Supplementary InformationSupplementary Material and Methods
Supplementary References
Supplementary Figures 1-17
Supplementary Tables 1-4
Supplementary Material and Methods
Plant and insect materials The seeds of NahG and cv Moneymaker plants were kindly provided by
Dr. Jonathan Jones (Sainsbury Laboratory, UK). All plants were grown in a greenhouse with a
photoperiod of 16L:8D and fertilized with 3 g of Osmocote plus (15-9-12, Scotts). Four-leaf-stage plants
were used for all experiments. NahG plants were placed in a shaded area of the greenhouse to avoid
necrotic symptoms; one day in advance of each experiment, healthy plants were moved to greenhouse
bench where the treatments were performed. Adults of Colorado potato beetles (CPB, Leptinotarsa
decemlineata) were collected from potato field in Pennsylvania in 2008 and the lab colony has been
maintained on tomato plants grown in a greenhouse. We have introduced a new population from potato or
tomato field every year, except 2012. The lab colony was reared as described by Chung and Felton (1).
Briefly, eggs were hatched and larvae were reared by feeding them on detached tomato leaves (cv. Better
Boy) in a growth chamber under conditions of 16L:8D and 27°C. CPB adults and larvae were collected
from potato fields in Centre County, PA in 2012 and the field colony was maintained separately as
described previously.
Fluorescent pictures and movie of regurgitation by CPB larvae Leaf petioles were put in 50 μL of
the fluorescent dye solution (0.2 mg/mL in water) and placed in a plastic box with wet paper towels until
the dye solution was absorbed completely. As a negative control, 50 μL of water were used instead of
dye. One 4th instar was fed on a leaf containing the dye overnight. Then larvae were transferred to new
leaves and after 10 min of feeding, the damaged sections of each leaf was mounted on a glass slide. The
slides were observed at an excitation of 488 nm on an Olympus FV1000 Laser Scanning Confocal
Microscope at the Penn State Microscopy and Cytometry Facility-University Park, PA. Fluorescent dye
was not detected on leaves damaged by larvae that fed on leaves without the dye. To take live videos of
regurgitation, larvae that had consumed the leaves containing the fluorescent dye were placed on fresh
leaves. Videos were recorded immediately after placing the larvae on leaves using a Leica M205 FA
stereomicroscope.
1
To investigate whether antibiotic treatment affected deposition of OS, AB-treated or untreated
larvae were allowed to feed on leaves containing the dye overnight. The amount of OS deposited on each
leaf was then estimated by comparison a standard curve as described previously (2).
Antibiotics treatment To test the effects of microbes in OS on plant responses, we reduced the
microbes present in CPB OS as much as possible by feeding third instars a consistent amount of casein-
based artificial diet (3) for 2-3 days containing an antibiotic cocktail (AB). Per 50 mL of artificial diet, we
used three anti-bacterial agents (0.01 g neomycin sulfate (MP Biomedicals), 0.05 g aureomycin
(BioServ), and 0.003g streptomycin (Sigma)) and three anti-fungal agents (0.04 g methyl paraben
(BioServ), 0.03 g sorbic acid (BioServ), and 0.013 g FABCO-I (BioServ)). Control larvae (3rd instars)
received artificial diet without AB and all larvae were provided with fresh diet daily. Only larvae that
excreted yellowish frass indicating that the gut was free from leaf material were used for herbivore
treatments. Because scarce amounts of OS can be collected from larvae that fed on artificial diets, OS was
collected from larvae that received the AB cocktail on leaves instead of artificial diet. For leaves, AB
solutions were prepared in 50 mL of MilliQ water and the concentrations of AB solutions were the same
as used in artificial diet. Detached leaves were treated with 200 μL of AB and placed in a chemical hood
until dry (ca. 1.5-2 h). One larva was placed in a 1 oz cup containing one AB-treated leaflet on top of a
layer of 1% agar to maintain leaf moisture. For untreated larvae, leaves received 200 μL of water without
AB. Two leaves were freshly prepared daily. Larvae that consumed two complete leaves over a 2-day
period were used for herbivore treatment.
Scanning electron microscopy (SEM) images The damaged sections of leaves were collected 1 h
after feeding by larvae that fed on AB-treated or untreated artificial diet. Leaf tissues were fixed overnight
in 2.5% glutaraldehyde and 1.5% paraformaldehyde in 0.1 M sodium cacodylate buffer, pH 7.4, followed
by three washes with 0.1 M sodium cacodylate buffer, pH 7.4 for 15 min each. A secondary fixation was
performed with 2% osmium tetroxide, followed by three washes with 0.1 M sodium cacodylate buffer,
pH 7.4 for 15 min. The samples were dehydrated in an ethanol series 25, 50, 70, 85, 95, and 100% for 15
min each, and then dried in a Bal-tec CPD-030 Critical Point Dryer with liquid CO2. The samples were
coated with gold and palladium in a Bal-tec SCD-050 Sputter Coater. SEM images were taken with a
JEOL JSM 5400 scanning electron microscope at the Penn State Microscopy Facility, University Park,
PA.
Herbivore treatment and application of OS to wounded plants To investigate the effect of
herbivore feeding on plant defenses, one AB-treated or untreated larva was placed on the terminal leaflet
2
of the third leaf (counting from the bottom up) using clip cages (diameter: 2 cm). Undamaged control
plants received an empty clip cage. When the larva consumed 100% of the confined area (ca. 2-3 h), the
larva and the cage was removed. One hundred mg of leaf tissue were harvested for RNA extraction 24 h
after placing insects; 48 h after treatment 50 mg of leaf tissues were collected to measure polyphenol
oxidase (PPO) activity. Leaf samples were frozen in liquid nitrogen and stored at -80°C until used. To test
whether AB affected gene expression and/or PPO activity, we applied AB to wounded plants. The
terminal leaflets of the third leaf of each plant were mechanically wounded using a cork borer (diameter:
4 mm) to remove two holes on the mid-vein and two holes next to the mid-vein. Leaf treatments consisted
of 20 μL of undiluted or diluted (1: 200 v/v with water) AB or water applied to the wounds. Leaf samples
were harvested as described above. To examine the effects of microbes in OS on plant defenses, we
collected OS from AB-treated or untreated larvae. Plants were mechanically wounded as described above
and 20 μL of fresh, crude OS from each treatment group of larvae were applied after diluting 1:4 v/v with
water. Wounded control plants as described above received 20 μL of water to the wounds.
DNA and RNA extraction, and quantitative real time polymerase chain reaction (qPCR) One μg
of RNA was used to synthesize cDNA using the High Capacity cDNA Reverse Transcript kit (Applied
Biosystems). qPCR was carried out using the FastStart Universal SYBR Green PCR Master Mix (Roche)
with the 7500 Fast Real-Time PCR System (Applied Biosystems). The PCR conditions were as follows:
95°C for 10 min, then 40 cycles of 15 sec at 95°C, and 60 sec at 60°C. Primer pairs for qPCR are listed in
Table S3. Expression levels for each gene were normalized to the housekeeping gene ubiquitin. Relative
quantification of gene expression was calculated relative to undamaged controls using the 2-ΔΔct method
(4). Dissociation curves were examined to confirm the specificity of each primer. Efficiency of
amplification for each gene was validated by running qPCR with serial dilutions of cDNA. Amplicon size
was verified using agarose gel electrophoresis. Non-template controls were included to verify the absence
of contamination.
To quantify Pseudomonas sp. that were delivered on leaves by larval feeding, we measured rpoD
abundance because the rpoD gene is present as a single copy, house-keeping gene in the genus
Pseudomonas (5). The partial sequence of a pure culture of Pseudomonas sp. was obtained as PsEG30F
(ATYGAAATCGCCAARCG) and EG790R (CGGTTGATKTCCTTGA) (5) and used to design primers
for qPCR. The primer efficiency was validated by running qRT-PCR with serial dilutions of genomic
DNA from the pure culture. Amplicon size was verified by agarose gel electrophoresis. Total genomic
DNA was extracted from leaves that were damaged by AB-treated or untreated larvae using the Dneasy
Plant Mini kit (Qiagen) following the manufacture's protocol and quantified using NanoDrop (Thermo
Scientific). One hundred ng of genomic DNA were used in triplicate with rpoDF/R primers and a non-
3
template control was included in each run. The PCR conditions were described above. Levels of rpoD
abundance were normalized to plant ubiquitin. Relative abundance of rpoD was calculated relative to AB-
treated larvae using the 2-ΔΔct method (3).
Isolation of bacteria in OS and application of the bacteria to wounded plants To isolate bacteria in
OS from CPB larvae, OS was collected from 4th instars that fed on untreated leaves using a pipette tip.
Fresh, crude OS was diluted with sterile 1x phosphate-buffered saline, pH 6.0 and cultured on 2xYT agar
plates at 27°C for 24 h. Twenty two colonies were randomly selected and subcultured on 2xYT agar
plates. Single colonies of each subculture were grown in 3 mL of 2xYT liquid media overnight in a rotary
shaker at 200 rpm and 27°C. The liquid cultures were stored at -80°C in 20% sterile glycerol until used.
To characterize bacterial isolates in OS that suppressed plant defenses, we applied individual isolates to
wounded plants. Each isolate was grown in 3 mL of 2xYT liquid media at 27°C overnight. Plants were
mechanically wounded as described above and 20 μL of cultured isolates were applied. For wounded
control plants, 20 μL of water or 2xYT media were applied to the wounds. In trial 1, 11 of 22 isolates
were randomly selected and tested for suppression of PPO activity. In trial 2, the other 11 bacterial
isolates and 6 isolates previously tested in trial 1 were applied to the wounds. To investigate whether
suppression of PPO activity was dose-dependent, we applied serial dilutions of bacterial isolates to
wounded plants. Each isolate was grown individually in 2xYT media at 27°C overnight (Optical Density
at 600 nm, OD600 = 0.1, 109 CFU/mL) and diluted 100-fold with 2xYT media to obtain different
concentrations of bacteria, ranging from 103 to 109 CFU/mL. We also tested the effect of cultured
bacteria at 109 CFU/mL on suppression of PPO activity. To investigate whether there were synergistic or
antagonistic interactions among the three cultured bacteria that suppressed PPO activity, we applied all
possible combinations of the three isolates to wounded leaflets. Twenty μL of the combined isolates, a
single isolate, or 2xYT media were applied to the wounds. For example, 10 μL of one isolate and 10 μL
of the other isolate were combined to apply 20 μL of the mixture of two isolates to keep the total
concentration of bacteria consistent among treatments.
Reinoculation of the suppressing bacteria to larvae and zone of inhibition assay To determine
whether the bacterial isolates that suppress JA-mediated responses were secreted by larvae, we
reintroduced the bacteria to AB-treated larvae. Each isolate was grown individually in 2xYT media at
27°C overnight and diluted with 2xYT (OD600 = 0.1, 109 CFU/mL). The bacterial cells were pelleted by
centrifugation at 5,000 x g for 10 min and resuspended in sterile suspension buffer (10 mM MgCl2).
Detached leaves were treated with 200 μL of each bacterial suspension or buffer and placed in a chemical
hood until the suspension dried (ca. 1.5-2 h). Larvae were allowed to feed on leaves that were treated or
4
untreated with AB for 2 d as described above; then each larva received leaves that were inoculated with
the bacterial isolates or suspension buffer for 2 d, receiving freshly prepared leaves daily. The four
herbivore treatments included: untreated larvae that received suspension buffer or the
suppressing bacteria, and AB-treated larvae that received suspension buffer or were reinoculated
with suppressing bacteria.
To confirm whether AB treatment inhibited the growth of the suppressing bacteria, we
conducted a zone of inhibition assay. Each isolate was grown individually in 2xYT media at
27°C overnight and diluted with 2xYT (OD600 = 0.1, 109 CFU/mL). A 100 μL aliquot of 1/100
dilutions was spread on 2xYT agar plates. A sterile filter paper disc (diameter: 5 mm) imbibed
with 20 μL of AB or sterile water was placed on the center of each plate. Plates were incubated
at 27°C for 24 h and diameters of zones of clearing were measured. Three plates were used for
each bacterial isolate.
DNA extraction, PCR, 16S rRNA and rpoD gene sequencing to taxonomically classify bacterial
isolates To identify bacteria to the lowest taxonomic level possible, a small amount of cells from a
single cultured bacterial colony was collected using a pipette tip and suspended in 10 μL of sterile water.
Cells were lysed by boiling the bacterial suspension at 95°C for 10 min. DNA released from the cells was
used to amplify the 16S ribosomal RNA (rRNA) gene using polymerase chain reaction (PCR). Universal
16S rRNA primers 530 F (5'-GTG CCA GCM GCC GCG G-3') and 1392R (5'-ACG GGC GGT GTG
TRC-3') were used. The reaction mixture consisted of 2 μL of suspension, 12.5 μL of GoTaq Green
Master Mix (Promega), 1 μL of 10 μM forward/reverse primers, and 8.5 μL of water. The PCR conditions
were as follows: 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, 53°C for 1 min, and 72°C for 1
min 30 sec, and 72°C for 7 min. To eliminate unincorporated primers and dNTPS, enzymatic digestion
was performed on 5 μL of the PCR products adding 1 μL of EXOSAP-IT (USB Corporation). The
mixture was incubated at 37°C for 15 min, followed by 80°C for 15 min. Two μL of the purified products
were sequenced with 530F primer at the Penn State Genomics Core Facility. To assign the suppressing
bacteria to genus level, 16S rRNA sequences were analyzed by Ribosomal Database Project Naive
Bayesian rRNA Classifier Version 2.4, December 2011 using an 80% confidence threshold (6). 16S
rRNA gene sequences were deposited in GenBank and accession numbers are listed in Table S4.
To test whether Pseudomonas sp. were present in CPB from field populations, DNA was
extracted from larvae and adults using a salting-out protocol (7) and NucleoSpin Tissue kit (Macherey-
Nagel), respectively. Fourth-instar larvae from the lab and field colonies were surface sterilized using
Coverage plus (Seteris), rinsed in sterile water and then gut tissues were dissected. For adult DNA, we
5
used whole adults because two of these adults (kindly donated by S. Fleischer) were collected in 2001 and
1992 in Centre County, PA and could not be dissected. PCR was conducted with EG30F/EG790R to
sequence rpoD gene products. In addition, we used rpoDF/R primers to confirm the presence of the
Pseudomonas sp. PCR conditions were as described above.
Flagellin purification and identification To isolate flagellin from the Pseudomonas sp. cultured from
CPB oral secretions, this purified isolate was grown in 2xYT media at 27°C overnight (109 CFU/mL) and
flagellin was purified as described previously (8). Briefly, cells were collected by centrifugation at 7,000
g for 10 min at 4°C and the bacterial pellets were resuspended in 50 mM phosphate buffer, pH 7.0. To
collect flagella, the bacterial suspension was vortexed for 1 min at maximum speed and centrifuged at
10,000 g for 30 min at 4°C. The supernatant was centrifuged at 100,000 g for 30 min at 4°C. The pellets
were suspended in 0.1 M glycine-HCl, pH 2.0 and centrifuged at 100,000 g for 30 min at 4°C and the
supernatant containing flagellin was adjusted to pH 7.0 with 1N NaOH. Total protein was quantified
using a NI Protein Assay kit (G-Biosciences). Twenty μg of purified flagellin proteins were visualized by
12% SDS-PAGE and stained with Simply Blue Stain (Invitrogen). For protein identification, the band
was excised with a clean razor followed by trypsin digestion and alkylation
(http://med.psu.edu/web/core/proteinsmassspectometry/protocols/in-gel-digestion). Mass spectra were
obtained using the ABSciex 5800 Proteomic analyzer (MALDI TOF-TOF). Protein Pilot™ was used to
analyze MS and MS/MS spectra using Pseudomonas ref sequences from NCBI, which contains 843274
annotated proteins. Protein identification of flagellin was performed at Penn state Hershey Proteomics
and Mass Spectrometry Core Facility.
Statistical analysis The normal distribution and heterogeneity of variance of residuals were verified.
Gene expression data were log2-transformed to meet the assumption of analysis of variance (ANOVA).
Relative gene expression, larval weights, PPO activity, and phytohormone levels between treatments were
analyzed using One-way ANOVA (Proc GLM) followed by Fisher’s Least Significant Difference (LSD)
test. Differences between PPO activities in plants treated with wounding and individual bacterial isolates
and those in plants treated with wounding and 2xYT media were assessed using unpaired Student’s T-
test. SAS 9.3 (SAS Institute) was used for all statistical analyses.
6
Supplementary References
1. Chung SH, Felton GW (2011) Specificity of induced resistance in tomato against specialist lepidopteran and coleopteran species. J Chem Ecol 37:378–386.
2. Peiffer M, Felton G (2009) Do caterpillars secrete “Oral Secretions”? J Chem Ecol 35:326–335.
3. Chippendale GM (1970) Metamorphic changes in fat body proteins of the southwestern corn borer, Diatraea grandiosella. J Insect Physiol 16:1057–1068.
4. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408.
5. Mulet M, Lalucat J, García-Valdés E (2010) DNA sequence-based analysis of the Pseudomonas species. Environ Microbiol 12:1513–1530.
6. Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol 73:5261–5267.
7. Sunnucks P, Hales DF (1996) Numerous transposed sequences of mitochondrial cytochrome oxidase I-II in aphids of the genus Sitobion (Hemiptera: Aphididae). Mol Biol Evol 13:510–524.
8. Felix G, Duran JD, Volko S, Boller T (1999) Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant J 18:265–276.
7
A B
C D
Fig. S1. Oral secretions (OS) produced during herbivory of untreated larvae (A) and AB-treated larvae
(B). AB-treated or untreated larvae that fed on leaves containing Fluorescent Alexa 488 were allowed to
feed on fresh leaves for 10 min. Fluorescent dye (green) was detected on edge of the damaged leaves. No
fluorescence was detected on leaves damaged by untreated (C) or AB-treated larvae (D) that fed on leaves
without the dye. Scale bar = 100 μm.
Fig. S2. Oral secretions (OS) produced during herbivory of AB-treated or untreated larvae. Values are
means ± SEM (N = 5). AB(-), plants damaged by untreated larvae; AB(+), plants damaged by AB-treated
larvae. N.S., not significant.
8
Fig. S3. Larval growth and PPO activities in plants damaged by larvae that fed on AB-treated or untreated
leaves. (A, C, and E) Neonates were allowed to feed on excised leaflets from each treatment for 5 days
and then larval mass was determined. Values are means ± SEM. Different letters represent significant
differences (ANOVA, P < 0.05; followed by LSD test; (A) F(2,35) = 3.92, P < 0.05, N = 12-14; (C) F(2,45) =
19.3, P < 0.0001, N = 16; (E) F(2,33) = 5.99, P = 0.006, N = 12). (B, D, and F) PPO activities were
measured on subsamples from each treatment 48 h after insect feeding. To collect subsamples, two leaf
discs from each of two leaves were pooled as one replicate. Different letters represent significant
differences (ANOVA, P < 0.05, N = 4; followed by LSD test; (B) F(2,9) = 39.7, P < 0.001; (D) F(2,8) = 21.5,
P = 0.0006; (F) F(2,9) = 7.82, P = 0.018). Data from three independent experiments were presented. Con,
undamaged plants; AB(-), plants damaged by untreated larvae; AB(+), plants damaged by AB-treated
larvae.
9
Fig. S4. PPO activities in plants that were treated with mechanical wounding and OS from AB-treated or
untreated larvae. Twenty μL of OS were applied to the wounds. PPO activities were measured 48 h after
treatment. Values are means ± SEM (N = 5-6). Different letters represent significant differences
(ANOVA, P < 0.05; followed by LSD test; F(3,19) = 24.7, P < 0.0001). Con, undamaged plants; W+H2O,
wounding + water; W+OS(-), wounding + OS from untreated larvae; W+OS(+), wounding + OS from
AB-treated larvae.
10
Fig. S5. Expression levels of JA- and SA-regulated genes and PPO activities in plants that were treated
with mechanical wounding and antibiotic (AB). Twenty μL of undiluted or diluted (1:200) AB were
applied to the wounds. Gene expression was measured 24 h after treatment and PPO activities were
measured 48 h after treatment. Values are untransformed means ± SEM (N = 4-6). Different letters
represent significant differences (ANOVA, P < 0.05; followed by LSD test; CysPI, F(3,14) = 22.5, P <
0.0001; PR-1(P4), F(3,14) = 0.99, P > 0.05; PPO activity, F(3,20) =1087, P = 0.0082). Con, undamaged plants;
W+H2O, wounding + water; W+AB, wounding + undiluted AB; W+AB(1:200), wounding + diluted AB
to 1:200 (v/v) with water. CysPI, cysteine proteinase inhibitor; PR-1(P4), pathogenesis-related protein 1
(P4).
11
Fig. S6. JA and SA accumulation in plants damaged by larvae that fed on AB-treated or untreated leaves.
Values are means ± SEM (N = 4-5). Different letters represent significant differences (ANOVA, P < 0.05;
followed by LSD test; for cis-JA, 2h, F(2,11) = 51.0, P < 0.0001; 4h, F(2,11) = 24.0, P < 0.0001; for SA, 2h,
F(2,11) = 10.7, P = 0.0026; 4h, F(2,10) = 3.81, P < 0.05 ). Con, undamaged plants; AB(-), plants damaged by
untreated larvae; AB(+), plants damaged by AB-treated larvae.
12
Fig. S7. PPO activities in wild-type Moneymaker and SA-deficient NahG plants damaged by larvae that
fed on AB-treated or untreated leaves. PPO activities were measured 48 h after insect feeding. Values are
means ± SEM (N = 5-6). Different letters represent significant differences (ANOVA, P < 0.05; followed
by LSD test; for Moneymaker, F(2,14) = 26.5, P < 0.0001; for NahG, F(2,10) = 19.7, P = 0.0003). Con,
undamaged plants; AB(-), plants damaged by untreated larvae; AB(+), plants damaged by AB-treated
larvae.
13
Fig. S8. PPO activities in plants damaged by larvae that fed on AB-treated or untreated leaves. PPO
activities were measured 48h after treatment. Values are means ± SEM (N = 6). Different letters represent
significant differences (ANOVA, P < 0.05; followed by LSD test; F(4,25) = 15.2, P < 0.0001). Con,
undamaged plants; AB(-), plants damaged by untreated larvae; AB(+), plants damaged by AB-treated
larvae; Anti-B, anti-bacterial agents; Anti-F, anti-fungal agents; Anti-B/F, anti-bacterial/fungal agents.
14
Fig. S9. PPO activities in plants that were treated with mechanical wounding and individual bacterial
isolates cultured from OS from untreated Colorado potato beetle larvae. (A) Trial 1, 11 of 22 isolates
(from A to V) were randomly selected and 20 μL of each isolate was applied to wounds. PPO activities
were measured 48 h after treatment. Values are means ± SEM (N = 4-5). Asterisks indicate significant
differences from wounding + 2xYT media treatment (YT) (T-Test, YT vs. Con, t(7) = -4.61, P = 0.0025;
YT vs. I isolate, t(7) = -2.53, P = 0.039; YT vs. S isolate, t(7) = -2.39, P < 0.05 ). (B, C) Trial 2, the
remaining 11 bacterial isolates from trial 1 and 6 isolates tested previously in trial 1 were evaluated for
effects on PPO activity. (T-Test, YT vs. Con, t(7) = -3.43, P = 0.011; YT vs. A isolate, t(7) = -4.79, P =
0.002; YT vs. I isolate, t(7) = -3.0, P = 0.02; YT vs. S isolate, t(7) = -6.75, P = 0.0003). Con, undamaged
plants; H2O, wounding + water; A, wounding + Stenotrophomonas sp.; I, wounding + Pseudomonas sp.;
S, wounding + Enterobacter sp.. *P < 0.05; ** P < 0.01; *** P < 0.001.
15
Suppressing bacteria Non-suppressing bacteria
Fig. S10. PPO activities in plants that were treated with mechanical wounding and serial dilutions of
bacterial isolates (Suppressing bacteria: A, I, S isolates; Non-suppressing bacteria: L, B, and F isolates).
Twenty μL of each isolate were applied to the wounds. PPO activities were measured 48 h after
treatment. Values are means ± SEM (N = 5-6). Different letters represent significant differences
(ANOVA, P < 0.05; followed by LSD test; A isolate, F(5,29) = 11.4, P < 0.0001; I isolate, F(5,32) = 9.86, P <
0.0001; S isolate F(5,28) = 8.48, P < 0.0001; L isolate, F(5,29) = 4.49, P < 0.05; B isolate, F(5,30) = 12.7, P <
0.0001; F isolate, F(5,27) = 17.1, P < 0.0001). Con, undamaged plants; 2xYT, wounding + 2xYT media; A,
Stenotrophomonas sp.; I, Pseudomonas sp.; S, Enterobacter sp.; L, Raoultella sp.; B, Pseudomonas sp.;
F, Enterobacteriaceae.
16
Fig. S11. PPO activities in plants that were treated with mechanical wounding and equivalent
concentration(s) of bacteria. (Suppressing bacteria: I isolate; non-suppressing bacteria: N, T, and F
isolates). Twenty μL of each isolate were applied to plant wounds. PPO activities were measured 48 h
after treatment. Values are means ± SEM (N = 5-6). Asterisks indicate significant differences from
wounding + 2xYT media treatment (YT) (T-Test, YT vs. Con, t(11) = 9.11, P < 0.0001; YT vs. I isolate, t(9)
= -2.53, P = 0.0191). Con, undamaged plants; I, Pseudomonas sp.; N, Sphingobacterium sp.; T,
Enterobacter sp.; F, Enterobacteriaceae. *P < 0.05; *** P < 0.001.
17
Fig. S12. Expression levels of JA- and SA-regulated genes in plants that were treated with mechanical
wounding and the suppressing bacterium, Pseudomonas sp. Twenty μL of I isolate were applied to the
wounds. Gene expression was measured 12 h after treatment. Values are means ± SEM (N = 4-5). Different letters represent significant differences (ANOVA, P < 0.05; followed by LSD test; CysPI, F(2,10)
= 82.7, P < 0.0001; PPOF, F(2,10) = 48.6, P < 0.0001; PR-1(P4), F(2,11) = 58.4, P < 0.0001). Con,
undamaged plants; 2xYT, wounding + 2xYT media, I, wounding + Pseudomonas sp. CysPI, cysteine
proteinase inhibitor; PPOF, polyphenol oxidase F; PR-1(P4), pathogenesis-related protein 1 (P4).
18
Fig. S13. PPO activities in plants that were treated with mechanical wounding and a mixture of the three
suppressing bacteria. Twenty μL of the combined isolates (AI, AS, IS, and AIS) and single isolates (A, I,
and S, 109 CFU/mL) were applied to the wounds. PPO activities were measured 48 h after treatment.
Values are means ± SEM (N = 5-6). Different letters represent significant differences (ANOVA, P <
0.05; followed by LSD test; F(8,41) = 3.61, P = 0.0029). Con, undamaged plants; YT, wounding + 2xYT
media; A, wounding + Stenotrophomonas sp.; I, wounding + Pseudomonas sp.; S, wounding +
Enterobacter sp.
19
Fig. S14. Relative amount of Pseudomonas sp. on leaves delivered by feeding of AB-treated or untreated
CPB larvae. Relative abundance of rpoD was measured 2h after insect feeding. Values are untransformed
means ± SEM (N = 4-5). Asterisks indicate significant differences (T-Test, t(8) = 2.39, P <0.05). AB(-),
plants damaged by untreated larvae; AB(+), plants damaged by AB-treated larvae. *P < 0.05.
20
A B
Fig. S15. (A) Purification of flagellin from Pseudomonas sp. Twenty μg of purified flagellin proteins
(Flg) were loaded on 12% SDS-PAGE and stained by Simply Blue Stain (Invitrogen). (B) PPO activities
in plants that were treated with purified flagellin. Twenty μL of different concentrations of flagellin were
applied to plant wounds (Flg L, 0.0054 ng; Flg H, 0.54 ng) and PPO activities were measured 48 h after
treatment. Values are means ± SEM (N = 6-10). Asterisks indicate significant differences from
wounding + 0.1M glycine-HCl, pH 7.0 treatment (Buffer) (T-Test, Buffer vs. Con, t(14) = 6.68, P < 0.0001;
Buffer vs. Flg L, t(18) = 2.88, P = 0.0099; Buffer vs. Flg H, t(18) = 2.88, P < 0.05. Con, undamaged plants.
*P < 0.05; ** P < 0.01; *** P < 0.001.
21
Fig. S16. PPO activities in plants damaged by AB-treated or untreated larvae collected from potato fields
in PA. PPO activities were measured 48 h after insect feeding. Values are means ± SEM (N = 6).
Different letters represent significant differences (ANOVA, P < 0.05; followed by LSD test; F(2,15) = 34.4,
P < 0.0001). Con, undamaged plants; AB(-), plants damaged by untreated larvae; AB(+), plants damaged
by AB-treated larvae.
22
A
B
Fig. S17. Presence of Pseudomonas sp. in CPB larvae and adults from lab and field colonies. DNA was
extracted from larval guts or whole adults. (A) PCR was conducted with primers PG30F/790F (760bp).
1-9, lab colony larvae; 10-11, lab colony adults; 13-18, 20-25, potato field larvae; 28-29, potato field
adults; 30, adult collected in 2001; 31 adult collected in 1992; 12, marker; 19, PCR negative control; 26,
DNA extraction negative control; 27, positive control (Pseudomonas sp. culture). (B) PCR was conducted
with rpoDF/R (86bp). 2-10, lab colony larvae; 12-13, lab colony adults; 14-19, 21-26, potato field larvae;
28-29, potato field adults; 30, adult collected in 2001; 31, adult collected in 1992; 12, marker; 11, PCR
negative control; 20, DNA extraction negative control; 27, positive control (Pseudomonas sp. culture)
23
Adults (2)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
Larvae (9) Larvae (12) Adults (4)
Lab colony Field population
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 3031
Lab colony Field population
Larvae (9) Adults (2) Larvae (12) Adults (4)
Table S1. Inhibition of growth of suppressing bacteria cultured from larval oral secretions following
application of antibiotics in a filter paper disc. Clear zones of inhibition were measured. Values are means
± S.E.
Bacterial isolate Inhibition zone diameter (mm)
Stenotrophomonas sp. 15.3 ± 0.2
Pseudomonas sp. 15.7 ± 0.2
Enterobacter sp. 20.7 ± 0.2
Table S2. Protein identification by MADLI-TOF Mass Spectrometry
GenBank gi no.a Protein ID / Species %Covb Mr (kDa)/pIc
gi|421525236 flagellin domain-containing protein [Pseudomonas putida LS46] 22.7 56.3/4.5
gi|339488673 flagellin [Pseudomonas putida S16] 19.1 68.0/4.6
gi|402700552 flagellin domain-containing protein [Pseudomonas fragi A22] 12.2 57.7/5.0
a. Gene Info (gi) identifier number on NCBIb. Percentage of identified peptides matching to the complete protein sequence.c. Theoretical molecular mass and isoelectric point (pI) of the identified protein.
24
Table S3. Primer pairs used for qPCR
Gene
name
Description GenBank
Accession No.
Forward/reverse sequence Efficiency
(%)
CysPI Cysteine proteinase
inhibitor
AF198390 GGTGAAGGAATGGGAGGACTTCAA /
GGAGGTTTGGGAATGGAACATTGG
96
PPOF Polyphenol oxidase
F
Z12838 ATGTGGACAGGATGTGGAACGAGT/
ACTTTCACGCGGTAAGGGTTACGA
96
PPOB Polyphenol oxidase
B
Z12834 AGTCAGGGACTGTTTGGACACGAA/ TTCGCGAGTGGGAATACCTCGTTT
90
PR-1(P4) Pathogenesis-related
protein 1 (P4)
AJ011520 TGTCTCATGGTATTAGCCATATTTCAC
T
/CGTTGTGAACCGCAAGATAGTC
104
UBQ Ubiquitin X58253 GCCAAGATCCAGGACAAGGA/
GCTGCTTTCCGGCGAAA
99
rpoD Sigma factor subunit
of RNA polymerase
KC955138 GGTCGTGCCCACAAGGAA/
AACTGCTTGGGTACCAGCTTGA
99
Table S4. Bacteria isolates in OS from CPB larvae
Isolate Classification (Genus or Family) GenBank Accession No.
A Stenotrophomonas JX296529
I Pseudomonas JX296531
S Enterobacter JX296530
L Raoultella KC977256
B Pseudomonas KC977254
N Sphingobacterium KC977253
T Enterobacter KC977257
F Enterobacteriaceae KC977255
25