-
University of Groningen
In principio erat Lactococcus lactisCoelho Pinto, Joao Paulo
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2015
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Coelho Pinto, J. P. (2015). In principio erat Lactococcus lactis: Towards a membrane protein overproducerhost. ([Groningen] ed.). University of Groningen.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 15-06-2021
https://research.rug.nl/en/publications/in-principio-erat-lactococcus-lactis(e5ba7f4d-6659-4239-a093-6c2777c6d17a).html
-
CHAPTER 6
UPGRADING THE TOOLKIT OF
LACTOCOCCUS LACTIS§
§ João P. C. Pinto, Araz Zeyniyev, Sjoerd van der Meulen, Oliwia Bieniek, Harma Karsens, Hein
Trip, Juke S. Lolkema, Oscar P. Kuipers and Jan Kok
Part of this chapter was published in:
João P. C. Pinto, Araz Zeyniyev, Harma Karsens, Hein Trip, Juke S. Lolkema, Oscar P. Kuipers,
and Jan Kok. “pSEUDO, a Genetic Integration Standard for Lactococcus Lactis.” Applied and
Environmental Microbiology 77, no. 18 (September 2011): 6687–6690.
-
Chapter 6
154
Abstract
Lactococcus lactis is an industrially important microorganism and a model for the family of
Lactic Acid Bacteria (LAB). Catering to the ever increasing need to constantly update the
genetic toolkit of L. lactis, we constructed plasmid pSEUDO and derivatives and used them to
show that llmg_pseudo_10 in Lactococcus lactis MG1363, and its homologous locus in L.lactis
IL1403, are suitable for chromosomal integrations. L.lactis MG1363 and IL1403 NICE-
system-derivatives (JP9000 and IL9000) and two general stress reporter-strains
(NZ9000::PhrcA-GFP; NZ9000::PgroES-GFP) enabling in-vivo non-invasive monitoring of
cellular fitness were constructed. We additionally established a protocol to easily screen and
characterize randomly produced mutants of this organism. We successfully implemented
and validated a protocol for Genomic Array Footprinting (GAF), using SuperAmine glass
slides spotted with duplicates of around 2500 ORF amplicons of L. lactis subsp. cremoris
MG1363. We additionally constructed pGh8T7:ISS1, a plasmid with a tetracycline resistance
marker rather than the often used erythromycin resistance that is present in pGh9T7:ISS1.
This unlocks experimental setup and screening strategies on strains that are already
erythromycin resistant, e.g. from carrying a genetic construct used in the selection
procedure.
-
Upgrading the Toolkit of Lactococcus lactis
155
Introduction
Lactococcus lactis is an industrially important microorganism which is widely used in dairy
fermentation. Glancing into the future, this bacterium could also play a role in other, novel,
biotechnological applications, for instance as a possible membrane protein overproduction
host, as is explored in the work described in this thesis.
L. lactis has also been a model organism for the Lactic Acid Bacteria (LAB) for the past
several decades and the current knowledge regarding the molecular biology of this family of
bacteria derives in great part from evidence initially collected from L. lactis. With the public
availability of eight genome sequences of this bacterium (1–8), L. lactis also leads the way
with respect to post-genomics experimental approaches such as transcriptomics, proteomics
and metabolomics and using these for in-depth systems biology studies (see for example
(9)).
The ever increasing pace of scientific research on the LAB demands continuously updating
the genetics and genomics toolkit of L. lactis so that it remains a valid model organism in
which experimental questions can be readily addressed and answered. Here we document
the construction a standard for chromosomal integrations and the set up a protocol in L.
lactis for the easy screening and characterization of randomly produced mutants.
A standard locus in the chromosome of L. lactis for integration of DNA fragments, whether
for genetic complementation (single-copy or merodiploid-like situations) or cloning of a
reporter gene or -promoter, is lacking. Contrary to e.g. Bacillus subtilis, where the amyE locus
is often used for these purposes (22), in L. lactis various chromosonal loci in the
chromosome have been chosen as targets for integration. Unfortunately, and to the best of
our knowledge, none of the proposed strategies exclude the possibility of phenotypic
consequences. The leuA locus was shown to suffer from active read-through from the native
leuA promoter (11), whereas the choice of the sex factor locus might interfere with the
biology of L. lactis and, in addition, may have consequences with respect to possible
conjugational transfer of the inserted DNA. Also, bacteriophage sequences have been used to
drive site-specific integration of plasmids in the chromosome of L. lactis (3, 9). However,
these methods do not allow making strains without resistance markers while some require
the use of a second plasmid to provide the bacteriophage integrase in trans. Furthermore, the
localization in the chromosome of L. lactis MG1363 of sequences with high similarity to a
given attB, e.g. in the comGC gene for TP901-1 attB and in rex for TUC2009 attB (data not
shown), implies that the integration process might lead to the simultaneous disruption of
potentially relevant processes.
Here it was examined whether the llmg_pseudo_10 locus of L. lactis MG1363, or its
corresponding region in L. lactis IL1403, is a suitable neutral region for chromosomal
-
Chapter 6
156
integrations (Figure 4). In L. lactis IL1403, this locus contains yfjF, a gene of 1506 bp of which
the product exhibits homology to transport proteins from the major facilitator superfamily.
In L. lactis MG1363, translation is halted prematurely due to the presence of a stop codon at
position 303, hence its annotation as a pseudo gene (24). By cloning and re-sequencing, the
nucleotide sequence of this region in L. lactis MG1363, originally described by Wegmann et
al. (24), was confirmed. The loss of function of the locus in L. lactis MG1363 suggests that yfjF
is non-essential. The llmg_pseudo_10 locus has been shown to be silent throughout the
growth of L. lactis MG1363 in batch cultures in M17 medium (4) and milk (Anne de Jong,
personal communication). In addition, llmg_pseudo_10 and yfjF display low nucleotide
sequence similarity with other regions in the L. lactis genome, minimizing the possibility of
illegitimate recombination.
Figure 1 – Genomic context of llmg_pseudo_10 of L. lactis MG1363 and its relation to the homologous regions (hr’s) present in pSEUDO and pSEUDO-GFP. The multiple cloning site (MCS) contains, in clockwise order, EcoRI, XmaI/SmaI, SphI, ScaII, SalI, HindIII, BglII, XhoI and BamHI restriction enzyme sites. The gfp gene for super-folder GFP (19) was cloned in pSEUDO using the XhoI and BamHI sites, yielding pSEUDO-GFP. Terminators are indicated by ‘lollipop’ structures. The vertical line on llmg_pseudo_10 depicts the stop codon that prematurely halts translation of the gene in L. lactis MG1363. eryR: erythromycin resistance gene; oroP encodes the L. lactis orotate transporter (5).
-
Upgrading the Toolkit of Lactococcus lactis
157
Part I: pSEUDO, a genetic integration standard for
Lactococcus lactis
Construction and applicability of pSEUDO and pSEUDO-GFP
To be able to perform unmarked integrations in the chromosome of L. lactis the
chromosomal integration vector pCS1966 was employed, allowing to positively select cells in
which the plasmid has been excised from the genome (16). Two DNA fragments were
amplified from L. lactis MG1363 chromosomal DNA by PCR, one of 529 bp obtained with the
primer pair P1_pseudo10/P2_pseudo10 and another of 804 bp using
P3_pseudo10/P4_pseudo10, and sequentially inserted into pCS1966 using the restriction
enzymes indicated in Table 1, and E. coli DH5α as the cloning host. Selection was performed
on TY agar plates with 150 µg/ml erythromycin. The custom-made multiple cloning site
GAATTCCCCGGGCATGCCGCGGTCGACAAGCTTAGATCTCGAGGATCC was introduced between
the BamHI and EcoRI sites, thus producing the plasmid pSEUDO (Figure 4). This vector can
be used to insert DNA fragments into the llmg_pseudo_10 locus of L. lactis MG1363 using
positive selection for resistance to the toxic pyrimidine analog 5-fluoroorotate, as described
before (16), with minor modifications (17). Although it is not possible to screen for
integrants via loss of function through gene disruption, pSEUDO allows for a quick and
efficient positive survival strategy to monitor both integration (erythromycin resistance) and
excision of the vector backbone from the chromosome (5-fluoroorotate resistance), thus
enabling the production of unmarked strains in an easy and fast manner.
As a proof of principle, the applicability of pSEUDO is illustrated through the integration of
the genes of the two-component nisin sensor, NisRK (12), in the chromosome of L. lactis
MG1363, internal and in opposite orientation to llmg_pseudo_10. A fragment containing the
nisRK genes with their own promoter was amplified by PCR from chromosomal DNA of L.
lactis NZ9000 (20) using the primers nisRK_Forw and nisRK_Rev. The PCR product and
pSEUDO were digested with BamHI and ligated after dephosphorylation of the digested
vector, producing pSEUDO::nisRK. The presence and orientation of the insert were checked
with PCR and restriction endonuclease digestions. The integration of nisRK into L. lactis
MG1363 using pSEUDO::nisRK generated the L. lactis strain JP9000. Expression of nisRK and
the applicability of the nisin-induced controlled expression (NICE) system (18, 19) using L.
lactis JP9000 are the same as for L. lactis NZ9000. As an example, the NICE system was used
for the overproduction of a GFP- and hexa-histidine-tagged membrane protein of L. lactis,
BcaP-GFP-H6, using pNZbcaP-GFP-H6, a pNZ8048 derivative in which the bcaP-gfp-H6 gene
is driven by the nisin-inducible PnisA promoter (11). L. lactis strains NZ9000 and JP9000
carrying this plasmid produced equivalent levels of the tagged protein since a similar
fluorescent signal from the overproduced BcaP-GFP-H6 was obtained using either strain
-
Chapter 6
158
(Figure 2). Contrary to previous observations (20), the native nisRK promoter (21) was
sufficient to yield significant amounts of NisRK and read-through from the neighboring genes
was not required for a functional NICE system. In addition to pSEUDO::nisRK, a similar vector
was constructed for nisRK integration in the yfjF locus of L. lactis IL1403. The llmg_pseudo_10
homologous regions of pSEUDO were replaced by homologous regions of the yfjF locus,
amplified from chromosomal DNA of IL1403 using primers P1_yfjF, P2_yfjF, P3_yfjF and
P4_yfjF (Table 1). The nisRK genes were inserted in the BamHI site in opposite direction to
the yfjF gene, resulting in plasmid pSEUDO-IL::nisRK. The integration of nisRK into L. lactis
IL1403 resulted in strain IL9000. To test functionality, IL9000 was transformed with a
pNZ8048-derived plasmid in which gfp was inserted downstream the nisin-inducible PnisA
promoter (H. Trip, unpublished results). GFP fluorescence levels upon induction with nisin
were similar to those obtained with L. lactis NZ9000 harboring the same plasmid (data not
shown), demonstrating that the NICE system is identically functional in L. lactis IL9000. The
plasmids pSEUDO::nisRK and pSEUDO-IL::nisRK can be used to introduce the NICE system in
any L. lactis MG1363- or L. lactis IL1403-derived strain, respectively. This is thought to be
very useful for the LAB research community since L. lactis MG1363 and L. lactis IL1403 are
by far the most commonly used strains in the L. lactis applied and fundamental research
fields. The use of pSEUDO::nisRK or pSEUDO-IL::nisRK circumvents the use of combinations
of vectors in strains that do not carry nisRK on the chromosome. In those cases, pNZ9530
(18) is usually required to provide nisRK in trans, for complementation analysis. L. lactis
JP9000 is preferable over the standard strain NZ9000, since pepN is intact in the former
whereas it is disrupted in NZ9000 (pepN::nisRK) (18) (Figure 2). L. lactis IL9000 is the first
IL1403 derivative in which the NICE system for nisin-inducible gene expression can be
employed. The general aminopeptidase N (PepN) (21), while generally assumed not to be
relevant under most conditions, is likely to have an effect on nitrogen metabolism through
the influence of the products of peptide hydrolysis on e.g., the major pleiotropic regulator
CodY (22). Also, the availability of specific peptides in the medium has been correlated with
the ability of L. lactis to overproduce membrane proteins (23).
-
Upgrading the Toolkit of Lactococcus lactis
159
A)
B)
Figure 2 – Heterologous protein production and activity of aminopeptidase PepN in L. lactis. (A) Expression of the membrane protein BcaP-GFP-His6 was induced in L. lactis strains NZ9000 and JP9000, both carrying plasmid pNZbcaP-GFP-H6 (11). The strains were grown in GM17 until an OD at 600 nm of 0.5 was reached, after which they were induced for one hour with 5 ng/ml of nisin. Mean fluorescence, as measured by flow-cytometry, of the plasmid-carrying strains is plotted, normalized to that of plasmid-free L. lactis NZ9000. The uninduced bar depicts the fluorescence of the non-induced JP9000 (pNZbcaP-GFP-H6) culture. (B) PepN activity in L. lactis strains MG1363 (24), NZ9000 (18), MG1363ΔpepN (25), and JP9000 (this work) was determined in cell-free extracts of cultures grown in GM17 until an OD at 600 nm of 0.5, by monitoring the hydrolysis of the PepN substrate lysyl-p-nitroanilide, as described previously (26). (A) and (B): data are the average of 4 biological replicates and the error bars are the associated standard deviation.
0
20
40
60
80
100
120
140
160
180
200
Uninduced NZ9000 JP9000
Norm
aliz
ed F
luore
scence [
A.U
.]
0
20
40
60
80
100
120
MG1363 NZ9000 MG1363ΔpepN JP9000
Norm
aliz
ed P
epN
Activity [
-]
-
Chapter 6
160
To facilitate the integration of promoter-gfp reporters in the chromosome of L. lactis,
pSEUDO-GFP was also constructed (Figure 4). This vector was made by cloning the gene of
the superfolder variant of GFP (27) together with the two terminator sequences from the
iGEM Biobrick I746909 (http://partsregistry.org/Part:BBa_I746909) (28) to block read-
through into llmg_0576, a putative transcriptional regulator of the TetR family. The PCR
fragment obtained with primers GFP-SF_Forw and GFP-SF_Rev was inserted in pSEUDO
using BamHI and XhoI. The first primer was used to add 4 well-translated codons and a
strong RBS sequence to the 5’-end of gfp (29).
As an example of the applicability of pSEUDO-GFP, promoter-gfp fusions were constructed
using the upstream regions of two general stress response genes, hrcA and groES. The
promoter region of hrcA was amplified using the primer pair PhrcA_forw/ PhrcA_rev and that
of groES was amplified with the primers PgroES_forw/PgroES_rev. EcoRI and XhoI were used
to digest these DNA fragments and pSEUDO-GFP, in which the two promoter fragments were
separately inserted. Insertion of the promoter-gfp fusions in the llmg_pseudo_10 locus of the
chromosome of L. lactis NZ9000 yielded the strains NZ9000::PhrcA-gfp and NZ9000::PgroES-
gfp. By exposing both strains to high temperatures, and making use of the stress-induced
activity of PhrcA and PgroES, it was demonstrated that they are able to reliably monitor, in a
non-invasive manner (unlike e.g., promoter-lacZ fusions) and in real-time, the effect of
growth and environmental conditions on the general fitness of cells (Figure 3).
The use of pSEUDO-GFP enables applying high-throughput screening strategies (e.g., using
microtiter plates) for conditions in which putative promoters are expected to be active.
Furthermore, the use of flow-cytometry, or other single-cell analysis techniques, allows
characterizing phenomena such as gene expression heterogeneity.
Altogether, pSEUDO, pSEUDO-GFP and the derived plasmids and strains add value to the
lactococcal research community in that they establish an improved working standard for the
effective and efficient integration of DNA fragments into the chromosome of L. lactis.
-
Upgrading the Toolkit of Lactococcus lactis
161
Figure 3 – Induction of GFP production in L. lactis NZ9000::PgroES-GFP and in L. lactis NZ9000::PhrcA-GFP, grown in GM17 medium at 30oC. Both cultures were shifted to 60°C when they had reached an optical density at 600 nm of 0.5. White: 0 min after the temperature shift; light grey: 15 min after the temperature shift; dark grey: 60 min after the temperature shift. The fluorescence was measured over time using an Epics XL-MCL flow-cytometer (Coulter, Fullerton, CA). Values were normalized to the fluorescence of L. lactis NZ9000 undergoing the same heat treatment. 20.000 cells were measured per experiment and 4 biological replicates obtained per strain and per time point. The error bars are the associated standard deviations.
Part II: Genomic Array Footprinting in Lactococcus lactis
Construction of pGh8T7:ISS1
The ISS1 element from pGh8:ISS1 (30) was removed by digestion of the plasmid with EcoRI
and HindIII and replaced by a HindIII-, EcoRI-digested PCR product of the ISS1 element
generated from pGh8:ISS1 with primers ISS1_T7_up and ISS1_T7_down (12). This resulted in
pGh8T7:ISS1, which, like pGh9T7:ISS1 (12), contains the ISS1 element with the T7 promoters
on either of its sides (Figure 4).
-
Chapter 6
162
Table 1 – Oligonucleotides used in this study. Restriction enzyme sites are underlined.
Name Nucleotide Sequence; 5’ > 3’ § Restriction
enzyme
P1_pseudo10 GCTCTAGACAATTGCTCCCATGCTTGATTCC BglII
P2_pseudo10 CGCGGATCCTGCTTTTGGATTAAAAGGTTTGAAAG BamHI
P3_pseudo10 CGGAATTCGGCGGCTCTGTTGGATTAATATATGG EcoRI
P4_pseudo10 GCGGTACCCAATTGAAGAGACAAGAAAACC KpnI
P1_yfjF GCGAAATCTAGACTTCAAACATAAGAGACCTCG XbaI
P2_yfjF GCGAAAGGATCCTTTAGCTTTAGGGTTGAAAGG BamHI
P3_yfjF GCGAAAGGATCCTTTGGCTGGCGGTTCTGTGGG BamHI
P4_yfjF GCGAAAGGTACCAATCGAAGAGACAAGAAAGCC KpnI
nisRK_Forw TAAAGGGATCCGCTTAGATACAGATAAAGGTCAGG BamHI
nisRK_Rev AGATTGGATCCCAAAACTGATATCTTGTAGCACCTGC BamHI
GFP-SF_Forw ATAGTCTCGAGTAAGGAGGCAAATATGAAACATCTTCGTAAAGGCGAAGAGCTGTTCACTGG
XhoI
GFP-SF_Rev ACTATGGATCCTATAAACGCAGAAAGGCCCACC BamHI
PhrcA_forw ATCTGGAATTCATCCAAAGATTCTAATCTTTTATAACAG EcoRI
PhrcA_rev GCTCCCTCGAGTATCTCTAAGTTTTTTCTTTTAGCACTC XhoI
PgroES_forw GGAACGAATTCTTGAAGCTGATGAGCTCCCTTTCTG EcoRI
PgroES_rev ATACTCTCGAGCATTTTTTATTTTTAGCACTCTTAATAG XhoI
Figure 4 – Schematic representation of pGh8T7:ISS1 (this work) and pGh9T7:ISS1 (12). Both plasmids carry a repA (ts) gene encoding a temperature sensitive replication protein that is non-functional above 37°C (30, 31). The ISS1 insertion sequence is flanked by two outward-facing T7 promoters (12). pGh8T7:ISS1 contains the tetracycline resistance marker from pT181 (30, 32) while pGh9T7:ISS1 carries the erythromycin resistance marker from pIL253 (15, 30).
-
Upgrading the Toolkit of Lactococcus lactis
163
The pGh8T7:ISS1 replicon, like that of pGh9T7:ISS1 (12), is a thermosensitive derivative of
pWV01 (33), in which repA contains four mutations compared to that of pVW01 (31, 34). In
L. lactis these plasmids replicate normally up to 28°C but not above 37°C (30, 31). The Ts
plasmids can be used to perform insertional mutagenesis not only in L. lactis but also in
other lactococci, enterococci and streptococci, where ISS1 has been shown to transpose
randomly throughout the genome (30).
The characterization of mutants that are pulled out during a given screening strategy can be
performed by amplifying the chromosomal regions that are adjacent to where the plasmid
has integrated. The transposed structure is flanked by ISS1 on each side (30), so the
outward-facing T7 promoters can be used to produce local RNA fragments which pinpoint
the site of integration and therefore allow identifying the genes that have been disrupted or
transcriptionally affected.
Genomic Array Footprinting in Lactococcus lactis
In GAF, an entire transposon library can be screened, for example, for mutants that
disappeared or became differentially more prevalent under a certain experimental setup by
comparing the obtained mutant bank (target) to the control or original library (12). This is
accomplished by digesting chromosomal DNA from each of the two populations (target and
control), and amplifying RNA from the DNA segments that remain adjacent to the transposon
insertion sites using the T7 RNA polymerase. The RNA is then used as a template to yield
cDNA that is labelled and hybridized onto a DNA microarray (12).
To validate this strategy in L. lactis, we used the method as described before (12), with small
libraries (≈ 100 CFU’s). Following the transformation of L. lactis with pGh9T7:ISS1 and the
subsequent temperature up-shift to select for integrants, 3 small libraries of 32 CFU’s each
were made. From these 3 libraries, one was obtained from a selection of small colonies, the
second from medium sized ones, and the third from colonies larger than the average
wildtype L. lactis colony. Additionally, 10 random colonies (3 small, 4 medium, 3 large ones)
were independently picked. We selected and independently expanded in liquid culture, not
only each of these 10 colonies, but also each library of 32 CFU’s, to dismiss in this validation
stage any artifacts, such as overrepresentation bias, that might derive from growth rate
differences among mutant strains.
Chromosomal DNA from each of the small transposon libraries and from each of the 10
randomly selected strains was independently purified. Then, two chromosomal DNA
mixtures were prepared: DNA pool 1 contained equal amounts of DNA from each of the three
small libraries (thus representing 96 CFU’s); the second preparation (DNA pool 2) contained
this same DNA mixture to which chromosomal DNA from each of the 10 independently
picked colonies was proportionally added (in total about ≈ 30% compared to the DNA from
-
Chapter 6
164
each of the three small libraries). This setup served to mimic a situation where, during a
selective process, 10 mutants had disappeared from the transposon library pool. We only
used small libraries, of 96 and 96+10 CFU’s, to minimize the probability of a given insertion
locus being represented in both the “96 CFU’s” and the “10 CFU’s” partial libraries of DNA
pool 2.
DNA from each of these two mixtures was digested with AluI, which cuts the L. lactis
chromosome on average every 233 bp. The “MEGAscript® T7 Transcription Kit” (Ambion,
Texas, USA) was used to amplify regions adjacent to the T7 promoters, according to
manufacturer instructions. The obtained RNA was purified with the “High pure RNA isolation
kit” (Roche Molecular Biochemicals, Mannheim, Germany). Synthesis of cDNA and DNA
microarraying were performed as described before using SuperAmine glass slides (ArrayIt,
Sunnyvale, CA) spotted with duplicates of around 2500 ORF amplicons of L. lactis subsp.
cremoris MG1363 (17, 35).
Analysis of the DNA microarray data indicates that, indeed, some spots on the DNA
microarray slide display greater signal intensities, corresponding to the 10 extra mutants in
the 96+10 CFU’s DNA sample, as compared to the 96 CFU’s library (Figure 5).
Figure 5 – DNA microarray output of GAF using an L. lactis transposon library of 96 CFU’s (horizontal axis) versus 96+10 CFU’s (vertical axis). Spots with significantly greater intensities in the channel that corresponds to the 96+10 CFU’s sample are highlighted as red triangles.
-
Upgrading the Toolkit of Lactococcus lactis
165
As previously observed (30), integration of pGh9T7:ISS1 in the genome of L. lactis appears to
have been random since the DNA microarray spots with greater intensities and those with
greater intensity biases (Figure 5) map onto regions all around the genome (Table 2). Also,
Southern hybridization on the DNA of all 10 independently picked CFU’s using pGh9T7:ISS1
as a probe indicates that integration loci were different in all cases as the samples yielded
different patterns on the blot (data not shown).
Note, however, that the outcome from GAF depends on the restriction enzyme used to digest
the chromosomal DNA. For the transposon insertion site to be identifiable, a DNA microarray
probe has to at least partially match the chromosomal region between the T7 promoter and
the restriction site of the particular restriction enzyme.
Table 2 – DNA microarray probes that are highlighted as red triangles in Figure 5.
Gene Microarray Probe Net Intensity
Ratio 96 CFU’s 96+10 CFU’s
llmg0430_cstA_MG752 431 773 1,8
llmg0724_llmg0724_mg10050s 336 825 2,5
llmg1031_trpG_MG750 352 8.543 24,3
llmg1032_trpD_MG749 322 1.653 5,1
llmg1453_llmg1453_MG150179 319 1.089 3,4
llmg1454_llmg1454_mg6115 253 8.020 31,6
llmg1455_bglA2_mg6114 275 3.149 11,5
llmg1455_bglA2_MG809 150 510 3,4
llmg1668_llmg1668_MG150107 349 2.830 8,1
probe mg5799 (between llmg1668 and llmg1669) 169 16.028 94.6
llmg1669_llmg1669_mg5800 173 6.440 37,2
llmg2100_ps442_MG1927 280 8.503 30,4
llmg2288_ackA2_MG1320 296 1.902 6,4
Further Considerations on GAF
The first step in the implementation of a GAF strategy is the construction a transposon
library in the organism of interest. The choice of either pGh8T7:ISS1 or pGh9T7:ISS1 is
important if the experimental setup requires the use of either erythromycin or tetracycline
to select for a marker, other than that on any of those two plasmids.
The size of the library, that is the number of integrants to be screened, is also a matter of
optimization. Assuming that plasmid integration via ISS1 is entirely random, the probability
of a gene having been disrupted at least once in a given library is given by the formula:
-
Chapter 6
166
𝑃 = 1 − (1 − 1
𝑁)
𝑛
where N is the number of genes on the chromosome and n is the number of CFU’s that were
collected to make the library. Thus, a transposon library of 5.000 CFU’s of L. lactis MG1363,
which encodes 2.563 genes (8), is likely to have a coverage of 85,8% disrupted genes
represented at least once in that library. Please note however that the formula offers a
simple estimate since 1) some genes are essential and will never be represented in any
library, 2) gene sizes differ considerably and, for example, 3) a gene in an operon can be
indirectly disrupted if transcription is terminated before reaching it.
A library made from a larger number of CFU’s is not necessarily better. Slight variations in
the site of integration, for example of 100 bp, can result in different phenotypes but produce
the same outcome on a DNA microarray slide when GAF is employed. Conversely, the
opposite is also true. Thus, the disappearance of a given mutant under selective pressure
could be masked by the persistence of other mutants, that are phenotypically distinct, but
that yield similar signals using GAF. To minimize this effect, the selection of a proper
restriction enzyme to digest the chromosomal DNAs of target and control cultures is
essential. A non-frequently cutting enzyme produces on average large fragments,
exacerbating the effect, i.e. making it more difficult to distinguish insertion sites using GAF.
Although a more frequently cutting enzyme would enable greater resolution it will also
increase the chance that there will be no probe on the DNA microarray that matches the
region between the T7 promoter and the restriction enzyme site.
We therefore suggest including variations in the size of the transposon libraries and in the
restriction enzymes used, which would also provide the replicates that are required in any
experimental setup. For L. lactis one could consider using the restriction enzymes AluI, TaqI
and DdeI, which on average cut the chromosomal DNA every 233 bp, 531 bp and 448 bp,
respectively. Also, one should keep in mind that in GAF, the probe on the DNA microarray
slide does not match one-to-one to the gene that has been disrupted, but rather to a region
that lies between the transposon insertion site and the enzyme restriction site.
All that is discussed above is not only true for other lactococci, but also for enterococci and
streptococci, where the GAF methodology presented here can be equally implemented since
ISS1 has been shown to transpose randomly throughout the genomes of these organisms
(30).
-
Upgrading the Toolkit of Lactococcus lactis
167
References
1. Bolotin A, Wincker P, Mauger S, Jaillon O, Malarme K, Weissenbach J, Ehrlich SD, Sorokin A. 2001. The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res 11:731–753.
2. Bolotin A, Quinquis B, Ehrlich SD, Sorokin A. 2012. Complete genome sequence of Lactococcus lactis subsp. cremoris A76. J. Bacteriol. 194:1241–1242.
3. Gao Y, Lu Y, Teng K-L, Chen M-L, Zheng H-J, Zhu Y-Q, Zhong J. 2011. Complete genome sequence of Lactococcus lactis subsp. lactis CV56, a probiotic strain isolated from the vaginas of healthy women. J. Bacteriol. 193:2886–2887.
4. Linares DM, Kok J, Poolman B. 2010. Genome sequences of Lactococcus lactis MG1363 (revised) and NZ9000 and comparative physiological studies. J Bacteriol doi:10.1128/JB.00533–10.
5. Makarova K, Slesarev A, Wolf Y, Sorokin A, Mirkin B, Koonin E, Pavlov A, Pavlova N, Karamychev V, Polouchine N, Shakhova V, Grigoriev I, Lou Y, Rohksar D, Lucas S, Huang K, Goodstein DM, Hawkins T, Plengvidhya V, Welker D, Hughes J, Goh Y, Benson A, Baldwin K, Lee J-H, Díaz-Muñiz I, Dosti B, Smeianov V, Wechter W, Barabote R, Lorca G, Altermann E, Barrangou R, Ganesan B, Xie Y, Rawsthorne H, Tamir D, Parker C, Breidt F, Broadbent J, Hutkins R, O’Sullivan D, Steele J, Unlu G, Saier M, Klaenhammer T, Richardson P, Kozyavkin S, Weimer B, Mills D. 2006. Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. U.S.A 103:15611–15616.
6. McNulty NP, Yatsunenko T, Hsiao A, Faith JJ, Muegge BD, Goodman AL, Henrissat B, Oozeer R, Cools-Portier S, Gobert G, Chervaux C, Knights D, Lozupone CA, Knight R, Duncan AE, Bain JR, Muehlbauer MJ, Newgard CB, Heath AC, Gordon JI. 2011. The impact of a consortium of fermented milk strains on the gut microbiome of gnotobiotic mice and monozygotic twins. Sci Transl Med 3:106ra106.
7. Siezen RJ, Bayjanov J, Renckens B, Wels M, van Hijum SAFT, Molenaar D, van Hylckama Vlieg JET. 2010. Complete genome sequence of Lactococcus lactis subsp. lactis KF147, a plant-associated lactic acid bacterium. J. Bacteriol 192:2649–2650.
8. Wegmann U, O’Connell-Motherway M, Zomer A, Buist G, Shearman C, Canchaya C, Ventura M, Goesmann A, Gasson MJ, Kuipers OP, van Sinderen D, Kok J. 2007. Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256–70.
9. Notebaart RA, van Enckevort FHJ, Francke C, Siezen RJ, Teusink B. 2006. Accelerating the reconstruction of genome-scale metabolic networks. BMC Bioinformatics 7:296.
10. Pinto JPC, Zeyniyev A, Karsens H, Trip H, Lolkema JS, Kuipers OP, Kok J. 2011. pSEUDO, a genetic integration standard for Lactococcus lactis. Appl. Environ. Microbiol. 77:6687–6690.
11. Linares DM, Geertsma ER, Poolman B. 2010. Evolved Lactococcus lactis strains for enhanced expression of recombinant membrane proteins. J. Mol. Biol 401:45–55.
-
Chapter 6
168
12. Bijlsma JJE, Burghout P, Kloosterman TG, Bootsma HJ, de Jong A, Hermans PWM, Kuipers OP. 2007. Development of genomic array footprinting for identification of conditionally essential genes in Streptococcus pneumoniae. Appl. Environ. Microbiol. 73:1514–1524.
13. Molzen TE, Burghout P, Bootsma HJ, Brandt CT, van der Gaast-de Jongh CE, Eleveld MJ, Verbeek MM, Frimodt-Møller N, Østergaard C, Hermans PWM. 2011. Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis. Infect. Immun. 79:288–297.
14. Burghout P, Bootsma HJ, Kloosterman TG, Bijlsma JJE, de Jongh CE, Kuipers OP, Hermans PWM. 2007. Search for genes essential for pneumococcal transformation: the RADA DNA repair protein plays a role in genomic recombination of donor DNA. J. Bacteriol. 189:6540–6550.
15. Simon D, Chopin A. 1988. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie 70:559–566.
16. Solem C, Defoor E, Jensen PR, Martinussen J. 2008. Plasmid pCS1966, a new selection/counterselection tool for lactic acid bacterium strain construction based on the oroP gene, encoding an orotate transporter from Lactococcus lactis. Appl. Environ. Microbiol 74:4772–4775.
17. Pinto JPC, Kuipers OP, Marreddy RKR, Poolman B, Kok J. 2011. Efficient overproduction of membrane proteins in Lactococcus lactis requires the cell envelope stress sensor/regulator couple CesSR. PLoS ONE 6:e21873.
18. Kuipers OP, de Ruyter PGGA, Kleerebezem M, de Vos WM. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. Journal of Biotechnology 64:15–21.
19. De Ruyter PG, Kuipers OP, de Vos WM. 1996. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl. Environ. Microbiol 62:3662–3667.
20. Henrich B, Klein JR, Weber B, Delorme C, Renault P, Wegmann U. 2002. Food-grade delivery system for controlled gene expression in Lactococcus lactis. Appl. Environ. Microbiol 68:5429–5436.
21. Van Alen-Boerrigter IJ, Baankreis R, de Vos WM. 1991. Characterization and overexpression of the Lactococcus lactis pepN gene and localization of its product, aminopeptidase N. Appl. Environ. Microbiol 57:2555–2561.
22. Den Hengst CD, Curley P, Larsen R, Buist G, Nauta A, van Sinderen D, Kuipers OP, Kok J. 2005. Probing direct interactions between CodY and the oppD promoter of Lactococcus lactis. J. Bacteriol 187:512–521.
23. Marreddy RKR, Geertsma ER, Permentier HP, Pinto JPC, Kok J, Poolman B. 2010. Amino acid accumulation limits the overexpression of proteins in Lactococcus lactis. PLoS ONE 5:e10317.
24. Gasson MJ. 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol 154:1–9.
-
Upgrading the Toolkit of Lactococcus lactis
169
25. Mierau I, Kunji ER, Leenhouts KJ, Hellendoorn MA, Haandrikman AJ, Poolman B, Konings WN, Venema G, Kok J. 1996. Multiple-peptidase mutants of Lactococcus lactis are severely impaired in their ability to grow in milk. J. Bacteriol 178:2794–2803.
26. Exterkate FA. 1984. Location of Peptidases Outside and Inside the Membrane of Streptococcus cremoris. Appl. Environ. Microbiol 47:177–183.
27. Pédelacq J-D, Cabantous S, Tran T, Terwilliger TC, Waldo GS. 2006. Engineering and characterization of a superfolder green fluorescent protein. Nat. Biotechnol 24:79–88.
28. Lou C, Liu X, Ni M, Huang Y, Huang Q, Huang L, Jiang L, Lu D, Wang M, Liu C, Chen D, Chen C, Chen X, Yang L, Ma H, Chen J, Ouyang Q. 2010. Synthesizing a novel genetic sequential logic circuit: a push-on push-off switch. Mol. Syst. Biol 6:350.
29. Eberhardt A, Wu LJ, Errington J, Vollmer W, Veening J-W. 2009. Cellular localization of choline-utilization proteins in Streptococcus pneumoniae using novel fluorescent reporter systems. Mol. Microbiol 74:395–408.
30. Maguin E, Prévost H, Ehrlich SD, Gruss A. 1996. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931–935.
31. Maguin E, Duwat P, Hege T, Ehrlich D, Gruss A. 1992. New thermosensitive plasmid for gram-positive bacteria. J. Bacteriol 174:5633–5638.
32. Khan SA, Novick RP. 1983. Complete nucleotide sequence of pT181, a tetracycline-resistance plasmid from Staphylococcus aureus. Plasmid 10:251–259.
33. Otto R, Vos WM de, Gavrieli J. 1982. Plasmid DNA in Streptococcus cremoris Wg2: Influence of pH on Selection in Chemostats of a Variant Lacking a Protease Plasmid. Appl. Environ. Microbiol. 43:1272–1277.
34. Leenhouts KJ, Tolner B, Bron S, Kok J, Venema G, Seegers JF. 1991. Nucleotide sequence and characterization of the broad-host-range lactococcal plasmid pWVO1. Plasmid 26:55–66.
35. Kuipers OP, de Jong A, Baerends RJS, van Hijum SAFT, Zomer AL, Karsens HA, den Hengst CD, Kramer NE, Buist G, Kok J. 2002. Transcriptome analysis and related databases of Lactococcus lactis. Antonie Van Leeuwenhoek 82:113–122.
-
Chapter 6
170