![Page 1: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/1.jpg)
UNIVERSIDADE ESTADUAL DE CAMPINAS
FACULDADE DE ODONTOLOGIA DE PIRACICABA
LÍVIA PAGOTTO RODRIGUES
RELAÇÃO ENTRE OS DIFERENTES ESTÁGIOS DA CÁRIE PRECOCE DA
INFÂNCIA E A COMPOSIÇÃO MICROBIOLÓGICA DO BIOFILME DENTÁRIO
EM PRÉ-ESCOLARES DE 36 A 60 MESES – ESTUDO LONGITUDINAL
RELATIONSHIP AMONG THE DIFFERENT STAGES OF EARLY CHILDHOOD
CARIES AND MICROBIOLOGICAL COMPOSITION OF DENTAL BIOFILM IN
PRESCHOOL CHILDREN FROM 36 TO 60 MONTHS OLD – A LONGITUDINAL
SUTDY
Piracicaba
2016
![Page 2: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/2.jpg)
LÍVIA PAGOTTO RODRIGUES
RELAÇÃO ENTRE OS DIFERENTES ESTÁGIOS DA CÁRIE PRECOCE DA
INFÂNCIA E A COMPOSIÇÃO MICROBIOLÓGICA DO BIOFILME DENTÁRIO
EM PRÉ-ESCOLARES DE 36 A 60 MESES – ESTUDO LONGITUDINAL
RELATIONSHIP AMONG THE DIFFERENT STAGES OF EARLY CHILDHOOD
CARIES AND MICROBIOLOGICAL COMPOSITION OF DENTAL BIOFILM IN
PRESCHOOL CHILDREN FROM 36 TO 60 MONTHS OLD – A LONGITUDINAL
STUDY
Piracicaba
2016
Tese apresentada à Faculdade de
Odontologia de Piracicaba da Universidade
Estadual de Campinas como parte dos
requisitos exigidos para a obtenção do título
de Doutora em Odontologia, na área de
Odontopediatria.
Thesis presented to the Piracicaba Dental
School of the University of Campinas in
partial fulfillment of the requirements for
the degree of Doctor in Dentistry, in
Pediatric Dentistry area.
Orientadora: Profa. Dra. Marinês Nobre dos Santos Uchôa
ESTE EXEMPLAR CORRESPONDE À VERSÃO
FINAL DA TESE DEFENDIDA PELA ALUNA LÍVIA
PAGOTTO RODRIGUES E ORIENTADA PELA PROF.ª
DR.ª MARINÊS NOBRE DOS SANTOS UCHÔA.
Assinatura da Orientadora
![Page 3: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/3.jpg)
Agência(s) de fomento e nº(s) de processo(s): CNPq, 141312/2013-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca da Faculdade de Odontologia de Piracicaba Marilene Girello - CRB 8/6159
![Page 4: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/4.jpg)
![Page 5: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/5.jpg)
DEDICATÓRIA
A Deus,
E aos Benfeitores Espirituais que sempre nos guiam no caminho da retidão. Meu
agradecimento pela intuição diária para decisões acertadas e pelo alento nos momentos de
dificuldade. Agradeço pelas riquezas que possuo, como bênçãos intituladas família e amigos.
Agradeço ainda pelas provas e expiações necessárias à lapidação de caráter.
_____________________________________________________________
Aos meus maiores amores: José Antônio, Ana Rúbia, Leonardo, Guilherme. Ainda, aos
meus novos amores Fabiana, Marília, João Gabriel e Maria Clara. Diamantes que Deus me
presentou e me concedeu a oportunidade de convívio e aprendizado. Distantes fisicamente,
mas unidos em coração. Amo cada um de vocês, meus grandes “pilares” e exemplos de
caráter. Também, à Carla da Silva, pelos momentos de alegria e companheirismo.
![Page 6: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/6.jpg)
AGRADECIMENTOS ESPECIAIS
À Profa. Dra. Marinês Nobre dos Santos Uchôa, que mais do que uma orientadora, foi uma
grande conselheira. Sempre presente em meus desafios. Acima de tudo, me ensinou a nunca
desistir, apesar das dificuldades e a tratar a todos com doçura e empatia. À senhora, agradeço
pelas opiniões, críticas construtivas e incentivo à vida acadêmica.
À Profa. Dra. Cínthia Pereira Machado Tabchoury, pelo auxílio ao longo destes seis anos
de pós-graduação. Também, pelo respeito às minhas dificuldades e pelo incentivo à
continuidade na vida acadêmica, apesar dos grandes desafios.
Ao professor Rafael Nobrega Stipp, pelos ensinamentos em microbiologia, sempre com
muita paciência e entendimento de minhas limitações. Extremamente gentil e disposto a
responder meus questionamentos. À Natalia Leal Vizoto, por ter me ajudado quando eu mais
precisei, sempre com um sorriso no rosto e com muita paciência diante de minhas
dificuldades nas fases laboratoriais.
Às demais colaboradoras deste trabalho, Gabriela Novo Borghi, que sempre me
acompanharam nas coletas, me ensinando noções de organização e trabalho em equipe, me
incentivando diariamente e acima de tudo, rindo comigo e superando as dificuldades
enfrentadas, inerentes a um trabalho clínico com crianças. Também, à Bruna Raquel
Zancopé, pela ajuda em situações difíceis, pela companhia sempre divertida e positiva nestes
seis anos.
![Page 7: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/7.jpg)
AGRADECIMENTOS
À Universidade Estadual de Campinas, na pessoa do seu Magnífico Reitor Prof. Dr.
José Tadeu Jorge; à Faculdade de Odontologia de Piracicaba, na pessoa do seu Diretor Prof.
Dr. Guilherme Elias Pessanha Henriques e Diretor Associado Prof. Dr. Francisco Haiter
Neto. À Profa. Dra. Cinthia Pereira Machado Tabchoury, Presidente da Comissão de Pós-
Graduação, FOP/UNICAMP; ao Prof. Dr. Marcelo de Castro Meneghim, Coordenador do
Programa de Pós-Graduação em Odontologia, FOP/UNICAMP.
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pela
concessão da bolsa de Doutorado para a execução deste trabalho. Também, ao CNPq, pelo
Programa Institucional de Bolsas de Iniciação Científica (PIBIC) que permitiu a concessão
de bolsas de iniciação científica às alunas Gabriela Silveira Correia e Jéssica Jeuken
Teixeira, às quais agradeço pela ajuda e principalmente, pelo jeito doce com que aceitaram
meus conselhos durante a execução deste trabalho.
À Profa. Dra. Carolina Steiner Oliveira Alarcon, Profa. Dra. Fernanda Miori
Pascon, Profa. Dra. Maria Beatriz Duarte Gavião, Profa. Dra. Marinês Nobre dos Santos
Uchôa e Profa. Dra. Regina Maria Puppin Rontani pelo compartilhamento de informações
e saberes em Odontopediatria. Também, ao Prof. Dr. Érico Barbosa Lima, Profa. Dra.
Kamila Rosamilia Kantovitz, Profa. Dra. Paula Midori Castelo, Profa. Dra. Regina Célia
Rocha Peres e Profa. Dra. Taís de Souza Barbosa pelos ensinamentos e convivência durante
algum período do meu tempo de pós-graduação.
Aos professores da Área de Ortodontia, Prof. Dr. Eduardo César Almada Santos,
Prof. Dr. João Sarmento Pereira Neto, Profa. Dra. Maria Beatriz Borges Araújo Magnani
e Profa. Dra. Vânia Célia Vieira de Siqueira, pela oportunidade de integração entre as áreas
e pelos ensinamentos durante as aulas teóricas e clínicas de graduação.
Às professoras membros da banca do exame de Pré-qualificação, Profa. Dra. Maria
Beatriz Duarte Gavião e Profa. Dra. Cínthia Pereira Machado Tabchoury, pelas sugestões
iniciais para a realização deste trabalho. Às professoras membros da banca do exame de
Qualificação, Profa. Dra. Érika Nikitza Shiauha Harth Chu, Profa Dra. Maria Beatriz
Duarte Gavião e Profa. Dra. Patrícia de Oliveira Lima, e aos professores da banca da defesa,
Profa. Dra. Sandra Regina Echeverria Pinho da Silva, Prof. Dr. Juliano Pelim Pessan,
Profa. Dra. Rosana de Fátima Possobon, Profa. Dra. Carolina Steiner Oliveira Alarcon e
aos suplentes Profa. Dra. Lidiany Karla Azevedo Rodrigues, Prof. Dr. Érico Barbosa Lima
![Page 8: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/8.jpg)
e Profa. Dra. Maria Beatriz Borges de Araújo Magnani, aos quais agradeço desde já pela
disponibilidade em ler e sugerir modificações neste trabalho.
Ao Laboratório de Microbiologia da Faculdade de Odontologia de Piracicaba e aos
colegas da área de Microbiologia, pela ajuda em momentos de dúvidas durante as análises
microbiológicas.
Ao amigo e técnico do Laboratório de Odontopediatria, Marcelo Corrêa Maistro
pelas explicações e toda ajuda durante as fases laboratoriais e principalmente, pela paciência e
auxílio minucioso em cada passo dos experimentos.
À secretária do Departamento de Odontologia Infantil, Sra. Shirley Rosana Sbravatti
Moreto, pela convivência diária harmoniosa, pelas conversas em dias difíceis, sempre disposta
a auxiliar de modo gentil e acolhedor.
Às secretárias da pós-graduação, Ana Paula Carone, Érica A. Pinho Sinhoreti,
Raquel Q. M.C. Sacchi e Roberta Clares Morales dos Santos (in memorian), pela atenção e
apoio durante as fases administrativas.
Ao Comitê de Ética em Pesquisa da FOP-UNICAMP, pela disponibilidade em
avaliar o projeto, preocupando-se com os aspectos éticos envolvendo os voluntários.
A todos os amigos e companheiros de Mestrado e Doutorado em Odontopediatria, em
especial à minha turma, Alexsandra Shizue Iwamoto, Ana Bheatriz Marangoni Montes,
Daniele Picco, Maria Carolina Salomé Marquezin, Luciana Tiemi Inagaki, Thayse
Rodrigues, Vanessa Benetello e Daniela Galvão de Ameida Prado. Também, aos demais
amigos e companheiros da Odontopediatria e de outras áreas com quem convivi durante esses
seis anos, em especial à Amanda Fabião, Anna Gabriela C. Presotto, Ana Lívia Fileto,
Andréia Sanchez, Bárbara Lucas, Camila Nobre Freitas, Cristina Muller, Darlle Araújo,
Érika Harth, Fabiana Furtado Freitas, Filipe Martins, Karla Vasconcelos, Larissa
Ferreira Pachecho, Lenita Maragoni Lopes, Micaela Cardoso, Patrícia Oliveira, Rafaela
Costa e Thaís Harder, pelos conselhos, ajuda, companhia e acima de tudo, apoio.
A todos os funcionários da Faculdade de Odontologia de Piracicaba pela colaboração
e convivência.
Aos amigos do Cepae, em especial à Profa. Dra. Rosana Possobon, à Cristiane
Tristão e aos amigos Amélia, Carlos, Caroline, Cibele, Cláudia, Gabriela, Isabela,
Jaqueline, Mariana, Marcela e Lucas. Essa experiência me trouxe valores únicos e um
sentimento de trabalho em equipe que me motivou a olhar “o outro” como um ser único e
especial.
![Page 9: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/9.jpg)
A todos os meus familiares, em especial aos meus mais novos amores João Gabriel
Rossini Rodrigues e Maria Clara Bizineli Rodrigues, que me despertaram sentimentos
inéditos e que me fizeram ter ainda mais amor pelo cuidado aos pacientes infantis. Também,
aos meus padrinhos Flávio Aparecido Gumieri e Rubiani de Cássia Pagotto, exemplos de
sucesso posterior à história de dedicação incansável.
À Secretaria Municipal de Ensino de Piracicaba que permitiu a realização da
pesquisa nas escolas por mim solicitadas, às diretoras, professoras e funcionárias das escolas
que frequentei. Obrigada pela simpatia e carinho durante esses dois anos de convivência.
Por último, mas não de menor importância, aos voluntários desta pesquisa, sem os
quais eu não teria conseguido realizar este trabalho. Trabalho clínico tem suas dificuldades e
particularidades, mas certamente, a finalização do mesmo traz um sentimento de satisfação
inigualável. Vocês foram essenciais para a concretização desta etapa em minha vida.
A todos, direta ou indiretamente citados, dedico os meus agradecimentos.
![Page 10: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/10.jpg)
EPÍGRAFE
"Não sei... se a vida é curta ou longa demais para nós,
Mas sei que nada do que vivemos tem sentido, se não
tocarmos o coração das pessoas”.
Cora Coralina
![Page 11: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/11.jpg)
RESUMO
Levantamentos epidemiológicos têm mostrado que a cárie precoce da infância
(CPI) é altamente prevalente no Brasil e no mundo, apresentando-se como um problema de
saúde pública, o que enfatiza a importância de se pesquisar os fatores relacionados à etiologia
e à identificação de crianças que possam desenvolver a CPI. Esta tese é composta por um
capítulo, cujo objetivo foi avaliar a composição microbiológica do biofilme dentário formado
sobre lesões de manchas brancas ativas ou sobre lesões de cárie cavitadas, bem como avaliar a
presença de biofilme visível na região anterossuperior dos dentes e as variáveis sociais que
poderiam exercer influência nos diferentes estágios da doença. Assim, neste estudo
longitudinal de um ano, foram avaliados 51 pré-escolares de ambos os sexos, que frequentaram
creches e pré-escolas municipais na cidade de Piracicaba-SP (Brasil). As crianças foram
divididas nos seguintes grupos, de acordo com os diferentes estágios da CPI, avaliados de
acordo com o critério de diagnóstico proposto por Séllos e Soviero (2011): grupo livre de cárie
(LC) (grupo controle) (n=17), grupo lesão de mancha branca ativa (LMB) (n=7) e grupo lesão
de cárie cavitada (LCC) (n=27). No biofilme dentário, foram dosadas as quantidades de
Actinomyces naeslundii, Bifidobacterium spp., Streptococcus mutans, Veillonella spp. e grupo
dos comensais (pela dosagem do grupo Streptococcus mitis e Streptococcus gordonii) por
qPCR (quantificação em tempo real pela reação em cadeia da polimerase). Todas as crianças
foram submetidas ao exame clínico para avaliação da presença de biofilme visível nos incisivos
superiores e para a realização do diagnóstico de cárie. Os responsáveis preencheram um
questionário para a obtenção dos dados relacionados às variáveis comportamentais (renda
familiar e grau de instrução materno). Os dados foram analisados pelos testes do qui-quadrado
/exato de Fisher, seguidos de regressão logística múltipla (α=0,05), com dados expressos por
razão de chances (odds-ratio-OR). A prevalência de cárie precoce na infância encontrada no
baseline (tempo zero) foi de 48,7%, com dados de ceos de 4,05 (± 7,33) e ceod de 2,68 (± 4,06).
Os fatores relacionados às variáveis comportamentais não apresentaram diferença estatística
significativa entre os grupos avaliados. Os resultados sugerem que altos níveis de S. mutans
(OR = 15,3) mostraram uma associação significativa com o estágio inicial da doença. Além
disso, altos níveis de S. mutans (OR = 45,5) (p< 0,05). e presença de biofilme visível na região
anterossuperior dos dentes (OR = 13,1) apresentaram associação significativa com o estágio de
cavitação da doença (p < 0,05).Altos níveis de S. mutans sobre lesões de cárie ativa, assim como
sobre lesões cavitadas, são fatores relevantes para o início e progressão da CPI. A presença de
biofilme clinicamente visível é um importante parâmetro clínico para progressão da CPI.
![Page 12: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/12.jpg)
Palavras-chave: cárie dentária, pré-escolar, epidemiologia, biofilme dentário, microbiologia.
![Page 13: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/13.jpg)
ABSTRACT
Epidemiological surveys have shown that early childhood caries (ECC) is highly
prevalent in Brazil and worldwide, and is considered a public health problem. These evidences
emphasize the importance of studying the factors related to the etiology and identification of
children who may develop the disease. This thesis consists of a chapter, that aimed to evaluate
the microbiological composition of dental biofilm formed over active early caries lesion and
cavitated caries lesion, as well as the presence of visible biofilm in the upper anterior teeth and
behavioral factors that could influence the different stages of the disease. Thus, in this
longitudinal study of one year, 51 preschoolers of both genders who attended kindergartens and
municipal preschools in the city of Piracicaba-SP (Brazil) were evaluated. Children were
divided into the following groups, assessed by the caries diagnostic proposed by Séllos and
Soviero (2011): caries-free group (CF; n=17) (control group), group with the early caries lesion
(ECL; n=7) and group with cavitated caries lesions (CCL; n=27). The relative quantification of
Actinomyces naeslundii, Bifidobacterium spp., Streptococcus mutans, Veillonella spp. and
commensal group (Streptococcus mitis group and Streptococcus gordonii) were quantified by
qPCR (quantitative-polymerase Chain Reaction). All children underwent clinical examination
to assess the presence of visible biofilm in the upper incisors and the diagnosis of caries. The
parents answered a questionnaire to obtain data related to social variables (family income and
maternal level of education). Results were analyzed by chi-square/Fisher's exact test, followed
by stepwise backward regression (α = 0.05), with data expressed as odds ratio (OR). Forty eight
percent of the children showed ECC and mean dmfs/ dmft were 4.05 (± 7.33) and 2.68 (± 4.06)
respectively. No difference among groups was found regarding behavioral variables. The
results demonstrated a significant association between the initial stage of the disease and high
levels of S. mutans (OR = 15.3) (p <0.05). In addition, high levels of S. mutans (OR = 45.5)
and the presence of visible dental biofilm in the anterior region of the upper incisors (OR =
13.1) were strongly associated with the cavitation stage of the disease (p <0.05). Conclusion:
High levels of S. mutans over ECL as well as CCL are relevant factors for initiation as well as
progression of ECC. The presence of visible biofilm is an important clinical parameter for ECC
progression.
Key Words: dental caries, preschool children, epidemiology, biochemistry, dental biofilm.
![Page 14: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/14.jpg)
LISTA DE TABELAS
Tabela 1. Primers for bacterial identification used in qPCR 29
Tabela 2. Means and standard deviations of decayed, missing and filled
surfaces (dmfs) and teeth (dmft) according to Séllos and Soviero criteria
30
Tabela 3. Bivariate analysis of the relationship between different stages of
early childhood caries and related factors
33
Tabela 4. Multivariate modeling of different stages of caries lesions
development regarding the Streptococcus mutans relative concentration and
presence of dental biofilm.
34
![Page 15: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/15.jpg)
LISTA DE ABREVIATURAS E SIGLAS
ECC - Early childhood caries
ECL - Early caries lesion
CCL - Cavitated caries lesion
CF - Caries-free
CPI - Cárie precoce da infância
ceos - índice – cariados, indicados para exodontia e obturados (superfícies)
ceod - índice – cariados, indicados para exodontia e obturados (dentes)
dmfs - decayed, missing or filled surface
dmft - decayed, missing or filled teeth
TE – Tris-EDTA
qPCR: quantitative polymerase chain reaction
16S rDNA: gene codificador do RNA ribossômico 16S
![Page 16: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/16.jpg)
SUMÁRIO
1 INTRODUÇÃO 17
2 ARTIGO
Microbiological composition of dental biofilm in different stages of early childhood
caries – a longitudinal study
21
3 CONCLUSÃO
46
REFERÊNCIAS
47
ANEXOS
ANEXO 1 – Informação CCPG/001/201512
ANEXO 2 – Comprovante de submissão do manuscrito
ANEXO 3 – Certificado de aprovação do Comitê de Ética em Pesquisa
ANEXO 4 – Ficha clínica
ANEXO 5 – Escores do critério de diagnóstico
ANEXO 6 – Fotografias com escores do critério de diagnóstico
52
53
54
55
56
57
![Page 17: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/17.jpg)
17
1 INTRODUÇÃO
A cárie precoce da infância (CPI) é definida como a presença de uma ou mais
superfícies dentárias cariadas (cavitadas ou não), perdidas ou restauradas em pré-escolares com
idade inferior a 06 anos (Drury et al., 1999). Inicialmente, a CPI se manifesta clinicamente
como lesões de manchas brancas opacas, principalmente no terço cervical da superfície
vestibular e lingual dos incisivos decíduos superiores, podendo surgir assim que os dentes
decíduos irrompam (Ripa, 1988). Na forma severa da doença podem surgir manifestações
clínicas como dor, abscesso e dificuldade mastigatória (Ramos-Gomez et al., 2002; Ferraz et
al., 2014). Da mesma forma, a perda precoce de dentes decíduos pode acarretar transtornos no
desenvolvimento adequado do sistema estomatognático, o que favorece a instalação de hábitos
parafuncionais e maloclusão, podendo gerar a perda do guia de erupção dos dentes permanentes
(Drummond et al., 2013). Estudos clínicos demonstram que crianças com CPI apresentam
piores condições na qualidade de vida (Filstrup et al., 2003, Feitosa et al., 2005; Abanto et al.,
2011) e maior prejuízo no desempenho e frequência escolares em crianças de idade maior
(Paula e Mialhe, 2013).
Levantamentos epidemiológicos têm mostrado que, no Brasil, CPI apresenta-se
como um problema de saúde pública. Dados recentes do relatório relativo ao Projeto Técnico
SB São Paulo 2015 (Pesquisa Estadual de Saúde Bucal, 2015) mostraram que, tanto aos cinco
quanto aos doze anos de idade, a média de dentes com experiência de cárie foi de 1,90 no estado
de São Paulo. Em Piracicaba, as médias foram de 1,63 e 1,28 aos cinco e doze anos de idade,
respectivamente, sendo que o componente cariado correspondeu a 77,9% do índice aos cinco
anos. Esses dados enfatizam a importância de se pesquisar os fatores relacionados à etiologia
da doença cárie e à identificação de crianças que possam desenvolver a CPI, não apenas devido
à alta prevalência da doença, mas também, porque a literatura evidencia que crianças com CPI
têm maior risco de desenvolvimento de cárie no futuro, sendo a experiência passada dessa
doença considerada como um dos preditores de risco mais significativos (Skeie et al., 2006;
Parisotto et al., 2012, André-Kramer et al., 2013).
Os fatores primários relacionados à etiologia da cárie são a presença de bactérias
cariogênicas, carboidratos fermentáveis e hospedeiro e/ou superfície dentária susceptíveis, que
interagem em determinado período de tempo (Harris et al., 2004; Kidd, 2011; Chafee et al.,
2015). Em crianças jovens, um elevado número de bactérias cariogênicas como Streptococcus
mutans e Lactobacillus spp., a presença de biofilme dental visível na região anterossuperior
dos dentes decíduos, práticas inadequadas de alimentação, nível socioeconômico da família e
![Page 18: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/18.jpg)
18
escolaridade da mãe têm sido identificados como os principais indicadores de risco ao
desenvolvimento de cárie (Selwitz et al., 2007; Oliveira et al., 2008; Takahashi e Nyvad, 2008;
Parisotto et al., 2010).
O biofilme dental é descrito como um grupo de microrganismos embebidos em uma
matriz de polissacarídeos extracelulares, que suporta um microssistema com bactérias que
exibem uma variedade de características fisiológicas. Essas características dizem respeito a
alguns fatores de virulência, como a capacidade de aderência, a natureza acidogênica e a
resistência em baixos níveis de pH, sendo capazes de colonizar a superfície dentária e produzir
ácidos, resultantes da fermentação de substratos (Berkowitz, 1996; Gudiño et al., 2007; Ren et
al., 2016).
A perda mineral do esmalte é explicada pelo desequilíbrio contínuo dos processos
de desmineralização e remineralização das estruturas dentárias. A desmineralização ocorre na
superfície mineralizada do esmalte e dentina, decorrente da ação dos ácidos orgânicos
produzidos pelas bactérias presentes no biofilme, que se difundem na estrutura do dente,
causando a dissolução dos tecidos, sendo vista clinicamente como lesões de manchas brancas
e, posteriormente, como cavitação (Featherstone, 2008).
Conceitos mais recentes sobre a etiologia da doença têm enfatizado a definição da
mesma como uma doença biofilme-açúcar dependente (Sheihan e James, 2015; Barnabé et al.,
2016). Dentre esses fatores, a frequência e a quantidade de sacarose ingerida têm sido
destacadas como responsáveis pelas alterações orgânicas, inorgânicas e microbiológicas que
ocorrem no biofilme dentário (Marsh, 1994; Nobre dos Santos et al., 2002; Parisotto et al.,
2010; Parisotto et al., 2015). Ainda, a Organização Mundial de Saúde (OMS) afirma que existe
uma associação positiva entre o nível de açúcar livre ingerido e acometimento de cárie e, desde
2015, tem recomendado que a ingestão de açúcares na forma livre seja menor que 10% da
ingestão total de energia diária (Organização Mundial de Saúde, 2015).
Todos os açúcares, independentemente de serem mono, di, ou polissacarídeos
servem de substrato para os microrganismos do biofilme, embora somente a sacarose sirva de
substrato específico para a produção de polissacarídeos extracelulares insolúveis (PECIs)
(Bezerra e Toledo, 2003). Esses PECIs aumentam a viscosidade do biofilme e facilitam a
aderência microbiana em grande quantidade, o que favorece a ocorrência do processo carioso.
A este respeito, evidências recentes demonstraram que pré-escolares que apresentavam uma
concentração de polissacarídeos no biofilme maior que 2,36 μg/mg tinham um risco 6,8 vezes
maior de desenvolver cárie que aqueles que apresentaram concentrações mais baixas (Parisotto
et al., 2015).
![Page 19: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/19.jpg)
19
No entendimento dos fatores que afetam o processo da doença, a saliva tem papel
fundamental como agente protetor, por meio de inúmeras funções desempenhadas na cavidade
bucal e estas, se relacionam com as características do fluido do biofilme e de seus componentes
específicos, destacando-se: o efeito de lavagem, formação do bolo alimentar, facilitação da
mastigação, ação lubrificante, fonação, deglutição, participação na formação da película
adquirida, atividade antimicrobiana e proteção dos tecidos mineralizados dos dentes pela
neutralização de ácidos, por meio de sua capacidade tampão e por suas propriedades
remineralizadoras (Edgar e Higham, 1995; Kirstilä et al., 1998). Entretanto, nem sempre a
saliva é capaz de controlar a acidez do meio, e assim, ressalta-se a necessidade do entendimento
das mudanças que ocorrem na composição microbiológica do biofilme como fator determinante
no processo de cárie (van Ruyven et al., 2000)
Marsh (1991) sugeriu que a alteração do perfil microbiológico da microflora
residente no biofilme quando comparado a certos microrganismos patógenos ocorre devido à
alteração da homeostase bacteriana, definindo então a teoria da placa ecológica, segundo a qual
tal alteração causaria mudanças na composição da microflora. Além disso, foi sugerido que o
biofilme dental acumula-se preferencialmente em sítios retentivos, desde que não seja removido
por higiene oral adequada. Como a massa de biofiome aumenta, a saliva se torna menos capaz
de penetrá-la, e proteger assim, as estruturas dentais (Marsh et al., 1994).
O entendimento das mudanças que ocorrem no biofilme que estão intimamente
relacionadas com o desenvolvimento da cárie e a identificação das crianças que estejam sob
risco de desenvolver a doença são importantes ferramentas para a prevenção da cárie dental.
Em relação à composição da microbiota do biofilme dental, crianças com CPI apresentam altas
contagens de Streptococcus mutans e Lactobacillus (Nobre dos Santos et al., 2002; Parisotto et
al., 2010). Além disso, essas crianças frequentemente apresentam hábitos de dieta inadequados,
como ingestão excessiva de carboidratos e líquidos açucarados, o que fornece maior quantidade
de sacarose como substrato para a produção de polissacarídeos extracelulares, que favorecem a
adesão e acúmulo de microrganismos (Mattos-Graner et al., 1998; Mattos-Graner et al., 2000;
Parisotto et al., 2015).
Estudos prévios sobre a CPI têm demonstrado que a quantidade das espécies de
Streptococcus mutans, Lactobacillus spp., Veillonella spp., Bifidobacterium spp. e Actinomyces
spp. é significativamente maior em crianças com cárie (Wolff et al., 2013; Tao et al., 2013; Ma
et al., 2015). Inúmeros estudos mostram que os Streptococcus mutans estão intimamente
relacionados tanto com desenvolvimento, quanto com a progressão da CPI, por serem agentes
patógenos primários (Mattos-Graner et al., 2000; Sanchez-Perez e Acosta-Gio, 2001, Nobre-
![Page 20: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/20.jpg)
20
dos-Santos et al., 2002; Berkowitz, 2003), possuírem a capacidade de sintetizar glucano
insolúvel em água para aderência bacteriana às estruturas dentais, além de serem altamente
acidogênicos e acidúricos, favorecendo assim o crescimento de espécies que sejam favorecidas
pela acidez do meio, como os Lactobacillus spp. (Takahashi e Nyvad, 2008). Ainda, os S.
mutans foram identificados em crianças livres de cárie enquanto algumas crianças com padrão
severo da CPI não tiveram níveis detectáveis de dessa espécie, o que leva ao entendimento de
que é necessária a utilização de novos métodos de identificação de possíveis agentes patógenos
ainda desconhecidos, envolvidos com a CPI (Xu et al., 2014).
Em relação aos Lactobacillus, esses microorganismos possuem pouca afinidade
pela superfície dental, colonizam principalmente a mucosa bucal e não se acumulam em grandes
quantidades no biofilme dental, tendo um papel de maior importância na progressão do que no
início do acometimento da doença (Loesche, 1986; van Houte, 1980). Outros estudos mostram
que além dos S. mutans e Lactobacillus, Actinomyces spp. também estão associados com a
cárie, enquanto que Streptococcus mitis, Streptococcus oralis e Streptococcus sanguinis
predominam na microbiota indígena de sujeitos livres de cárie (Corby et al., 2005).
Com o advento de técnicas moleculares avançadas, tem sido possível a
investigação da diversidade bacteriana e da estrutura da comunidade em diferentes habitats e a
análise do perfil microbiológico utilizando o método de Reação em Cadeia da Polimerase
(qPCR) com primers específicos, que mostrou-se um método sensível e preciso. Essa técnica
fornece a quantificação das bactérias nas amostras, permitindo que essa informação seja
relacionada à observação clínica do indivíduo, sendo que antes as técnicas formeciam
informações apenas em relação à presença ou ausência das mesmas (Hata et al., 2006) .
Assim, a compreensão das características comuns entre crianças com CPI e o
entendimento das mudanças que ocorrem no perfil microbiológico do biofilme dental formado
sobre a superfície cariada nos diferentes estágios da doença podem fornecer elementos
importantes para o desenvolvimento de novas ferramentas para a identificação e controle dos
fatores de risco, de modo a serem propostas estratégias que permitam a prevenção da doença
ou que controlem o desenvolvimento da mesma. O objetivo desta tese foi investigar a
composição microbiológica do biofilme dental formado sobre a superfície cariada nos
diferentes estágios da doença, assim como parâmetros clínicos e sociais de pré-escolares com
CPI, sendo este um estudo longitudinal de um ano.
![Page 21: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/21.jpg)
21
2 ARTIGO
Microbiological composition of dental biofilm in different stages of early childhood caries
– a longitudinal study.
*Artigo submetido à publicação no International Journal of Paediatric Dentistry (ANEXO 2)
Rodrigues LP1, Silveira GC2, Borghi GN1, Zancopé BR1, Vizoto NL3, Parisotto TM4, Stipp
RN5, Nobre-dos-Santos M6
1DDS, MS, PhD student of the Department of Pediatric Dentistry, Piracicaba Dental School,
University of Campinas, Piracicaba-SP
2Graduation student of Piracicaba Dental School, University of Campinas, Piracicaba-SP
3DDS, MS, PhD, professor of Microbiology, Anhanguera School, Piracicaba, São Paulo, Brazil.
4DDS, MS, PhD, professor of the Department of Microbiology and Molecular Biology, São
Francisco University, Bragança Paulista, Brazil
5DDS, MS, PhD, professor of the Department of Oral Diagnosis, Piracicaba Dental School,
University of Campinas, Piracicaba-SP
6DDS, MS, PhD, professor of the Department of Pediatric Dentistry, Piracicaba Dental School,
University of Campinas, Piracicaba-SP
Key words: dental caries, biofilm, preschool children, Real-time quantitative polymerase chain
reaction.
Corresponding author: Prof. Marinês Nobre dos Santos Uchôa, Avenida Limeira, 901. Zip
Code: 13414-903, Piracicaba-SP, Brazil, e-mail: [email protected], phone number: +55-
19-21065287, Fax: +55-19-21065218.
![Page 22: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/22.jpg)
22
Abstract
Aim: This longitudinal study aimed at investigating the microbiological composition of the
dental biofilm formed over dental surfaces in different stages of early childhood caries (ECC)
(early caries lesion (ECL) or cavitated caries lesion(CCL)) and determine the association among
clinical, microbiological and social variables, as well to predict the risk for ECC.
Design: This was an observational longitudinal study of 1 year in which 51 children aged 36-
60 months were selected from five preschools in Piracicaba-SP (Brazil). Visible biofilm was
recorded and caries assessment was done according to Séllos and Soviero criteria. Biofilm
samples were collected and the microbiological composition was determined by assessment of
quantities of Actinomyces naeslundii, Bifidobacterium spp., Streptococcus mutans, Veillonella
spp. and commensal group (Streptococcus mitis group and Streptococcus gordonii). A short
questionnaire was used to obtain information regarding the mother´s education level and
socioeconomic status.
Results: The mean number of decayed, missing and filled surfaces (dmfs) and decayed, missing
and filled teeth (dmft) at baseline were 4.05 ± 7.33 and 2.68 ± 4.06 respectively, and at follow-
up after 1 year were 5.45 ± 10.82 and 2.96 ± 4.13 respectively. High levels of S. mutans over
ECL showed significant association with the early stage of caries (OR=15.3) (p<0.05) as well
as with cavitated caries lesion (OR=45.5) (p<0.05). Furthermore, presence of visible biofilm
(OR= 13.1) was significantly associated with CCL (p<0.05). The social variables “mother´s
education level” and “family income per month” did not achieve statistical significance in this
study.
Conclusions: High levels of S. mutans over ECL as well as CCL are relevant factors for
initiation and progression of ECC. The presence of visible biofilm is an important clinical
parameter for ECC progression.
Introduction
Early childhood caries is defined as a multifactorial, biofilm–sucrose dependent
disease (Garcia et al., 2015; Sheiham and James, 2015), affecting deciduous teeth of children
under 71 months of age (Drury, 1999). If the disease progresses, it can lead to destruction of
the primary dentition, affecting negatively children’s physical and mental health (Cunnion et
al., 2010). Furthermore, several studies have shown that children who have ECC have an
increasing risk of developing new caries lesions in the permanent dentition (Parisotto et al.,
2012; Isaksson et al., 2013; Ng and Chase, 2013). Previous investigations showed that ECC
![Page 23: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/23.jpg)
23
causes significant economic and social burden on children, their families, and the society,
expending hundreds of million dollars annually in surgical care in United States of America
(Samnaliev et al., 2015; Bruen et al., 2016). Thus, strategies to improve prevention of early
childhood caries, including community-and family-based education, and to increase access to
timely and early dental care for low-income children could reduce the burdens and costs of this
health problem (Bruen et al., 2016).
Factors related to ECC aetiology include social, behavioral and psychological
factors, like social environment, educational level of caregivers, health behavior and oral
hygiene (Seow, 2012; Fontana, 2015). Furthermore, previous studies have emphasized the
relevance of diet and biofilm as factors that play an important role in caries development
(Sheiham and James, 2015; Parisotto et al., 2015; Bernabé et al., 2016). Previous reports of our
research group have showed that the early stage of caries is highly affected by the total sugar
exposure, mutans streptococci count and visible dental biofilm on maxillary incisors, whereas
cavities are strongly related to presence of lactobacilli, total microorganism count and a solid
sugar exposure higher than 3 times a day (Parisotto et al., 2010). Furthermore, we demonstrated
that visible dental biofilm, extracellular insoluble polysaccharides, solid sugar/sucrose and
cariogenic microorganisms could predict caries development in preschool children (Parisotto
et al., 2015), however, these studies did not demonstrate the microbiological composition of the
biofilm, considering other potentially pathogenic microorganisms for the initiation and
progression of ECC. The identification of the risk factors for ECC makes it easier to select the
most important groups of individuals to target preventive dentistry strategies.
Caries is primarily dependent on the development of cariogenic biofilms as a result
of complex interactions between oral bacteria and their acid producing ability and acid
tolerance, occurring on tooth surfaces, salivary constituents and dietary carbohydrates (Paes
Leme et al., 2006; Takahashi and Nyvad, 2008). The oral microbiome is comprised of hundreds
of microorganisms and the imbalance of the resident biofilm microflora rather than other
pathogen driven by changes in local environmental conditions may explain the occurrence of
caries (Marsh et al., 1994).
Oral species detected in children with early childhood caries include Streptococcus
mutans, Lactobacillus spp., Actinomyces spp., Bifidobacterium spp. and Veillonella spp.,
Streptococcus mitis, Streptococcus oralis and Streptococcus sanguinis are predominant in the
indigenous microbiota of caries free subjects, demonstrating that there is a distinctive
microbiota of healthy children that is different from that associated with oral disease. It has
been demonstrated that S. mitis group and S. gordonii are able to generate ammonia,
![Page 24: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/24.jpg)
24
neutralizing acid in cariogenic and favoring pH increase, which can contribute to the
inactivation of caries lesion (Kuribayashi et al, 2012). Thus, identifying all species associated
with health and disease, especially with early stage of infection, would provide alternative
targets for clinical intervention (Aas et al., 2008; Tanner et al., 2010; Wolff et al., 2013).
Regarding caries lesion initiation and progression, the work of Tanner et al. (2011)
demonstrated that the bacterial level of dental biofilm varies depending on the stage of the
disease. In this regard, Actinomyces spp. and non-S. mutans streptococci may be involved in
the initiation of the disease, while Veillonella spp. dominated the bacterial population in all
stages, from intact enamel to deep-dentin cavities (Aas et al., 2008; Tanner et al., 2011).
Moreover, the microflora of deep-dentin lesions was dominated by S. mutans, Lactobacillus
spp. and Propionibacterium spp. (Aas et al., 2008). However, these studies quantified oral
microorganisms in biofilm obtained from dental sample by pooling material collected from at
least three different teeth. Moreover, it is known that the microbiological biofilm composition
changes according to its location in the oral cavity (Shi et al., 2016). In addition, at least to our
knowledge, information regarding if children having cavitated caries lesions also possess active
early caries lesions is not available. In this way, it is relevant to assess dental biofilm samples
formed over the caries lesion, considering the different stages of ECC.
Thus, the aim of this follow up study was to investigate the microbiological
composition of the biofilm formed over dental surfaces in different stages of ECC (early caries
lesion or cavitated caries lesion). Moreover, the association among clinical, microbiological
and social variables, as well the power of these variables to predict the risk for ECC were also
investigated.
Material and methods
Ethical considerations
This study was evaluated and approved by the Ethics Committee in Research of
Piracicaba Dental School – University of Campinas (Protocol #033/2014). Parents or caregivers
who agreed with the inclusion of the children in this study signed a free and informed consent
term. The preschoolers were also consulted about the participation in this study and if they
refused to open their mouth during clinical procedures, they were not included in the current
study.
![Page 25: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/25.jpg)
25
Study population
A sample of 51 preschool children, of both genders and aged 36 to 60 months
participated of this study. These children were from low economic backgrounds and regularly
attended five urban nursery schools randomly selected from a total of 80 units in the city of
Piracicaba, São Paulo state, Brazil. The city has a population around 365 thousand inhabitants
with fluoridated public water supply (0.7 ppm F) since 1980. Children were not included from
the study if they refused to participate in any phase or if they had salivary gland disorders or
systemic diseases, severe fluorosis, dental hypoplasia, history of significant medical disease or
antimicrobial use reported by their parents within the last 3 months prior to the study. During
the period that children stayed in the preschool, they had the same diet, stayed a minimum of 5
h/day and had their teeth brushed at least once a day with fluoride containing dentifrice.
Children selected for this study were submitted to the following steps:
Baseline: Step 1: intraoral examination for caries diagnosis, dental biofilm assessment in the
maxillary incisors and biofilm collection for the microbiological analysis.
Step 2: data collection from socio-economic status, family income and mother´s
education level.
Follow-up (after 1 year): intraoral examination for caries diagnosis, dental biofilm assessment
in the maxillary incisors.
After the caries diagnosis (baseline), children were divided into three groups: (1)
Caries-free children (CF) (n=17); (2) Children having early caries lesion (ECL) (n=07); (3)
Children having cavitated caries lesion (CCL) (n=27) (Figure 1).
![Page 26: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/26.jpg)
26
Figure 1. Flow chart of participation, distribution and study design.
All children who participated in this study received a kit containing a toothbrush,
fluoride toothpaste (1100 ppm F) and oral hygiene instruction. Children who presented any
dental treatment needs were referred to the Pediatric Dentistry department at the Piracicaba
Dental School, University of Campinas, to receive comprehensive oral care.
Data about family income and mother’s education level were obtained from a
standardized questionnaire with closed questions, to assess social variables (Parisotto et al.,
2010). For income data, the question was ‘‘How much is the family income per month? (in
terms of minimum wage’’ and for mother’s education level the question addressed was ‘‘what
is your level of scholarly education?’’.
Caries diagnosis and groups allocation
(n=51)
Biofilm collection and microbiological
analysis
Assessment of social variables
Children invited to participate in the study (n= 100)
Caries-free children (CF)
(n=17)
Cavitated caries lesion children
(CCL) (n=27)
Excluded
Children with syndromes and chronic systemic diseases or using long-term antibiotics (n=8)
Parents or caregivers refuse to sign the informed consent (n=10)
Non-cooperating children (n=8)
samples with poor quality of DNA(n=23)
Early caries lesion
children (ECL) (n=7)
After 1 year: - Presence of biofilm examination - Caries diagnosis
![Page 27: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/27.jpg)
27
Calibration of the examiner and caries diagnostic criteria
Clinical examinations were performed at preschool by a single examiner,
previously calibrated (Kappa value=0.80 (at baseline and follow-up)) using mouth mirrors
under artificial light and the explorer was eventually used to clean any surface to detect dental
sealants (Kopycka-Kedzierawski and Billings, 2004). For calibration, sessions of theoretical
discussions and clinical training were conducted.
For this study, the caries diagnostic criteria according to Nyvad´s criteria adapted
to primary teeth by Séllos and Soviero (2011) was used. This criterion allows the recognizing
of the earliest stage of the disease and the codification of the signs suggestive of the activity of
caries lesion, taking into consideration the dynamic nature of the disease (Bussaneli et al.,
2015). A portable dental unit with a triple syringe, including a portable compressor (Odontocase
Basic Line, Rio de Janeiro, Brazil) was used to allow the teeth surfaces drying. For the
determination of the caries index, the decayed, missing and filled surfaces in deciduous surfaces
or teeth (dmft / dmfs) were counted in each child after tooth brushing for the mechanical
removal of biofilm.
Presence of visible biofilm
The presence or absence of clinically visible biofilm on the buccal surface of
maxillary incisors was recorded under artificial light without disclosing solution (Alaluusua
and Malmivirta et al., 1994) and with the child lying on a table. Results were recorded in the
clinical record as 0 for no visible biofilm and 1 for the presence of visible biofilm.
Bacterial strains and biofilm collection
From each child, one biofilm sample formed over early lesions cavitated carious
lesions or caries-free surfaces, not as a pool but from a single tooth, were collected using
sterilized periodontal probes (S.S. White Duflex). Samples were not pooled across other lesions
or patients. Biofilm samples were immediately transferred to sterile RNAse-free microtubes
(Axygen, Union City, Calif., USA) containing 220 µL of TE (10 mM Tris-HCl, 1mM EDTA
pH 7.6) and immediately transported to the laboratory, where they were frozen at -80°C until
the microbiological analysis.
Quantitative PCR was performed to detect the presence/absence and to permit the
quantification of targeted bacterial DNA in biofilm samples. The choice of the bacterial species
to be investigated in this study was based on previous studies showing that Streptococcus
mutans, Actinomyces naeslundii, Veillonella dispar and Bifidobacterium spp. are associated
![Page 28: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/28.jpg)
28
with early childhood caries while Streptococcus mitis group and Streptococcus gordonii are
associated with caries-free individuals. (Tanner et al., 2016; Ma et al., 2015; Aas et al., 2008;
Corby et al., 2005). Specific forward and reverse primers are listed in Table 1.
DNA extraction, purification and quantification
All biofilm samples were transferred to a 2-mL screw cap micro tube. The
mechanical disruption of bacterial cells was made by the addition of 0.16 g of 0.1 mm diameter
zirconium beads to each biofilm sample, using a Mini-Beadbeater (Biospec Products Inc.,
Bartlesville, Okla., USA) at maximum power (1 cycle of 60 s). The DNA purification was
performed by phenol-chloroform and alcohol precipitation method (Wilson, 2001). The RNA
was removed by adding RNase (40min / 40° C), and the DNA precipitated in the presence of
isopropanol, salts and low temperature (-20° C). The nucleic acid was resuspended in TE
solution and the samples were stored at -20° C. DNA concentration and purity (A260nm/A280nm
and A260nm/A230nm) were measured with Nanodrop 2000c (Thermo Scientific, Wilmington, Del.,
USA). DNA integrity was verified by agarose gels.
Quantitative Real-Time PCR (qPCR) for quantification of target bacterial DNA
The primers specificity in human samples was tested in previous studies (Nadkarni
et al., 2002; Rinttilä et al., 2004; Furet et al., 2004; Yano et al., 2002; Wolff et al., 2013).
Dilutions starting from 300 to 0.0003 ng (10-fold) of purified DNA were used as standards and
positive controls for relative quantification of the targeted bacteria. A standard amplification
curve and a melting-point product curve were obtained for each primer set. The qPCR assays
were carried out in duplicate in a StepOne TM Real Time PCR System (Applied Biosystems,
Foster City, CA, USA) using a MicroAmpFast Optical 48-Well Reaction Plate (Applied)
covered with Optical Adhesive Film (Applied Biosystems). Assays were carried out in
duplicate and the mean of the two reactions were used to the analyzes. The reaction mixture (10
μL) included 5 μL of 2x Power SYBR-Green PCR Mix master (Applied Biosystems, USA), 0.3
μL of each primer (forward and reverse 10μM), 1μL of DNA sample and (10 ng/μL) and 3.4
μL of nuclease free-water. Negative control included reactions without template. The standard
curves were used to transform the cycle threshold values to the amplified DNA mass. The cycle
threshold (Ct) values were transformed to the mass of DNA using the standard curves The
results of the concentrations of bacteria in biofilm samples were normalized relative to the total
bacterial load estimated by the primer Bacteria 16S rDNA (Nadkarni et al., 2002).
![Page 29: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/29.jpg)
29
Table 1. Primers for bacterial identification used in q-PCR
Bacteria Primer Sequence (5´ 3´) Annealing
temperature
(°C)
Amplicon size
(bp)
References
16S rDNA F:TCCTACGGGAGGCAGCAGT
R:GGACTACCAGGGTATCTAATCCTGTT 57 466 Nadkarni et
al., 2002
Actinomyces
naeslundii
F:CTGCTGCTGGACATCGCCGCTCGTA
R:TCCGCTCGCGCCACCTCTCGTTA 62 144 Nadkarni et
al., 2002
Bifidobacterium spp.1 F:TCGCGTC(C/T)GGTGTAAAG
R:CCACATCCAGC(A/G)TCCAC 58 243 Rinttilä et al.,
2004
Mitis group2 F:TAGAACGCTGAAGGAAGGAGC
R:GCAACATCTACTGTTATGCGG 60 133 Wolff et al.,
2013
Streptococcus gordonii F:CAGGAAGGGATGTTGGTGTT
R:GACTCTCTTGGCGACGAATC
62 136 Wolff et al.,
2013
Veillonella spp.3 F:AACGCGTAATCAACCTGCC
R:CTTTCATCTATCGATGCC
62 115 Wolff et al.,
2013
Streptococcus mutans F:AGCCATGCGCAATCAACAGGTT
R:CGCAACGCGAACATCTTGATCAG 64 415 Yano et al.,
2002
1. Bifidobacterium longum, B. minimum, B. angulatum, B. catenulatum, B. pseudocatenulatum,
B. dentium, B. ruminantium, B. thermophilum, B. subtile, B. bifidum, B. boum, B. lactis, B.
animalis, B. choerinum, B. gallicum, B. pseudolongum subsp. globosum, B. pseudolongum
subsp. pseudolongum, B. magnum, B. infantis, B. indicum, B. gallinarum, B. pullorum, B.
saeculare, B. suis 2. Mitis group: Streptococcus mitis, S. oralis, S. pneumoniae, S. parasanguinis, S. australis 3. Veillonella parvula, V. dispar
F = Forward; R = reverse
Statistics
Descriptive statistics (means, standard deviations) were performed considering
caries status (caries-free, early caries lesion or cavitated lesion) as the dependent variables. The
proportion of caries-free children and the mean dmfs⁄dmft scores were also calculated. The
independent variables were presence of visible biofilm and microbiological composition of the
biofilm, as well as social variables. The Shapiro–Wilk test was used to assess data normality.
All independent variables were dichotomized, considering the interquartile range or in presence
/ absence, when categorical variables. These variables were initially tested (chi-square or
Fisher's exact test) in a bivariate analysis in order to verify possible associations between
dependent and independent variables. Multivariate regression was performed with the variables
![Page 30: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/30.jpg)
30
that showed a p-value lower than 0.2. The multivariate modelling process was stepwise, so that
the variables were included in the model one by one and the associations between dependent
and independent variables were expressed as odds ratios (OR) with their respective 95%
confidence intervals to identify the factors that could predict ECC development. The
nonparametric Kruskal-Wallis test was performed to compare the abundance of species
between the groups. Statistical analyses were performed using SPSS 16.0 version software
(Statistical Package for Social Science Inc., Chicago, Ill., USA), using a significance level set
at 5% and a confidence interval of 95%.
Results
The final sample consisted of 51 children aged 36-60 months, the mean age of
children in this study was 50 months and 52.9% were female. Table 2 shows the sample mean
number of dmft and dmfs at baseline and at follow-up, as well as the one year caries increment
Table 2. Means and standard deviations of decayed, missing and filled surfaces (dmfs) and
teeth (dmft) according to Séllos and Soviero criterion.
Caries index Baseline (n=51) Follow-up (n=51) 1-year increment (n=51)
dmfs 4.05 ± 7.33 5.45 ± 10.82 1.44 ± 3.84
dmft 2.68 ± 4.06 2.96 ± 4.13 0.60 ± 1.66
The results of the qPCR analysis are presented in Figure 2. Children with early
caries lesions and with cavitated caries lesions showed a significantly greater proportion of S.
mutans than caries-free children (p <0.05). In addition, the results evidenced significantly
increased percentage of Bifidobacterium spp. only in children having cavitated caries lesions
(p <0.05). Moreover, there was no statistically significant difference among groups regarding
levels of Actinomyces naeslundii, Veillonella spp., Streptococcus mitis group and Streptococcus
gordonii.
![Page 31: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/31.jpg)
31
Figure 2. Medians and interquartile ranges of relative percentages of bacterial species from
dental biofilm over dental surfaces in different stages of caries (early caries lesion and cavitated
carious lesion). Different letters indicate statistically significant differences among groups in
the same species. Differences evaluated by Kruskal -Wallis test followed by the post-hoc
Student- Newman-Keuls test (p <0.05). CF (caries-free); ECL (early caries lesion); CCL
(cavitated carious lesion).
![Page 32: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/32.jpg)
32
To investigate the association between different ECC stages, microbiological
composition, presence of dental biofilm, mother´s education level as well as family income per
month, a bivariate analysis was performed. From Table 3 it is evident that the factors that
showed statistically significant association with ECL were percentages of mutans streptococci
and Bifidobacterium spp. and presence of visible dental biofilm on the maxillary incisors (Table
2). In addition, these variables together with the ones that showed a p-value lower than 0.2 were
submitted to a stepwise multiple logistic regression analysis in order to find the best model
possibility. Regarding the CF versus ECL group, the bivariate analysis revealed that
Streptococcus mutans was the only significant factor for ECL (Table 3). After the stepwise
multivariate analysis, it was verified that Streptococcus mutans was strongly associated with
early carious lesions, with an OR of 15.3. This model was adjusted by Veillonella spp., S.
gordonii and S. mitis group (Table 4). The bivariate analysis also evidenced that the significant
factors for CCL were Streptococcus mutans, Bifidobacterium spp. and presence of dental
biofilm (Table 3). Furthermore, high levels of S. mutans and the presence of visible biofilm on
the buccal surfaces of upper incisors were strongly associated with the development of cavitated
caries lesion, with an OR of 45.5 and 13.1 respectively. This model was adjusted by percentages
of Veillonella spp., S. gordonii and S. mitis group (Table 4).
![Page 33: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/33.jpg)
33
Table 3. Bivariate analysis of the relationship between different stages of early childhood
caries and related factors.
Variables CF x ECL CF x CCL
n(%) n(%)
Streptococcus mutansa 0.001* <0.0001*
< 6,3% 15(88) 1(15) 15(88) 4(15)
6,3% 2(12) 6(85) 2(12) 23(85)
Actinomyces naeslundiia 0.647 0.319
< 18,14% 5(30) 3(43) 5(30) 12(45)
18,14% 12(70) 4(57) 12(70) 15(55)
Veillonella spp.a 0.191 0.150
< 6,20% 8(47) 1(15) 8(47) 7(26)
6,20% 9(53) 6(85) 9(53) 20(74)
Bifidobacterium spp.a 1.000 0.001*
< 0,4% 15(88) 6(85) 15(88) 9(33)
0,4% 2(12) 1(15) 2(12) 18(67)
Mitis groupa 0.283 0.735
< 0,56% 4(24) 1(15) 4(24) 9(33)
0,56% 13(76) 6(85 13(76) 18(67)
Streptococcus gordoniia 0.065 0.977
< 0,46% 7(41) 1(15) 7(41) 11(41)
0,46% 10(59) 6(85) 10(59) 16(59)
Visible dental biofilm 0.085 0.001*
Absent 12(70) 2(28) 12(71) 5(19)
Present 5(30) 5(72) 5(29) 22(81)
Mother´s education level 0.085 0.054
< complete first grade 5(30) 5(72) 5(29) 16(59)
complete first grade 12(70) 2(28) 12(71) 11(41)
Family income per month 0.393 0.211
< 2 minimum wage 11(65) 3(43) 15(88) 9(33)
2 minimum wage 6(35) 4(57) 2(12) 18(67)
*Significant results evaluated by the Chi-square or Fisher´s Exact test (α = 0,05). Fisher´s
Exact test was applied when the frequencies were smaller than 5. CF (caries-free); ECL
(early caries lesion); CCL (cavitated carious lesion). aRelative percentage to the total
bacteria identified by 16S gene.
![Page 34: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/34.jpg)
34
Table 4. Multivariate modeling of different stages of caries lesions development regarding the
Streptococcus mutans relative concentration and presence of dental biofilm.
OR: odds ratio; CI: confidence interval.1 Likelihood Ratio Test = 14.59 (4 degrees of freedom);
Hosmer & Lemeshow: p=0.99. Model adjusted by Veillonella spp., S. gordonii, S.mitis group.
2Likelihood Ratio Test = 32.38 (3 degrees of freedom). Hosmer & Lemeshow: p=0.24. Model
adjusted by Bifidobacterium spp.
Discussion
Previous investigations have shown that determinants of oral health, mainly the
individual level such as oral microflora, diet and oral hygiene have greatly influenced oral
health of children with regard to caries presence and activity of the lesions (Neves et al., 2016;
Parisotto et al., 2015; Gilbert et al., 2014; Parisotto et al., 2010). Thus, this study investigated
if microbiological composition, presence of visible dental biofilm and social factors could be
able to predict the ECC development, considering the different stages of the disease. The
bacterial microflora present in the dental biofilm is considered to be a highly relevant factor in
the formation and progression of dental caries. For this reason, the understanding of the role of
the microbiome in the pathology of caries is notably important, to allow the knowledge of which
bacteria are associated with different types and stages of the disease (Tanner et al., 2016). In
Variables
Caries development
No (%) Yes (%) OR (95%CI) p-value
Mo
del
1:
CF
x E
CL
S. mutans
0.048
< 6,3%
15 (94) 1(6) 1
6,3%
2 (25) 6 (75) 15.3 (1.03-227.48)
Mo
del
2:
CF
x C
CL
S. mutans
0.003
0.034
< 6,3% 15(79) 4(21) 1
6,3% 2(8) 23(92) 45.5(3.58-579.81)
Biofilm
Absent 12(71) 5(29) 1
Present 5(19) 22(81) 13.1(1.22-139.91)
![Page 35: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/35.jpg)
35
this regard, cross-sectional studies provide valuable information regarding factors related to
caries development. However, longitudinal studies can add further evidence to the
understanding of the disease process in young children.
In this regard, results of the present study showed that the percentage of S. mutans
was significantly higher in biofilm formed over the ECC than in biofilm from sound enamel
surfaces. Furthermore, concerning the bacterial microflora present in the biofilm of the group
of children with the ECL, results of the current study showed that children with higher
percentages of S. mutans were 15 times more likely to develop the early stage of caries when
compared with caries free children (Table 4). This finding is in accordance with several studies
showing that S. mutans in both saliva and dental biofilm samples was found to be strongly
associated with ECC (Gross et al., 2012; Tanner et al., 2011; Parisotto et al., 2010), however,
all these studies were cross-sectional, not being able to explain the modification in the biofilm
composition related to progression of the ECC. In the same way, the study of Gross et al. (2012)
showed that mean levels of S. mutans were higher in ECL samples at baseline from subjects
who subsequently developed caries, after one year. In addition, early studies have identified
several bacterial species like S. mutans, Actinomyces spp. and S. sobrinus, to be strongly
associated with ECC in both saliva and supragingival biofilm samples.
Early caries lesion is the first clinical sign of caries lesion development, both in
primary and permanent dentitions and several studies have identified the major species involved
in the initiation of ECC like S. mutans, non-mutans Streptococcus spp., Lactobacillus spp.,
Scardovia spp., Prevotella spp., Bifdobacterium spp. and Veillonella spp. (Aas et al., 2008;
Becker et al., 2002; Torlakovic et al., 2012). These studies also showed that bacterial species
diversity is reduced in carious as compared with healthy sites, suggesting that an acidic
environment suppresses acid-sensitive bacteria (Gross et al., 2012). Thus, the detection of
specific bacteria associated with ECC may facilitate specific preventive strategies and treatment
approaches of children with the disease (Tao et al., 2013; Ma et al., 2015).
In relation to the cariogenic potential of biofilm formed over cavitated caries
lesions, children who had percentages of S. mutans equal or higher than 6,3% (of the total
bacteria in the sample) were 45 times more likely to develop caries with cavitation (Table 4).
This result is in line with an early cross- sectional investigation by our research group (Parisotto
et al., 2010). In the current study, we found a very high prediction value for cavitated carious
lesions. The possible explanation for this finding could be that as shown in Figure 2, the
percentage of S. mutans in biofilm formed over cavitated carious lesions was 85 times higher
than that found in biofilm formed over caries-free surfaces and 12.5 times higher than that found
![Page 36: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/36.jpg)
36
in biofilm over active early caries lesions. As a second possible explanation for this finding is
that the investigations by Kreth et al. (2006) showed that as a consequence of it’s acid
generation and the acid tolerance properties, and its ability to form biofilms and produce
extracellular glycans, S. mutans keeps a high cariogenic potential. In summary, by the time
these virulence factors are phenotypically expressed by strains of S. mutans and other oral
microorganisms and are working coordinately, the dental biofilm becomes altered into a state
of progressive cariogenic potential (Argimón and Caufield, 2016).
In the current study, the levels of the S. mitis group and S. gordonii were determined
because previous studies found that these species are beneficial regarding dental caries (Corby
et al., 2005; Wolff et al., 2013; Tao et al., 2013). S. gordonii competes with other bacteria by
producing a bacteriocin or excreting hydrogen peroxide to trigger the lysis of competitors
during initial colonization, delaying Streptococcus mutans colonization (Kreth et al., 2008). S.
sanguini, S. mitis and S. gordonii are pioneering bacteria that colonize and form dental biofilm
over caries-free tooth surfaces (Becker et al., 2002) In our study, the percentages of S. gordonii
and S. mitis group did not achieve statistical difference between the groups, but S. gordonii
showed increased percentages in ECC when compared with CF and CCL groups and S. mitis
group showed approximately the same proportion in ECC and CCL when compared with CF
group (Figure 2). This data may be a result of competition of these microorganisms with other
species not evaluated in this study like S. sanguinis. Our results were not able to show a
significant difference in the percentage level of these species among groups, probably because
differently from other investigators who collected dental biofilm from four different sites, in
the present study, samples were collected from a single surface and did not collected as a pool
(Shi et al., 2016).
Regarding the other bacterial species evaluated in this study, there was no
significant difference in the percentage of the Actinomyces naeslundii among the groups (Figure
2). In this respect, it is known that Actinomyces spp. are intimaly related to the earliest stage of
ECC (Jiang et al., 2014). It is a commensal species from human oral cavity, producing lactate
and participating in the bacterial aggregation stage in the dental biofilm formation, being
considered as a risk marker for ECC in caries free children (Ma et al., 2015). The difficult to
detect the real percentages of Actinomyces naeslundii in the samples of the current study may
be the reason for the results found. The study of Kanasi et al. (2010) reports a lack of detection
of Actinomyces spp. in the samples, probably due to the DNA extraction and bacterial lysis
methods, PCR and primer bias.
![Page 37: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/37.jpg)
37
Concerning Veillonella spp., this microorganism has also been related to the initial
stage of the caries lesion and is considered as a predictor for future caries microorganism (Gross
et al., 2012). Veillonella spp. levels may serve as a sensitive biologic indicator and early
warning of acid production. In a recent study with caries-free children, Veillonella spp., but not
S. mutans or other acid-producing species, predicted future caries development (Gross et al.,
2012). This microorganism uses lactate as a metabolic carbon source and takes part in the
coaggregation of several oral bacteria like Streptococcus spp., Eubacterium saburreum and
Actinomyces viscosus (Aas et al., 2008). In the current study, biofilm from ECL, as well as from
CCL presented increased relative percentages of Veillonella spp. when compared with
percentages in biofilm from caries-free children. However, results did not achieve statistical
significant differences, which is contrary to the findings of Jiang et al. (2013) and Aas et al.
(2008). These authors pointed that Veillonella spp. are frequently found in the first stages of
caries and enhances the growth of S. mutans, suggesting a close symbiotic relationship between
these species. However, it should be noted that from each subject, these authors collected
pooled supragingival biofilm samples from intact buccal surfaces of four different sites,
including surfaces from anterior and posterior teeth and in our study, samples were collected
from biofilm formed over the ECL as well as from the CCL and from sound enamel surfaces.
The results showed higher levels of Bifidobacterium spp. (Figure 2) in biofilm from
children with the cavitated caries. This result is in line with some studies (Becker et al., 2002;
Aas et al., 2008) and with the recent investigation by Kanasi et al. (2010) that concluded that
this species is a candidate of a new caries pathogen. Furthermore, the study of Becker et al.
(2002) showed that bifdobacteria may be the major pathogen in deep carious lesion in young
children, suggesting that these bacteria may provide additional targets for biological
interventions to prevent caries progression.
As dental caries is a multifactorial disease, social factors like mother´s education
level and family income were evaluated in this study. However, these factors did not achieve
statistical significance in the bivariate analysis for early carious lesions as well for cavitated
carious lesions (Table 2). There are studies demonstrating the relationship between these social
factors and ECC (Hallett and O´Rourke, 2006; Oliveira et al., 2008; Seow, 2012). One possible
explanation for these different findings could be that the sample of this study was homogeneous
and comprised of children from low-income families. These results emphasize the importance
of performing studies comparing children of different social and cultural background, who
attend public and private schools and live in different demographic areas.
![Page 38: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/38.jpg)
38
The presence of visible dental biofilm on the upper incisors was also assessed in
this study, to allow the understanding that the biofilm accumulation may be associated with
caries development. Results of the present study demonstrated that the presence of visible
dental biofilm must be considered as a risk factor for development of the most advanced stage
of the caries lesion. This result is in line with previous studies by our group (Parisotto et al.,
2010; Parisotto et al., 2015, Borghi et al., 2016). Furthermore, children who had clinically
visible biofilm on the buccal surfaces of the upper anterior teeth were 13 times more likely to
develop CCL as compared with children who did not have biofilm in the same region. Dental
caries is a dynamic process and it is the result of a chemical dissolution brought about by
metabolic activity in a microbial deposit (biofilm) covering a tooth surface at any given time.
Thus, the understanding that caries occurs as a consequence of biofilm metabolism is of extreme
clinical importance, since biofilm control and sugar exposure are the most important aspects of
the preventive strategy to be prioritized (Sheiham and James, 2015; Bernabé et al., 2016).
A limitation of the present study was that we did not assess the frequency of sugar
exposure of children from our study, making it impossible to discuss the influence of the sugar
exposure in the microbial composition of biofilm in the subjects of this study. Thus, further
studies investigating the behavior of the consumption of sugar could explain the results in a
better way. Another limitation of this study was that we did not determine the microbiological
composition of biofilm at follow-up to provide information on how these species behave
according to caries progression and further studies are strongly encouraged. In this sense,
longitudinal studies are carried out at more than one-time point, allowing a better understanding
regarding the possible risk factors of a disease, showing not just the association between the
variables and the upshot, but more importantly the factors that can predict the disease. In
summary, the etiology of ECC is multifactorial and complex, involving a range of individual’s
aspects, like the environmental, behavioral, socioeconomical and biological factors (Fontana,
2015). Thus, there is a clear need to understand the possible causes of this disease, and we have
to understand that dental caries is not just cavitation in teeth, but it is a pathogenic process in
which accumulation of biofilm is generally the first manifestation of the disease (Bowen, 2015).
Conclusion
In summary, our data showed that the very high percentages of Streptococcus
mutans in biofilm formed over early caries lesion as well as over cavitated caries lesion can
![Page 39: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/39.jpg)
39
predict the development of the initiation and progression of early childhood caries, explaining
to a certain degree the ECC pattern.
Why this paper is important to pediatric dentists
- Early childhood caries is the most prevalent oral disease in preschool children;
- The study of the microbiological composition of biofilm may provide information about
the behavior of the biofilm community in the caries initiation and progression;
- The presence of visible dental biofilm may be considered as the easiest clinical predictor
to caries risk development.
Acknowledgments
The authors thank all the preschool children, caregivers as well as their parents for
their valuable participation in this study. This study was based on a thesis submitted by the first
author to the Piracicaba Dental School, University of Campinas, in partial fulfillment of the
requirements for PhD degree in Dentistry (Pediatric Dentistry). This study was supported by
the National Council for Scientific and Technological Development (CNPq) (141312/2013-0).
Conflict of interest
The authors declare no conflict of interest.
References
1. Garcia R, Borrelli B, Dhar V, Douglass J, Gomez FR, Hieftje K, Horowitz A, Li Y, Ng MW,
Twetman S, Tinanoff N. Progress in Early Childhood Caries and Opportunities in Research,
Policy, and Clinical Management. Pediatr Dent. 2015 May-Jun;37(3):294-9.
2. Sheiham A, James WP. Diet and Dental Caries: The Pivotal Role of Free Sugars
Reemphasized. J Dent Res. 2015 Oct;94(10):1341-7.
3. Drury TF, Horowitz AM, Ismail AI, Maertens MP, Rozier RG, Selwitz RH. Diagnosing and
reporting early childhood caries for research purposes. A report of a workshop sponsored by
the National Institute of Dental and Craniofacial Research, the Health Resources and Services
Administration, and the Health Care Financing Administration. J Public Health Dent.
1999;59(3):192-7.
![Page 40: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/40.jpg)
40
4. Cunnion DT, Spiro A 3rd, Jones JA, Rich SE, Papageorgiou CP, Tate A, Casamassimo P,
Hayes C, Garcia RI. Pediatric oral health-related quality of life improvement after treatment of
early childhood caries: a prospective multisite study. J Dent Child (Chic). 2010 Jan-
Apr;77(1):4-11.
5. Isaksson H, Alm A, Koch G, Birkhed D, Wendt LK. Caries prevalence in Swedish 20-year-
olds in relation to their previous caries experience. Caries Res. 2013;47(3):234-42.
6. Ng MW, Chase I. Early childhood caries: risk-based disease prevention and Management.
Dent Clin North Am. 2013 Jan;57(1):1-16.
7. Parisotto TM, Santos MN, Rodrigues LK, Costa LS. Behavior and progression of early
carious lesions in early childhood: a 1-year follow-up study. J Dent Child (Chic).
2012;79(3):130-5.
8. Samnaliev M, Wijeratne R, Kwon EG, Ohiomoba H, Ng MW. Cost-effectiveness of a disease
management program for early childhood caries. J Public Health Dent. 2015 Winter;75(1):24-
33.
9. Bruen BK, Steinmetz E, Bysshe T, Glassman P, Ku L. Potentially preventable dental care in
operating rooms for children enrolled in Medicaid. J Am Dent Assoc. 2016 Sep;147(9):702-8.
10. Seow WK. Environmental, maternal, and child factors which contribute to early childhood
caries: a unifying conceptual model. Int J Paediatr Dent. 2012;22(3):157–68.
11. Fontana M. The Clinical, Environmental, and Behavioral Factors That Foster Early
Childhood Caries: Evidence for Caries Risk Assessment. Pediatr Dent. 2015 May-
Jun;37(3):217-25.
12. Parisotto TM, Stipp R, Rodrigues LK, Mattos-Graner RO, Costa LS, Nobre-Dos-Santos M.
Can insoluble polysaccharide concentration in dental plaque, sugar exposure and cariogenic
microorganisms predict early childhood caries? A follow-up study. Arch Oral Biol. 2015
Aug;60(8):1091-7
![Page 41: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/41.jpg)
41
13. Bernabé E, Vehkalahti MM, Sheiham A, Lundqvist A, Suominen AL. The Shape of the
Dose-Response Relationship between Sugars and Caries in Adults. J Dent Res. 2016
Feb;95(2):167-72.
14. Parisotto TM, Steiner-Oliveira C, Duque C, Peres RC, Rodrigues LK, Nobre-dos-Santos
M. Relationship among microbiological composition and presence of dental plaque, sugar
exposure, social factors and different stages of early childhood caries. Arch Oral Biol.
2010;55(5):365-73.
15. Paes Leme AF, Koo H, Bellato CM, Bedi G, Cury JA. The role of sucrose in cariogenic
dental biofilm formation--new insight. J Dent Res. 2006 Oct;85(10):878-87. Review.
16. Takahashi N, Nyvad B. Caries ecology revisited: microbial dynamics and the caries process.
Caries Res 2008;42:409–18.
16. Marsh PD. Microbial ecology of dental plaque and its significance in health and disease.
Adv Dent Res. 1994 Jul;8(2):263-71. Review.
17. Kuribayashi M, Kitasako Y, Matin K, Sadr A, Shida K, Tagami J (2012) Intraoral pH
measurement of carious lesions with qPCR of cariogenic bacteria to differentiate caries activity.
J Dent 40:222–228
18. Aas JA, Griffen AL, Dardis SR, Lee AM, Olsen I, Dewhirst FE, Leys EJ, Paster BJ. Bacteria
of dental caries in primary and permanent teeth in children and young adults. J Clin Microbiol.
2008 Apr;46(4):1407-17.
19. Tanner AC, Kressirer CA, Faller LL. Understanding Caries From the Oral Microbiome
Perspective. J Calif Dent Assoc. 2016 Jul;44(7):437-46. Review.
20. Wolff D, Frese C, Maier-Kraus T, Krueger T, Wolff B. Bacterial biofilm composition in
caries and caries-free subjects. Caries Res. 2013;47(1):69-77.
![Page 42: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/42.jpg)
42
21. Tanner AC, Kent RL Jr, Holgerson PL, Hughes CV, Loo CY, Kanasi E, Chalmers NI,
Johansson I. Microbiota of severe early childhood caries before and after therapy. J Dent Res.
2011 Nov;90(11):1298-305.
22. Shi W, Qin M, Chen F, Xia B. Supragingival Microbial Profiles of Permanent and
Deciduous Teeth in Children with Mixed Dentition. PLoS One. 2016 Jan 11;11(1):e0146938.
23. Kopycka-Kedzierawski DT, Billings RJ. A longitudinal study of caries onset in initially
caries-free children and baseline salivary mutans streptococci levels: a Kaplan-Meier survival
analysis. Community Dent Oral Epidemiol. 2004 Jun;32(3):201-9.
24. Séllos MC, Soviero VM. Reliability of the Nyvad criteria for caries assessment in primary
teeth. Eur J Oral Sci. 2011 Jun;119(3):225-31.
25. Bussaneli DG, Restrepo M, Boldieri T, Albertoni TH, Santos-Pinto L, Cordeiro RC.
Proximal caries lesion detection in primary teeth: does this justify the association of diagnostic
methods? Lasers Med Sci. 2015 Dec;30(9):2239-44.
26. Alaluusua S, Malmivirta R. Early plaque accumulation--a sign for caries risk in young
children. Community Dent Oral Epidemiol. 1994;22:273-6.
27. Ma C, Chen F, Zhang Y, Sun X, Tong P, Si Y, Zheng S. Comparison of oral microbial
profiles between children with severe early childhood caries and caries-free children using the
human oral microbe identification microarray. PLoS One. 2015 Mar 30;10(3):e0122075.
28. Corby PM, Lyons-Weiler J, Bretz WA, Hart TC, Aas JA, Boumenna T, Goss J, Corby AL,
Junior HM, Weyant RJ, Paster BJ. Microbial risk indicators of early childhood caries. J Clin
Microbiol. 2005 Nov;43(11):5753-9.
29. Wilson K (2001) Preparation of genomic DNA from bacteria. Curr Protoc Mol Biol Chapter
2:Unit 2.4. doi : 10.1002/ 0471142727.mb0204s56
![Page 43: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/43.jpg)
43
30. Nadkarni MA, Martin FE, Jacques NA, Hunter N. Determination of bacterial load by real-
time PCR using a broad-range (universal) probe and primers set. Microbiology. 2002
Jan;148(Pt 1):257-66.
31. Rinttilä T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of
16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal
samples by real-time PCR. J Appl Microbiol. 2004;97(6):1166-77
32. Furet JP, Quénée P, Tailliez P. Molecular quantification of lactic acid bacteria in fermented
milk products using real-time quantitative PCR. Int J Food Microbiol. 2004 Dec 15;97(2):197-
207.
33. Yano A, Kaneko N, Ida H, Yamaguchi T, Hanada N. Real-time PCR for quantification of
Streptococcus mutans. FEMS Microbiol Lett. 2002 Nov 19;217(1):23-30.
34. Neves BG, Stipp RN, da Silva Bezerra D, de Figueiredo Guedes SF, Rodrigues LK.
Molecular detection of bacteria associated to caries activity in dentinal lesions. Clin Oral
Investig. 2016 Nov 12 [Epub ahead of print].
35. Gilbert K, Joseph R, Vo A, Patel T, Chaudhry S, Nguyen U, Trevor A, Robinson E,
Campbell M, McLennan J, Houran F, Wong T, Flann K, Wages M, Palmer EA, Peterson J,
Engle J, Maier T, Machida CA. Children with severe early childhood caries: streptococci
genetic strains within carious and white spot lesions. J Oral Microbiol. 2014 Oct 29;6.
36. Gross EL, Beall CJ, Kutsch SR, Firestone ND, Leys EJ, Griffen AL. Beyond Streptococcus
mutans: dental caries onset linked to multiple species by 16S rRNA community analysis. PLoS
One. 2012;7(10):e47722.
37. Becker MR, Paster BJ, Leys EJ, Moeschberger ML, Kenyon SG, Galvin JL, Boches SK,
Dewhirst FE, Griffen AL. Molecular analysis of bacterial species associated with childhood
caries. J Clin Microbiol. 2002;40:1001–9.
38. Torlakovic L, Klepac-Ceraj V, Ogaard B, Cotton SL, Paster BJ, Olsen I. Microbial
community succession on developing lesions on human enamel. J Oral Microbiol. 2012;4.
![Page 44: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/44.jpg)
44
39. Tao Y, Zhou Y, Ouyang Y, Lin HC. Association of oral streptococci community dynamics
with severe early childhood caries as assessed by PCR-denaturing gradient gel electrophoresis
targeting the rnpB gene. J Med Microbiol. 2015 Aug;64(8):936-45
40. Kreth J, Merritt J, Zhu L, Shi W, Qi F. Cell density- and ComE-dependent expression of a
group of mutacins and mutacin-like gene in Streptococcus mutans. FEMS Microbiol Lett 2006;
265.
41. Argimón S, Caufield PW. Distribution of putative virulence genes in Streptococcus mutans
strains does not correlate with caries experience. J Clin Microbiol. 2011 Mar;49(3):984-92.
42. Kreth J, Zhang Y, Herzberg MC. Streptococcal antagonism in oral biofilms: Streptococcus
sanguinis and Streptococcus gordonii interference with Streptococcus mutans. J Bacteriol. 2008
Jul;190(13):4632-40.
43. Kanasi E, Dewhirst FE, Chalmers NI, Kent R Jr, Moore A, Hughes CV, Pradhan N, Loo
CY, Tanner AC. Clonal analysis of the microbiota of severe early childhood caries. Caries Res.
2010;44(5):485-97.
44. Jiang W, Zhang J, Chen H. Pyrosequencing analysis of oral microbiota in children with
severe early childhood dental caries. Curr Microbiol. 2013 Nov;67(5):537-42.
45. Hallett KB, O’Rourke PK. Pattern and severity of early childhood caries. Community
Dent Oral Epidemiol 2006;34:25– 35.
46. Oliveira LB, Sheiham A, Bönecker M. Exploring the association of dental caries with social
factors and nutritional status in Brazilian preschool children. Eur J Oral Sci. 2008;116(1):37-
43.
47. Borghi GN, Rodrigues LP, Lopes LM, Parisotto TM, Steiner-Oliveira C, Nobre-Dos-Santos
M. Relationship among α amylase and carbonic anhydrase VI in saliva, visible biofilm, and
early childhood caries: a longitudinal study. Int J Paediatr Dent. 2016 Jul 19.
![Page 45: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/45.jpg)
45
3 CONCLUSÃO
Altos níveis de S. mutans sobre lesões de cárie ativa, assim como sobre lesões
cavitadas, são fatores relevantes para o início e progressão da CPI. A presença de biofilme
clinicamente visível é um importante parâmetro clínico para progressão da CPI.
![Page 46: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/46.jpg)
46
___________________________ * De acordo com as normas da UNICAMP/FOP, baseadas na padronização do International Committee of Medical
Journal Editors - Vancouver Group. Abreviatura dos periódicos em conformidade com o PubMed
.
REFERÊNCIAS*
Abanto J, Carvalho TS, Mendes FM, Wanderley MT, Bönecker M, Raggio DP. Impact of oral
diseases and disorders on oral health-related quality of life of preschool children. Community
Dent Oral Epidemiol. 2011 Apr;39(2):105-14.
André Kramer AC, Skeie MS, Skaare AB, Espelid I, Ostberg AL. Caries increment in primary
teeth from 3 to 6 years of age: a longitudinal study in Swedish children. Eur Arch Paediatr Dent.
2014 Jun;15(3):167-73.
Berkowitz RJ. Causes, treatment and prevention of early childhood caries: a microbiologic
perspective. J Can Dent Assoc. 2003;69(5):304-7.
Bernabé E, Vehkalahti MM, Sheiham A, Lundqvist A, Suominen AL. The Shape of the Dose-
Response Relationship between Sugars and Caries in Adults. J Dent Res. 2016 Feb;95(2):167-
72.
Bezerra ACB, Toledo OA. Nutrição, dieta e cárie. In: Krieger, L. Editores. Promoção de saúde
bucal - ABROPEV, 3. Ed. Artes médicas: São Paulo; 2003:43- 69.
Chaffee BW, Feldens CA, Rodrigues PH, Vítolo MR. Feeding practices in infancy associated
with caries incidence in early childhood. Community Dent Oral Epidemiol. 2015Aug; 43(4):
338-48.
Corby, P. M., J. Lyons-Weiler, W. A. Bretz, T. C. Hart, J. A. Aas, T. Boumenna, J. Goss, A. L.
Corby, H. M. Junior, R. J. Weyant, and B. J. Paster. Microbial risk indicators in early childhood
caries. J. Clin. Microbiol. 2005; 43:5753–5759.
Drummond BK, Meldrum AM, Boyd D. Influence of dental care on children's oral health and
wellbeing. Br Dent J. 2013 Jun;214(11):E27.
![Page 47: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/47.jpg)
47
Drury TF, Horowitz AM, Ismail AI, Maertens MP, Rozier RG, Selwitz RH. Diagnosing and
reporting early childhood caries for research purposes. A report of a workshop sponsored by
the National Institute of Dental and Craniofacial Research, the Health Resources and Services
Administration, and the Health Care Financing Administration. J Public Health Dent.
1999;59(3):192-7.
Edgar WM, Higham SM. Role of saliva in Caries models. Adv Dent Res. 1995; (9): 235–8.
Featherstone JD. Dental caries: a dynamic disease process. Aust Dent J. 2008 Sep;53(3):286-
91.
Feitosa S, Colares V, Pinkham J. The psychosocial effects of severe caries in 4-year-old
children in Recife, Pernambuco, Brazil.Cad Saude Publica. 2005; 21(5):1550-6.
Ferraz NK, Nogueira LC, Pinheiro ML, Marques LS, Ramos-Jorge ML, Ramos-Jorge J.
Clinical consequences of untreated dental caries and toothache in preschool children. Pediatr
Dent. 2014 Sep-Oct;36(5):389-92.
Filstrup SL, Briskie D, da Fonseca M, Lawrence L, Wandera A, Inglehart MR. Early childhood
caries and quality of life: child and parent perspectives. Pediatr Dent. 2003 Sep-Oct;25(5):431-
40.
Gudiño S, Rojas N, Castro C, Rodríguez M, Vega M, López LM. Colonization of mutans
streptococci in Costa Rican children from a high-risk population. J Dent Child (Chic). 2007
Jan-Apr;74(1):36-40.
Guideline: Sugars intake for adults and children. Geneva: World Health Organization; 2015.
Harris R, Nicoll AD, Adair PM, Pine CM. Risk factors for dental caries in young children: a
systematic review of the literature. Community Dent Health. 2004 Mar;21(1 Suppl):71-85.
Review.
![Page 48: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/48.jpg)
48
Hata S, Hata H, Miyasawa-Hori H, Kudo A, Mayanagi H. Quantitative detection of
Streptococcus mutans in the dental plaque of Japanese preschool children by real-time PCR.
Lett Appl Microbiol. 2006 42: 127–31.
Kidd E. The implications of the new paradigm of dental caries. J Dent. 2011 Dec;39 Suppl
2:S3-8.
Kirstilä V, Häkkinen P., Jentsch H, Vilja P, Tenovuo J. Increment and Cariogenic Micro-
organisms: A Two-year Cohort Study Longitudinal Analysis of the Association of Human
Salivary Antimicrobial Agents with Caries. J Dent Res. 1998; 77(1):73-80.
Loesche WJ. Role of Streptococcus mutans in human dental decay. Microbiol Rev. 1986;
50(4):353-80.
Ma C, Chen F, Zhang Y, Sun X, Tong P, Si Y, Zheng S. Comparison of oral microbial profiles
between children with severe early childhood caries and caries-free children using the human
oral microbe identification microarray. PLoS One. 2015 Mar 30;10(3):e0122075.
Marsh PD. Sugar, fluoride, pH and microbial homeostasis in dental plaque. Proc Finn Dent Soc.
1991;87(4):515-25. Review
Marsh PD. Microbial ecology of dental plaque and its significance in health and disease. Adv
Dent Res. 1994 Jul;8(2):263-71. Review.
Mattos-Graner RO, Zelante F, Line RC, Mayer MP. Association between caries prevalence and
clinical, microbiological and dietary variables in 1.0 to 2.5-year-old Brazilian children. Caries
Res. 1998;32(5):319-23
Mattos-Graner RO, Smith DJ, King WF, Mayer MP. Water-insoluble glucan synthesis by
mutans streptococcal strains correlates with caries incidence in 12- to 30-month-old children. J
Dent Res. 2000;79(6):1371-7.
![Page 49: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/49.jpg)
49
Ministério da Saúde. Projeto SB Brasil 2010 – condições de saúde bucal da população da
população brasileira 2009. Disponível em: http://dab.saude.gov.br/cnsb/sbbrasil/projeto_
integra.htm.
Nobre dos Santos M, Melo dos Santos L, Francisco SB, Cury JA. Relationship among dental
plaque composition, daily sugar exposure and caries in the primary dentition. Caries Res.
2002;36(5):347-52.
Oliveira LB, Sheiham A, Bönecker M. Exploring the association of dental caries with social
factors and nutritional status in Brazilian preschool children. Eur J Oral Sci 2008;116:37–43.
Parisotto TM, Steiner-Oliveira C, Duque C, Peres RC, Rodrigues LK, Nobre-dos-Santos M.
Relationship among microbiological composition and presence of dental plaque, sugar
exposure, social factors and different stages of early childhood caries. Arch Oral Biol.
2010;55(5):365-73.
Parisotto TM, Santos MN, Rodrigues LK, Costa LS. Behavior and progression of early carious
lesions in early childhood: a 1-year follow-up study. J Dent Child (Chic). 2012;79(3):130-5.
Parisotto TM, Stipp R, Rodrigues LK, Mattos-Graner RO, Costa LS, Nobre-Dos-Santos M. Can
insoluble polysaccharide concentration in dental plaque, sugar exposure and cariogenic
microorganisms predict early childhood caries? A follow-up study. Arch Oral Biol. 2015
Aug;60(8):1091-7.
Paula JS, Mialhe FL. Impact of oral health conditions on school performance an lost school
days by children and adolescents: what are the actual pieces of evidence? Braz J Oral Sci 2013;
12: 189–98.
Pesquisa estadual de saúde bucal: relatório final / Antonio Carlos Frias; Antonio Carlos Pereira
e Vladen Vieira. – Águas de São Pedro: Livronovo, 2016. Disponível em:
http://w2.fop.unicamp.br/sbsp2015/down/ebook_relatorio_SBSP_2015.pdf
![Page 50: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/50.jpg)
50
Ramos-Gomez FJ, Weintraub JA, Gansky SA, Hoover CI, Featherstone JD. Bacterial,
behavioral and environmental factors associated with early childhood caries. J Clin Pediatr
2002 Winter;26(2):165-73
Ren Z, Chen L, Li J, Li Y. Inhibition of Streptococcus mutans polysaccharide synthesis by
molecules targeting glycosyltransferase activity. J Oral Microbiol. 2016 Apr 20;8:31095.
Ripa LW. Nursing caries: a comprehensive review. Pediatr Dent. 1988 Dec;10(4):268-82.
Review.
Sanchez-Perez L, Acosta-Gio AE. Caries risk assessment from dental plaque and salivary
Streptococcus mutans counts on two culture media. 2001. Arch. Oral Biol., 46: 49-55
Selwitz RH, Ismail AI, Pitts NB. Dental caries. Lancet. 2007 Jan 6;369(9555):51-9. Review.
Sheiham A, James WP. Diet and Dental Caries: The Pivotal Role of Free Sugars Reemphasized.
J Dent Res. 2015 Oct;94(10):1341-7.
Skeie MS, Raadal M, Strand GV, Espelid I. The relationship between caries in the primary
dentition at 5 years of age and permanent dentition at 10 years of age - a longitudinal study. Int
J Paediatr Dent. 2006 May;16(3):152-60.
Tao Y, Zhou Y, Ouyang Y, Lin HC. Association of oral streptococci community dynamics with
severe early childhood caries as assessed by PCR-denaturing gradient gel electrophoresis
targeting the rnpB gene. J Med Microbiol. 2015 Aug;64(8):936-45
Takahashi N, Nyvad B. Caries ecology revisited: microbial dynamics and the caries process.
Caries Res 2008;42:409–18.
van Houte J. Bacterial specificity in the etiology of dental caries. Int Dent J. 1980; 30(4):305-
26.
![Page 51: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/51.jpg)
51
van Ruyven FO, Lingström P, van Houte J, Kent R. Relationship among mutans streptococci,
"low-pH" bacteria, and lodophilic polysaccharide-producing bacteria in dental plaque and early
enamel caries in humans. J Dent Res. 2000 Feb;79(2):778-84.
Wolff D, Frese C, Maier-Kraus T, Krueger T, Wolff B. Bacterial biofilm composition in caries
and caries-free subjects. Caries Res. 2013;47(1):69-77.
Xu H, Hao W, Zhou Q, Wang W, Xia Z, Liu C, Chen X, Qin M, Chen F. Plaque bacterial
microbiome diversity in children younger than 30 months with or without caries prior to
eruption of second primary molars. PLoS One. 2014 Feb 28;9(2):e89269.
![Page 52: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/52.jpg)
52
ANEXO 1 – Informação CCPG/001/201512
![Page 53: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/53.jpg)
53
ANEXO 2 – Comprovante de submissão do manuscrito
Submission Confirmation Print
Thank you for your submission
Submitted to
International Journal of Paediatric Dentistry
Manuscript ID
IJPD-11-16-5856
Title
Microbiological composition of dental biofilm in different stages of early childhood
caries – a longitudinal study.
Authors
Rodrigues, Livia
Correa, Gabriela
Borghi, Gabriela
Zancopé, Bruna
Vizoto, Natalia
Stipp, Rafael
Nobre dos Santos, Marinês
Date Submitted
27-Nov-2016
![Page 54: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/54.jpg)
54
ANEXO 3 – Certificado de aprovação do Comitê de Ética em Pesquisa
![Page 55: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/55.jpg)
55
ANEXO 4 – Ficha clínica
FICHA CLÍNICA
Nome:____________________________________________Nº da Ficha:________
Creche:___________________________________________Data exame:________
Data nasc.:_______________Idade (meses):_________Sexo: (F) (M): Cor: (B) (N) (P)
0- Sadio
1- Cárie ativa (superfície intacta)
2- Cárie ativa (superfície descontínua)
3- Cárie ativa (cavidade)
4- Cárie inativa (superfície intacta)
5- Cárie inativa (superfície descontínua)
6- Cárie inativa (cavidade)
7- Restaurada (superfície sadia)
8- Restaurada + cárie ativa
9- Restaurada + cárie inativa
Biofilme visível nas superfícies vestibulares dos incisivos superiores:__________________
0: biofilme ausente ou não visível;
1: biofilme visível
![Page 56: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/56.jpg)
56
ANEXO 5 – Escores do critério de diagnóstico
Critério Nyvad modificado para dentição decídua
A Sadio Textura e translucidez normal de esmalte (leve mancha
permitida em fissura sadia)
B Cárie ativa
(superfície intacta)
Superfície de esmalte é esbranquiçada/amarelada com perda
de brilho; sem perda detectável de substância
Morfologia intacta da fissura; lesão se estendendo pelas
paredes.
C Cárie ativa
(superfície descontínua)
Mesmo critério que o escore 1. Defeito localizado
(microcavidade) em esmalte apenas. Sem esmalte minado ou
assoalho amolecido detectado com o explorador.
D Cárie ativa (cavidade) Cavidade em esmalte/dentina facilmente visível a olho nu,
superfície da cavidade sentida frágil em sondagem leve.
Pode ou não haver envolvimento pulpar.
E Cárie inativa
(superfície intacta)
Superfície de esmalte esbranquiçada, amarronzada ou preta.
Esmalte pode estar brilhante. Sem perda clínica de
substância. Morfologia intacta da fissura; lesões estendendo
pelas paredes.
F Cárie inativa
(superfície descontínua)
Mesmo critério do escore 4. Defeito de superfície
localizado (microcavidade) em esmalte apenas. Sem
esmalte minado ou assoalho mole detectável com
explorador.
G Cárie inativa (cavidade) Cavidade em esmalte/dentina facilmente visível a olho nu.
Superfície da cavidade pode estar brilhante e dura à
sondagem com leve pressão.
H Restaurada
(superfície sadia)
-
I Restaurada + cárie ativa Lesão de cárie pode estar cavitada ou não-cavitada
J Restaurada + cárie inativa Lesão de cárie pode estar cavitada ou não-cavitada
Quadro1. Escores de acordo com o critério diagnóstico de Nyvad modificado. Fonte: Séllos e
Soviero (2011).
![Page 57: UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE …repositorio.unicamp.br/.../331396/1/Rodrigues_LiviaPagotto_D.pdf · lÍvia pagotto rodrigues relaÇÃo entre os diferentes estÁgios](https://reader036.vdocument.in/reader036/viewer/2022081401/5c01f17509d3f23b288d728f/html5/thumbnails/57.jpg)
57
ANEXO 6 – Fotografias com escores do critério de diagnóstico