Andrews et al., 1987, Hoess et a/. , 1990). Both Cre and
Flp can generate higher order complexes with their target sites that represent the
assembly of more than one protein-bound target site. These synaptic complexes are
dependent on protein-protein and protein-DNA interactions and are essential
components of the recombination process (Amin et al., 1990, 1 99 1, Hoess et al.,
1990, Wierzbicki et al., 1987). The first crystal structure of the Cre recombinase was
of a Cre synapse (Guo et al., 1997).
-
- 1-20 -
A more detailed description of the interaction of Cre and Flp with their
respective cognate sites follows.
i. Mode1 of Cre Interaction with the lox Site
Examining a monomer Cre-DNA complex with the neocarzinotatin chernical
probe, Hoess and Abremski (1 984) demonstrated that the entire 13 base pairs of the
Zox symmetry element and the first 4 positions of the core region were protected by
Cre. Therefore, two Cre monomers bound to the lox site would in effect cover the
entire target site. Later hydroxy-radical footprinthg studies of Cre and Cre25 dimer
complexes showed that while Cre protected the entire site, the protection afforded by
the smaller COOH-terminal Cre peptide was limited to the syrnmetry elements alone
(Hoess et al.. 1990). The difference in the protection pattern suggested that the NHZ-
terminai region of Cre was positioned over the fox core region. 1 did footprinting
studies with a single lox element-containing substrate to compare the binding of Cre
and the Cre25 peptide (M.Sc. Thesis, A.C. Shaikh-1997). Contacts in the 4 base pair
region just proximal to the core-element junction were found to be important for
binding of intact Cre, but not the COOH-terminal peptide. This observation divided
the lox site into a 4 base pair NH,-terminal binding region, the core-proximal site, and
a 9 base pair COOH-terminal binding region, the core-distal site. The division and
organization of the iox site into discrete binding regions for the two dornains of the
-
- 1-2 1 -
Cre protein were analogous to the designation of similar binding elements in the FRT
site for the NH2- and COOH-terminal regions of Flp (Panigrahi and Sadowski, 1994,
see next section).
Since the substrate that 1 used contained only a single symmetry element,
which was bound by a single monomer of Cre, the differences in the positioning of
the domains of Cre suggest that conformational changes in the Cre protein are
induced by communication between adjacently bound Cre monomers that reposition
the NH,- and COOH-terminal domains of Cre over the lox site.
The initial interaction between a Cre monomer and the site involves the
placement of the NH,- and COOH-terminal domains of Cre over the core-proximal
and core-distal elements of the lox site, respectively. Protein-protein interactions
between Cre monomers bound across the core of the lox site appears to induce a
conformational change in the protein that extends the Cre25 and Crel3 domains over
the core-proximal and core regions, respectively. as suggested by the footprinting
assays done by Hoess et ai., (1990)(M.Sc. Thesis, A.C. ShaiWi- 1997). Evidence for
such an alteration in the Flp protein has also been documented (Panigrahi and
Sadowski, 1994). Furthemore, 1 have hypothesized that the stimulatory effects of
Cre 1 3 and P 13 on COOH-terminal domain activities are the result of conformational
-
- 1-22 -
changes in the COOH-terminal domains of Cre and Flp that are induced by the NH,-
terminal domains (M.Sc. Thesis, A C . Shaikh- 1997).
The crystal structure of the Cre synaptic complex (Guo et al., 1997) provides
support for the mode1 presented above. In the structure, contacts are observed
behveen COOH-tenninal domain residues and the entire lox symrnetry element and
the first 2 base pairs of the core region in both the major and minor grooves of the
DNA. In addition, the NH,-terminal B and D helices are arranged over both the core-
proximal and core-regions of the fox site with three direct contacts to two major
grooves of the DNA. The crystal structure illustrates drarnatic protein-protein
interactions between Cre monomers in the synapse. The NHZ-terminal A and E
helices of opposing Cre monomers bound at the same lox site or between paired lox
sites form cross-core and synaptic interfaces in the synapse. The combination of both
cross-core and synaptic interfaces generates a network of protein-protein interactions
between the NH,-termini of the monomers in the synapse. In addition, the COOH-
terminal N helix is donated between Cre monomers in the synapse to form another set
of cross-core and synaptic interfaces (Guo et al., 1997). These protein-protein
interactions may effect a conformational change in the bound Cre monomers and
reposition the NH,- and COOH-terminal domains of the protein over the target site.
The cartoon in Figure 1-7 is a composite view depicting the interaction of the NH2-
-
and COOH-terminal domains of Cre with the lox site. as suggested fkom the
biochemical data and the crystal structure.
Of the five helices in the NH2-terminal dornain of Cre, only the B and D
helices contact the DNA directly in the major groove. A third helix. E, comprises the
interface region between Cre monomers dong with the A helix (Guo et al., 1997).
The E helix of a cleaving monomer of Cre is positioned over the core region where it
interacts with the phosphates of the bent DNA backbone and forms a cross-core
interface. Asyrnmetry in the Cre dirner is evident with the position of the E helix of
the non-cleaving monomer, as it is organized between the synapsed lox sites in the
structure and forms a synaptic interface.
The COOH-terminal domain of Cre is comprised of nine helices and five P
strands and makes the most contacts with lox site, as would be expected for the
primaty binding determinant of the protein. The helices, P strands and bop regions
of this domain interact with the major and minor grooves of the DNA, as well as the
DNA backbone (Guo et al , 1997, 1999, Gopaul el al., 1998). The J helix makes the
only direct major groove contact of the COOH-terminal domain, between kg259 and
a guanine base one position to the lefi of the margin of the core proximal-core distal
regions. Surprisingly, most of the direct contacts with the DNA occur in the minor
-
- 1-24 -
groove (Guo et ai., 1997). The f3 sheet between the 1 and J helices forms three
contacts with the DNA, while the looped region between the J and K helices rnakes
one. Interestingly, an absolutely conserved lysine residue (Cao and Hayes, 1999),
Lys201 in Cre, is present in the loop region between P strands 2 and 3 and makes two
direct minor groove contacts to the positions at either side of the core-symrnetry
element junction (Guo et al., 1997). It has been postulated that this consenred lysine
is another catalytic residue (Cao and Hayes, 1999). The overall effect of the
interacting domains of Cre is that the entire lox symmetry element DNA is enveloped
by Cre in a clamp-like fashion (Figure 1-8), with additional electrostatic interactions
behveen Cre and the DNA adding to the stability of the entire protein-DNA complex
(Guo et ai., 1 997, 1 999).
ii. Mode1 of Flp Interaction with the FRT Site
The interactions of Flp with the FRT site have been studied by such methods
as nuclease footprinting, methylation protection and interference, mutational analysis
of the FRT site and UV cross-linking of Flp and its peptides to the target site. These
types of experiments showed that Flp protected the entire FRT site and contacted both
the major and minor grooves of each symmetry element (Andrews et al.. 1985, Beatty
and Sadowski, 1 988, Panigrahi et ai., 1992). At present, there is no crystallographic
data for the Flp/FRT interaction of the type which is available for the Cre/iox
-
- 1-25 -
interaction. Pan and Sadowski (l993a) showed that the COOH-terminal peptide P32
bound specifically to the FRT site while P l 3 exhibited only weak non-specific
binding. Cross-linking studies of the Flp peptides to a single FRT element showed
that the P32 peptide contacted the outer 9 base pairs of the symrnetry element, the
core-distal region, while the NH2-terminal domain of Flp cross-linked solely to the
core- proximal site, the fmt 4 base pairs of the symmetry element directly adjacent to
the FRT core (Panigrahi and Sadowski, 1994). Combined reactions. containing both
the P 13 and P32 peptides in the same cross-linking assays, demonstrated that P 13
stimulated cross-linking of P32 to the core-distal site and extended the P32 cross-
linking region to the include the core-proximal site as well (Panigrahi and Sadowksi,
1994). These results were extended to the mode1 shown in Figure 1-9, where the P 13
and P32 peptides separately contact their respective core-proximal and core-distal
sites in the FRT element. The interaction of the two domains of Flp induces a
conformational change in the COOH-terminal peptide that rearranges the domain
over the entire 13 bp of the syrnmetry element (Panigrahi and Sadowski, 1994, M.Sc.
Thesis, A.C. Shaikh- 1997).
Mutational analysis of the FRT site also demonstrated that positions in both
the core-proximal and core-distal regions of the FRT element were important for Flp
binding. Alterations at any of the fint three positions of the core-proximal region of
-
- 1-26 -
the FRT a element resulted in a drarnatic reduction of Flp binding and Flp-mediated
recornbination (Senecoff et d, 1988). In the core-distai region of the FRT element, a
change in the guanine base of the bottom strand of the FRT b element, two positions
to the lefi of the core-proximal - core-distal junction, has been shown to reduce Flp binding to the site (Senecoff et al., 1988). While the interaction behveen specific
residues of Flp and certain base positions of the FRT element have yet to be
detennined, the conserved lysine residue in Flp (Lys2231 may rnake direct contacts
with the DNA in the core-distal region of the FRT site, just as the equivalent residue
in Cre does with the lox site (Guo et al., 1997). Indeed, the sirnilar organization of
the binding elements in the lox and FRT sites and the interacting domains of Cre and
Flp coupled with the structural conservation observed in the crystal structures of the
solved integrase members, suggest that the interaction of Flp with the FRT site should
be analogous to the Cre-lox interface (Guo et al., 1997, Gopaul and Van Duyne,
1999).
b) DNA Bending
Both Cre and Flp induce bends in their target sites upon binding DNA
(Schwartz and Sadowski, 1990, Guo et al, 1997). Circular permutation experiments
were used to deduce that Flp generates three distinct bends in the FRT site (Schwartz
-
- 1-27 -
and Sadowski, 1990). Binding of a Flp monomer to a FRT symmetry element forms
a type 1 bend of 60'. A type II bend of greater than 144" results fiom cross-core
interactions between two Flp monomers bound to FRT symmetry elements a and b of
the same site. Finally, protein-protein interactions between Flp monomers bound to
elements b and c generate the least characterized type 111 bend (Schwartz and
Sadowski, 1989, IWO) . Flp bending of the FRT site is independent of synapsis and
through a number of elegant studies utilizing cyclic permutation gel shifl assays,
Leutke and Sadowski (1995) determined that the center of the FLP-induced type II
bend was located in the center of the FRT core region.
The various crystal structures of Cre-DNA complexes provide a definite
description of Cre-induced bending in the lox site. Upon binding the l m symmetry
element. a slight 25" bend is formed in the site that does not alter the structure of the
DNA appreciably (Guo et al., 1997, 1999). However, the entire Cre synaptic
cornplex demonstrates a severe 10ZO bend that is located in the center of the paired fox
sites and this arranges the synapsed sites into a square planar isomer of a Holliday
j unction.
A closer examination of the Cre-induced bend in the fox site reveals that the
deformation in the DNA is a result of a kink in core region generated mostly by
-
- 1-28 -
interactions between amino acid residues in both the m- and COOH-terminal regions of Cre and the sugar-phosphate backbone of the DNA (Guo et al., 1999).
These contacts serve to expose T-A and G-C steps in the core region to the solvent
which in mm facilitates water-mediated interactions with Cre residues that fiirther
stabilize the bent protein-DNA complex (Guo et al, 1997, 1999). In addition, the
bend in the DNA forces a compression of the minor groove and opening of the major
groove towards the center of the lox site. Within synapsed sites where cleavage has
occurred, this effects a separation of the DNA strands in the core region leaving the
5' OH DNA end of the crossing strand un-stacked and positioned for sirand uptake.
The continuous strand and the 3'-covalent linkage remain stabilized by both protein-
phosphate interactions and the interface between the Cre monomers (Guo et al., 1997,
1999).
The asymrnetry in the bend direction correlates to the asyrnmetry of cleavage
within a Cre dimer. The strand cleaved by Cre and exchanged in later stages of the
recombination reaction is at the opposite end of the core from the Cre-induced kink in
the DNA (Guo et al., 1997, 1999). That is to Say, if the kink occurs at the left side of
the Zox core region, Cre-mediated cleavage is predisposed to the occur at the scissile
bond at the right side of the core and vice versa (Figure 1-10). Hence, the asyrnmetry
in the bend location is either involved in activating the opposite cleavage site or
-
- 1-29 -
inactivating the adjacent scissile phosphate (or both). However, the exact
determinants in the protein-DNA complex that impose the bending directionality are
st il1 unknown (Guo et al., 1 999).
The role of bending in Cre- and Flp-mediated recombination has been inferred
h m the Crellox crystallographic structures and documented by a number of
biochemical studies. Firstly, the CO-crystal structures of Cre and lox illustrate that the
DNA strands in the crosssver region are separated to position the crossing strand for
a strand exchange event, while at the sarne time the continuous, un-cleaved strands
are fixed in the synaptic complex. Hence, the Cre-induced bend in the lox sites favors
the exchange of incoming S'-OH DNA ends. In the Flp system, DNA bending is
thought to facilitate the separation of DNA strands in the core region (Zhu and
Sadow-ski, 1998) and just as in the Cre system, the protein-induced bend may prevent
straight re-ligation of the cleaved strand and favor strand exchange.
The establishment of the type 11 bend appears to be critical for successful Flp-
mediated recombination. Flp variants defective in this type of bend and the P32
peptide which forms only a type 1 bend, are al1 defective in recombination (Leutke
and Sadowski, 1995, Schwartz and Sadowski, 1990, Kulpa et al., 1993). While less
characterized in this respect, the Cre system shows similar phenotypes with regards to
-
- 1-30 -
bending defects. A Cre variant, G3 14R, is the equivalent Cre protein to a known Flp
variant with a bending defect, G328R (Schwartz and Sadowski, 1989). This altered
Cre protein is defective in cleavage, synapsis and recombination, but can be
complemented in m n s by another Cre variant, Y324C. that is also defective in
cleavage, synapsis and recombination, to restore the fint two catalytic activities (A.C.
Shaikh, unpublished results). As this is the sarne phenotype observed with Flp
G328R (Dixon et al., 1995), this Cre variant may represent a putative bending-
de ficient Cre protein. Sirnilarly, because of the parallels between the COOH-terminal
domains of Cre and Flp, the inactivity of Cre25 in recombination may be because the
smaller COOH-terminal fiagrnent cannot induce the bend that is necessary to permit
recombination (Hoess et al., 1990, M-Sc. Thesis, A C Shaikh- 1997).
In addition to describing the bend generated in the target site, the crystal
structure of the Cre synapse implies a relationship between the bending activity of
Cre and the activities of cleavage and synaptic complex formation. Introduction of a
4 bp bulge on one of the strands in the core of the site is thought to bend the FRT site.
This bulge stimulates cleavage of the strand in which it resides. In fact, a bending-
and cleavage- defective Flp variant (W60S) is able to cleave the bulged substrate (Lee
et a/. , 1997). Similar experiments using bulged lox substrates and Cre have shown
similar results (Lee et al., 1997, Guo et al., 1997) indicating that bending of the DNA
-
- 1-3 1 -
site influences protein-mediated cleavage. While some bending defective venions of
Cre and Flp are also defective in cleavage, some bending defective Flp variants, such
as Flp TA232 and the P32 peptide, are still able to cleave (Amin and Sadowski, 1990,
MSc. Thesis, A.C. Shaikh-1997).
The Cre-induced bend in the target site occurs without cleavage of the site. as
co-crystal structures of catalytically inactive Cre variants also show a similar bending
of the DNA to that present in structures generated with wild type Cre (Guo et al.,
1999). However, a number of Cre variants that are defective in cleavage activity and
synaptic complex formation (Cre A36V, T4 1 F, G3 14R) can be complemented in
tram by a cleavage-defective, bending-competent Cre variant (Y324C) to restore
cleavage activity and synaptic complex formation (Wieabicki et al., 1987, A.C.
Shaikh. unpublished results, Guo et ab , 1999). A possible explanation is that the Cre
Y324C provides the bend in a mixed protein-DNA complex that allows the putative
bending-deficient Cre variant to cleave.
C) Strond Cleavage
The main catalytic activity of Cre and Flp is the breakage and rejoining of
DNA strands. As integrases, both proteins establish a covalent linkage between the
conserved tyrosine residue (Cre Y324, Flp Y343) of their respective COOH-terminal
-
- 1-32 -
domains and the 3'-phosphate at the cleavage site (Sadowski, 1995) through a
nucleophilic attack of the aromatic hydroxyl of the tyrosine residue on the DNA
backbone (Evans et al., 1990, Gronostajski and Sadowski, 1985). The covalent
intermediate is analogous to those found in topoisornerase systems as the energy of
the scissile bond is conserved for a later protein-mediated rejoining of DNA strands
(Landy, 1993, Sadowskil 1995).
A major question in integmse-mediated recombination is the location of the
cleaving monomer within a protein-DNA complex. In cis cleavage, the cleaving
monomer is bound adjacent to the scissile bond (Figure 1-1 1) and exarnples of
proteins employing this type of mechanism are the AInt and XerC proteins (Nunes-
Düby et ai.. 1994, Arciszewska and Sherratt, 1 995). In contrast, Flp-mediated
cleavage has been shown to occur in tram (Chen et ai., 1992). In this type of
cleavage, a Flp monomer bound adjacent to the cleavage site activates the scissile
bond but the catalytic tyrosine is donated by another Flp monomer bound elsewhere
in a protein-DNA complex. In principle, there are three type of trans cieavages. If
Flp donates its tyrosine to another Flp monomer bound across the core on the same
DNA site, frans-horizontal cleavage occurs. Tram-vertical or frans-diagonal
cleavage occurs when the donor Flp is bound to one partner DNA site but cleaves
another site in the synapse (Figure 1-1 1). In al1 cases, the characteristic feature is the
-
- 1-33 -
shared active site fonned between two Flp monornets. Some studies have suggested
that Flp uses solely a nans-horizontal mode of cleavage (Lee et al., 1994, Zhu and
Sadowski, 1995). However, it is still possible that Flp employs both cross-core and
synaptic cleavages dunng the recombination process (Qian and Cox, 1995).
There is conflicting data on the mechanism of Cre-mediated cleavage. My
data in Chapter II (Shaikh and Sadowski, 1997) support a pans mechanism of
cleavage. In direct contrat, the crystal structure of a Cre synapse shows cis cleavage
(Guo et al., 1997). To resolve these differences, 1 designed the experiments in
Chapter III. The following description refers to the cis mode of cleavage observed
for Cre as detailed in the first Cre crystd structure (Guo et al., 1997).
The crystal structure of a Cre synaptic complex demonstrated two primary
asyrnmetries between the cleaving and non-cleaving monomers that comprise the
catalytically active dimer within the synapse (Guo et aL, 1997). Firstly, the active site
of the Cre monomer that provides the catalytic tyrosine diffen fiom the active site of
the opposing non-cleaving Cre monomer. As expected, the active site consists of the
conserved integrase residues Arg173, His289, and Arg292, the cleaving nucleophile
Tyr324, and an additional residue Trp3 15. Within the cleaving monomer, the active
site is organized around the scissile phosphate with four hydrogen bonds between the
-
- 1-34 -
Arg 1 73. His289 and Ag292 residues and the first and second phosphate oxygen
atorns of the scissile bond. A fifth hydrogen bond interaction is also present between
the Trp3 15 amino acid and the second phosphate oxygen (Guo et al., 1997). Trp3 15
is not conserved amongst the integrases. most of which contain a histidine at this
position (Nunes-Düby et al., 1998). The histidine residue could participate in similar
hydrogen bond interactions suggesting that the CO-ordination of this interaction
between the scissile bond and the protein may be a conserved feature that ensures a
functional active site (Guo et al., 1997, Nunes-Düby et al., 1 998). These interactions
position the scissile phosphate for nucleophilic attack by the catalytic tyrosine
residue. The active site of the non-cleaving Cre monomer shows a similar
arrangement between the Arg173, k g 2 9 2 and Trp3 15 residues and the scissile
phosphate. In contrast, both His289 and the M helix that contains the catalytic
tyrosine residue are shified away fiom the scissile bond. Furthemore, the catalytic
tyrosine is hydrogen-bonded to the oxygen atom of the upstrearn phosphate group and
thus prevented from attacking the scissile phosphate (Guo et al., 1997).
The asymmetry exhibited in the active sites of the cleaving and non-cleaving
monomers insures that only one scissile bond in the lox site is cleaved. While the
Cre-induced asymrnetric bend in the fox site hints at a possible method by which Cre
selects one cleavage site over the other for activation of the scissile bond, the exact
-
- 1-35 -
mechanism by which the bend asymrnetry directs the asymmetry in the active sites of
two Cre monomee is unclear (Guo et al., 1997, 1999).
The most dramatic difference between the cleaving and non-cleaving
monomers of Cre is the arrangement of the L, M and N helices of the COOH-terminal
domains of the Cre monomers in the active dimer. The cleaving Cre monomer
donaies its N helix in tram to the non-cleaving monomer that is bound across the core
in a (psuedo) full-lox site. This monomer accepts the incoming helix in a
hydrophobic pocket created by the L and M helices (Figure 1-12)(Guo et al., 1997).
This represents the major cross-core protein-protein interaction between the COOH-
terminal domains of Cre monomers. As previously mentioned, the M helix of the
non-cleaving monomer shifts away firom the scissile phosphate and allows the capture
of the N helix in tram. The region between the M and N helices in the cleaving
monomer of Cre protein is in an extended conformation while the same region in the
non-cleaving unit is compacted. As a result, the N helix of the non-cleaving
monomer is directed away from the cleaving monomer bound on the same lox site and
towards the cleaving monomer bound to the partnered site in the synapse, where it
interacts using a dockinp site that differs from the one formed by the L and M helices
(Guo et ai., 1997) and thus forms a COOH-terminal based synaptic interface between
paired sites.
-
- 1-36 -
Cis-cleavage by one Cre monomer is accompanied with the burial of the N
helix tram in the non-cleaving monomer of the active dimer (Guo et al., 1997). This
conformation is also observed even in the absence of Cre-mediated cleavage (Gopaul
el al., 1 998, Guo et a/. , 1 999). Gopaul and Van Duyne (1 999) have proposed a
mechanism whereby tram-cleavage by Cre could occur. In this scheme, the N helix
is buned in cis in order to allow for the extension of the M helix toward the active site
of the monomer bound across the core that acts as the tyrosine acceptor.
d) Synapsis
The association of the two recombining sites into a higher order complex is
accomplished through protein-protein and protein-DNA interactions in a process
tenned synapsis. It is in within this framework of aligned protein-DNA complexes
that the actual exchange of strands in the recombination reaction occurs. The various
crystal structures of Cre-DNA complexes illustrate that both the NH,- and COOH-
terminal regions of the Cre protein participate in the assembly of the synaptic
complex (Guo et al., 1997). The interactions between the NH2-terminal A and E
helices of the non-cleaving and cleaving Cre monomers, respectively, bound to the
same fox site form a cross-core interface. In addition, the E helix of the non-cleaving
rnonomer is positioned to interact with the A helix of the cleaving monomer bound to
the partnered lox site in the synapse, thereby creating synaptic interface. Similarly,
-
- 1-37 -
the donation of the N helk of the cleaving monomer to the acceptor non-cleaving
rnonomer constitutes a cross-core interface that originates in the COOH-terminal
region of Cre. Additionally, a synaptic interaction is generated between the synapsed
DNAs by the contact of the N helix of the non-cleaving monomer fkom one dimer
with the COOH-terminal domain of the cleaving monomer of the other Cre dimer
found at the partner site. Combined, the NH,- and COOH-terminai interfaces
network al1 four Cre monomers into a highly stable cyclic complex where the actual
exchange of strands will occur (Figure 1- l3)(Guo et al., 1997).
Formation of a synaptic complex by Cre and Flp cm be monitored by non-
denaturing PAGE (Wierzbicki et ai., 1987, Amin et al., 199 1 ). While synapsis is not
a requirement for Cre- or Flp-mediated cleavage (Voziyanov et al., 1996, see Chapter
III). Cre variants that are defective for cleavage also fail to generate synaptic
complexes in vitro (Wierzbicki et ai., 1987, A.C. Shaikh, unpublished results).
Restoration of cleavage activity for these altered Cre proteins via complementation
with the cleavage defective Cre Y324C protein also results in a formation of a
synaptic complex (A.C. Shaikh, unpublished results). Hence, there is a strong
association between the cleavage activity of Cre and the ability to form higher order
complexes. Furthemore, the combined data obtained fiom the Cre crystal structures
and the biochemical assays suggest that protein-induced bending of the lox site directs
-
- 1-38 -
cleavage of the DNA, which in tum arranges the NH,- and COOH-terminal interfaces
between the paired recombining sites for assembly of the synaptic complex (Guo et
al., 1997, 1999. Gopaul et al., 1998, A.C. Shaikh, unpublished results).
In both the Cre and Flp systems, interaction of the bent protein-bound target
sites occurs by random collision (Beatty et al., 1986). Both parallel and anti-parallel
alignments of recombining FRT sites have been observed in the Flp reaction (Amin el
al., 199 1 ). However, recent evidence suggests that the asymrnetry of the FRT core
region favors parallel alignments of the recombining sites within the synaptic
complex to ensure the formation of a Holliday junction isomer that readily proceeds
to the resolution step (Hufhan and Levene, 1999). The Cre crystal structures show
that an anti-parallel alignment of the recombining lox sites is preferred. However,
since the Cre-induced bend direction in the lox site can occur in either direction, a
synapse resulting fkom a parallel alignment of lox sites should be possible as well
(Guo et al., 1997, 1999).
The inability of Cre25 and P32 to f o m synaptic complexes suggested a role
for the NH,-terminal domains of Cre and Flp in synapsis (Hoess et al., 1990, Pan and
Sadowski, 1 993, M.Sc. Thesis, AC. Shaikh- 1997). Furthemore, mutations in the
NHz-terminal regions of both Cre and Flp result in proteins that fail to f o m higher
-
- 1-39 -
order complexes (Wierzbicki et al., 1997. Lee et al., 1997). Given the importance of
the NHflerrninal domain of Cre in establishing the synapse seen in the crystal
structures and despite the sequence heterology that exists between the Cre L 3 and P 13
domains, it is likely that the crystal structure of the Flp synapse will also reveal a role
for P 13 in synapsis.
e) Ligation and Sttartd Exchange
The 5'-OH DNA end and the 3'-covalent phosphotyrosine end can be rejoined
in a protein-dependent manner called ligation. If the event occurs at the 5'- and 3'-
ends of the sarne nick, the cleavage reaction is simply reversed. Altematively, a
strand exchange occun when the nucleophilic attack of the S'-OH end of one DNA
site is directed to the 3'-phosphotyrosine Linkage of the partnered site in the synapse.
While Flp-mediated ligation has been shown to occur in cis, the mode of
ligation for the Cre recombinase has not been determined (Pan et al., 1993b).
However, the Cre crystal structures do suggest the chemistry involved in Cre-
mediated ligation. The active site of the cleaving monomer of Cre arranges Argl73,
His289, Arg292 and Trp3 15 around the scissile phosphate in a proton cradle (Guo et
al., 1997). In this configuration, the negative charges of the phosphate groups are
balanced and the His289 residue acts as a proton donor. As a result, the nucleophilic
-
- 1 4 0 -
attack of the 5'-OH DNA end is attracted to the tyrosine covalent linkage at the
scissile phosphate (Guo et al., 1997). This view of the protein-mediated ligation
mechanism is especially appealing as mutations in the equivalent conserved Flp
residues result in defects in ligation (Zhu and Sadowski. 1995, 1998, Pan and
Sadowski, 1992, Friesen and Sadowski, 1992).
Flp-mediated ligation can be either coupled to or independent of strand
cleavage (Zhu and Sadowksi, 1998). However, a Cre variant with an alteration at
Ar@ 73 is defective for both cleavage and ligation (Gopaul et aL, 1998, Guo et al..
1999), while the equivalent alteration in the Flp protein results only in a ligation
defect (Freisen and Sadowski, 1992). This suggests that Cre-mediated cleavage and
ligation may be coupled activities.
Cre initiates the first strand exchange event at the bottom strand of the iox site
(Hoess and Abremski, 1985, Hoess et al., 1987). While such a bias has not been
defined for the Flp system, a number of studies have suggested that the FRT b
element is the site of the first strand exchange in Flp-mediated recombination (Zhu
and Sadowski, 1998, Azam et al., 1997, H u h a n and Levene, 1999). In both the Cre
and Flp systems, strand exchange followed by protein-mediated ligation results in the
formation of a Holliday intemediate (Holliday, 1964, Jayaram et al., 1988, Hoess et
-
al., 1987).
The actual mechanism of strand exchange can be inferred from the first
Cre/lox crystallographic structure. Fhtly, the association of the bent protein-DNA
complexes mimics the four way junction of a Holliday isomer, the end product of the
first strand exchange reaction (Guo et al., 1997). Secondly, as a result of the bend in
the cleaved recombining sites, the DNA strands in the core regions are separated
resulting in an un-stacking of about three base pairs at the 5'-OH end of the nick,
while simultaneously maintaining the pairing of the 3'-phosphotyrosine DNA end
(Guo et ai., 1997, 1999). Through this limited separation of the crossing (cleaved)
and continuous (un-cleaved) DNA strands in the core regions of the two sites in the
synapse. strand exchange between the recombining sites is favored over the re-
ligation of the nicked site (Guo et al., 1997).
As the Cre synaptic complex adopts a Holliday-like structure, the S'-OH DNA
ends of the nicked strands are in close proximity to the 3'-phosphotyrosine ends of the
partnered sites. In addition, the reaction is driven by the base pairing between the
incoming 5'-OH DNA end and the complementary unbroken strand region opposite
the 3'-covalent Iinkage of the receiving site. Coupled with the environment created
by the active site residues around the covalent linkage at the scissile phosphate, the
-
- 1-42 -
nucleophilic attack of the S'-OH end of one cleaved site is strongly directed toward
the 3'-end of a nick at the partnered site in the synapse (Guo et al., 1997).
The crystal structure of the Cre synapse illustrates how both the cleavage and
strand exchange events can be CO-ordinated and encouraged within the same protein-
DNA complex, with very little change to the overall structure of both the DNA and
proteins in the synapse. This efficient mode1 of strand exchange was previously
suggested by biochemical studies of the AInt recombination system where the
swapping of DNA strands was driven by homology and not branch migration through
the core region of the recombining sites (Nunes-Duby et al., 1995, Dixon and
Sadowski. 1 994). Similarly, the XerClXerD and Flp recombinases are believed to
also un-stack bases at the branch point upon target site binding in their respective
recombination systems (Arciszewska et al., 1997, Zhu and Sadowski, 1998). Hence,
the formation of a protein-DNA complex that mimics the transition state of the
reaction may be a general feature of integrme-mediated recombination reactions that
favors strand exchange between nicked sites in a synapse.
The Holliday interrnediate, or X-structure, generated after the first strand
exchange event is the platform for a second round of protein-mediated cleavage,
-
- 1-53 -
strand exchange and ligation reactions that resolve this transition intennediate into
recombinant products (Dixon and Sadowski, 1993, 1994). Both Flp and Cre resolve
synthetic X-structures with out bias (ie. in the fonvard direction favoring recombinant
products. or the reverse direction favoring parental products; Dixon and Sadowski.
1 993, Hoess et al., 1987, A.C. Shaikh, unpublished results). Howevet, in vivo, both
recombinases show a definite bias toward resolution that generates recombinant
products and the way that this is achieved remains unclear (Hoess et al., 1987, Dixon
et al., 1995, Azam et al., 1997). The second cleavage reaction in the tesolution step
of the Flp system has been shown to occur in pans (Dixon et al., 1995). While Cre-
mediated cleavage of pstnictures in cis or trons has not been determined in vitro
(AC. Shaikh. unpublished results), the crystal structures of Cre complexed with
synthetic X-structures are consistent with cis-cleavage (Gopaul et al, 1 998).
The crystal structure of the Cre-bound Holliday junction suggests how
resolution might occur. Afier the first set of strand exchanges, a short 1-2 bp branch
migration in the lox core occurs. This shifis the bend center in the sites to the
opposite end of the core (Gopaul et al., 1998). As the bend asymmetry in the lox site
defines the directionality in the cleaving monomer, this limited isomenzation imposes
an inactive conformation upon the Cre proteins that were previously active in the first
strand exchange event and configures the two Cre monomers that were inactive in the
-
-1-44-
fmt set of reactions to an active state (Figure Id)(Gopaul et al., 1998, Dixon et al.,
1995). These Cre monomers are now responsible for the cleavage, strand exchange
and ligation reactions for the resolution of the Holliday intermediate.
As with the fint strand exchange reaction, the Cre-mediated resolution step
requires no extreme branch migration or helical re-stacking of the core region,
consistent with previous observations fiom the AInt and Flp systems that showed that
branch migration was not required for recornbination @ixon and Sadowski, 1994,
Nunes-Düby el al., 1995). The recombination reaction progresses from the first
strand exchange event to the second, resolution step without major reorganization of
the multi-protein-DNA complex fmt assembled in the synapse.
10. Thesis Outline
The major question addressed in this thesis is the mode of cleavage by Cre
recombinase. 1 performed complementation experiments described in Chapter II
(Shaikh and Sadowski, 1997) before the publication of the first Cre crystal structure.
1 determined that the Cre recombinase used a tram mode of cleavage. However, the
publication of the crystal structure of the Cre/lox synapse (Guo er ai., 1997) clearly
showed Cre cleaving in cis, and caused me to re-examine the mechanism of cleavage
by Cre. It was possible that my use of the sites and proteins in the complementations
-
- 145 - in Chapter II predisposed Cre to act in tram. In the data shown in Chapter III, 1
constructed Cre and Flp chimeras with aitered DNA binding specificity through
swaps of the NH,-terminal regions of both proteins. I characterized the distinct
binding activities of these novel chimeras and developed specific target sites for
them. Using hybrid target DNA sites for reactions of the chimeras with either Cre or
Flp. 1 determined that the Cre and Flp proteins cleave in cis and trons, respectively. 1
also found that both Cre and Flp had flexible catalytic domains that allowed for a
transition in the protein conformation to accommodate both cis- and tram-cleavage
modes.
-
Figure 1-1. The effect of general and site specific recombination on Pl plasmid maintenance.
a. The PI plasmid (inset circle) is present as one DNA copy per bacterial cell, (outer oval)(l). Replication of Pl DNA (2) results in two copies of the P l DNA which can be partitioned between the resulting daughter cells at ce11 division (3-5). General recombination gives dirneric Pl DNA (6), which cannot be partitioned between two daughter cells at ce11 division (7). Only one daughter ce11 receives P1 DNA, while the other is cured of the plasmid (empty oval)(8).
b. The lox site (black box) is present in each copy of Pl DNA (1). If generalized recombination dimerizes the P l DNAs (2 and 6), the dimeric DNA can then be resolved into monomenc P 1 plasmids by Cre-mediated recombination between the two Zox sites (7), allowing for partitioning of one P l DNA into each daughter ce11 at ce11 division (8).
-
Figure 1-2. Peptide maps of Cre and Flp recombinase.
a. Cre peptide map. The NH2-terminal domain, Cre 13 represents the first 1 1 8 amino acids. Cre25, the COOH-terminal peptide, includes the remaining amino acids. 1 19 to 343 of Cre. The four conserved cataiytic residues are shown in green.
b. Flp peptide map. The NH,-terminal domain, P l 3 contains the fint 123 amino acids of Flp. The COOH-terminal domain, P32, stretches fiom residue 124 to amino acid 423. The four catalytic residues of Flp are shown in green.
-
Figure 1-3. The Cre recombinase.
a. Secondary structure assignment for Cre. The p h a r y amino acid sequence of Cre is rnatched with the secondary structures observed fiom the crystal structure of a Cre synaptic complex (Guo et aL, 1997). The helices (lettered) and P strands (numbered) are denoted as barrels and arrows, respectively, while the intervening regions are depicted as the continuous line. The conserved catalytic residues, Arg 1 73, His289, kg292 and Tyr323, are shown in red. The original demarcation between residues 1 18-1 19 that divided Cre into NH,- and COOW-terminal domains (Hoess ei al., 1990) is shown in purple, while the seiaration of the domains from the crystal structure at amino acids 130-1 3 1 is shown in green. (Adapted fiom Guo et ai.. 1997)
b. Ribbon mode1 of the tertiary structure of Cre. The five helices of the NH2- terminal region (A-E) and the nine helices of the COOH-terminal region (F-N) of Cre are labeled. For clarity, the five P strands (yellow) are not labeled. The demarcation behveen Cre 13 and Cre25 is s h o w as a purple region in the E helix (purple arrow). The separation of the domains fiom the crystal structure at amino acids 1 30- 1 3 1 is shown as a green segment in the intervening region between the E and F helices (green arrow).
(The figure was generated using the Swiss-PDB Viewer and the ICRX set of CO-ordinates fiom Guo et al., 1997)
-
Figure 1-4. The lox and FRT target sites.
a. The lox site contains two inverted, identical 13 bp symmetry elements, (horizontal arrows. green sequence), that surround an asymmetric 8 bp core region, (open box, magenta sequence). Each element is divided into a 4 bp core-proximal region (underlined) and a 9 bp core-distal region. Cre binds to these symrnetry elements, cleaves at the phosphodiester bonds sites indicated by the two vertical arrows, and attaches covalently to the 3'-phosphate group of the dA nucleotide (top strand) or dG nucleotide (bottom strand), respectively.
b. The FRT site contains three 13 bp syrnmeay elements, a, b and c, (horizontal arrows. red sequences), that surround a 8 bp core region, (open box, blue sequence). Symmetry elements a, and b are in inverted orientation with respect to each other and differ from each other at a single base pair. Syrnmetry elements b and c are directly onented copies of one another. Each symmetry element is divided into a 4 bp core- proximal region (underlined) and a 9 bp core-distal region. Flp binds to these symmetry elements and cleavage by Flp occurs at the core-symmetry element junction. (vertical arrows). Pyrimidine rich tracts (solid green bars) radiate fiom the core towards each adjoining symmetry element.
-
5' ATAACTTCGTATAATGTATGCTATACGAAGTTAT
TATTGAAGCATATTACATACGATATGCTTCAATA
5' GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGCTTC 3'
3' CTTCAAGGATAAGGCTTCAAGGATAAGAGATCTTTCATATCCTTGAAG 5u
-
Figure 1-5. The 2 p M plasmid of Saccharomyces cerevisiue.
The plasmid is divided into two unique regions, large (L). and small (S), by two 599 bp inverted repeats (green bars), each containing an FRT site. The relative locations of the four open reading h e s with known functional products are shown, (REP 1 , RAF, REP2 and FLP). Two cis acting sequences, Stb, and the origin of replication, (Ori), are shown. Flp recombinase mediates a site-specific recombination event between the two FRT sites converthg the A isoform (top), into the B isofonn (bottom).
-
Figure 1-6. Steps in Cre-mediated recombination.
a. DNA Bioding. Two Cre monomers (ovals) bind specifically to the lox site at the symmetry elements @lue and red arms) that flank the core region (central black region). For simplicity in this figure, the extensive network of protein-protein interactions is not shown.
b. DNA Bending. Upon binding the lox site, Cre induces a bend in the center of the site and sets up an asymmetry in the Cre dimer where one monomer assumes an active state for cleavage (blue oval) while the opposing Cre monomer is in an inactive state (green ovai) (Guo er ul., 1999).
c. Cleavage and Covalent Attachment. The active monomer nicks one strand of the fox site in cis and f o m s a covalent Iinkage with the 3'-phosphoryl end of the nick (red dot and arm) and a free 5'-OH DNA end (open circle). The bottom strand nicked first is the bottom strand of the lox site (See Figure 1-4a).
d. Synapsis. Reactions a-c occur on a second lox site (green and purple arms, yellow core region). Protein-protein interactions between two dimeric Cre-lox complexes aiigns the sites in an anti-parallel manner to generate a synaptic cornplex. As a result of the bends in the synapse the crossing strands in the cross-over regions of both the fox sites are separated in the synapse (squiggly strands with yellow and black open circled ends).
e.f. Strand Exchange and the formation of the Holliday Intermediate. The 5'-OH ends of the crossing strands (incoming squiggly strands terminating in yellow and black open circles) are swapped. The 5'-OH terrnini attack the Cre covalent linkage and reform continuous strands of DNA (filled yellow and black circles in f.) As a result, a Holliday interrnediate is generated.
g. Resolution. i. An isomerization in the core region shifis the bends in the sites to the opposite side of the core region and inactivates the Cre monomers that catalyzed the first set of reactions (Cre monomers bound to the blue and purple arms) and activates the previously inactive Cre monomers (Cre monomers bound to the green and red arms). ii. A second set of Cre-mediated cleavage reactions initiate the next round of strand exchange events. üi. The second set of crossing strands (squiggly strands terminating in yellow and black open circles) are exchanged and ligated. iv. Resolution of the Holliday intennediate yields recombinant products. Note the swapping of the arms in the products and the heteroduplex nature of the core regions.
-
a. Binding b. Bending C, Cleavage
d. Synapsis e, Strand Exchange f. Holliday Intemediate
g. Resolution
i. Isomerization ii. Second Cleavages iii. Second Strand Exchange
iv. Recombinant Products
-
Figure 1-7. Modelo of binding of Cre to ibe lox site.
In al1 cases, the lox site is shown with the symmetry elements depicted in green sequences and horizontal arrows. The red sequence and the open box represent the core. Vertical arrows denote cleavage sites and are omitted in subsequent cartoons. Two Cre monomers are shown bound to each lox site on opposite DNA strands.
a. The initial binding of Cre to a single lox symmetry elernent occurs with the binding of the NH,-terminal domain of Cre, Crel3, to the fmt 4 bp of the symmetry element at the core-proximal region (underlined). The COOH-terminal domain. Cre25, contacts the remaining 9 bp of the core-distal region of the symmetry element. Hence. the entire symmetry element is contacted by the full-length Cre protein (M.Sc. Thesis, A.C. Shaikh-1997).
b. When two Cre monomers bind to a full-fox site, protein-protein interactions extend the contact region of the Cre domains so that Cre25 is positioned over both the core-proximal and -distal regions of the symmetry element, while Cre 13 is situated solely in the core. Thus, Cre binding to a full-lox site results in two Cre molecules occupying the core region at the sarne time, (shown here, on opposite strands).(Hoess et al., 1990)
c. Composite view of the above models derived from the Cre/lox crystallographic structure (Guo et al., 1997). The COOH-terminal domain of Cre contacts the entire syrnmetry element and the fvst 2 bp of the core region. The NH,-terminal domain interacts with the core-proximal region of the symmetry elemen&d the first 3 bp of the core region. Two Cre monomers cover the entire fox site except for the central 2 bp of the core region.
-
ATAACTTCGTATMTCTATGCTATWWGTTAT 3'
3' TATTGIUCCATATTACATACGATATGCTTCAATA 5'
5' ATMCTTCGTAT~TGTATGCTATACGAAGTTAT 3'
3' TATTGAAGCATATTACATACGATATGCTTCAATA 5'
3 ATAACTTCGTATAATGTATGCTATACGAAGTTAT 3'
3' TATTGAAGCATATTACATACGATATGCTTCAATA 5'
-
Figure 1-8. Tertiary structure mode1 of binding of Cre to the fox site.
For clarity, only some helices of the Cre protein are labeled and one Cre monomer, a cleaving subunit, is shown binding to the two-half lox sites.
The Cre protein binds the lox site in a clamp-like fashion, with the DNA sandwiched between the two domains of the protein. Extensive sugar-phosphate contacts occur between the core region (nucleotides of the core region of the continuous strand of the bound half-lox site shown in blue) and the E helix. The NH,-terminal domain forms direct base contacts primarily through the B and D helices. The COOH- terminal domain forrns several contacts with the DNA. Direct base contacts occur between the DNA and the J helix, the 4-5 P sheet and a Lys201 residue (green residue) contained in between the p strands 2 and 3. The catalytic tyrosine (red residue) is shown covalently attached (black oval) to the 3'-phosphoryl end of the cleavage site (dG nucleotide of the cleaved strand shown in purple). Accompanied with Cre binding, a bend is introduced in the lox site in the direction of the green arrow and would serve to separate the crossing (cleaved) and continuo