Transcript
Page 1: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

What is a Genetically

Modified Organism (GMO)? Would you ever eat a GMO?

Page 2: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

A Genetically Modified Organism

is a living thing whose DNA has been altered by

humans.

Page 3: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Transgenic Organisms (Genetically Modified Organisms)

Page 4: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Transgenic Zebra Fish Reading

1. Actively read through quick article: Glowing Fish – First Genetically Modified Organism Available as a Pet

2. Class Discussion

Page 5: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

How will the world be different when

you are your parent’s age?

Page 6: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: If you could create a transgenic

glowing human, what would you

choose to trigger the human to glow?

Page 7: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Transgenic Zebra Fish Reading

1. Zebra Fish vs. GloFish?2. Transgenic?3. Promotor?4. Creating Transgenic?5. Estrogen vs. Stress

Induced Promotors?6. Ethical Issues?7. Avatar?

Page 8: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Using Glofish to study water pollution

Promoter: TATAGCTAGCC

DNA code before geneturns gene on or off

Normal Zebrafish DNA:AGTTATGACCTCATTCAGCGTATCT

Glofish Glows!ATCCTAGTATA

ATCCTAGTATA

AGTTATGACCTCATTCAGCGTATCTGlofish doesn’t glowATCCTAGTATAX X

Page 9: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

How Did Scientists Engineer the Transgenic Glowfish? It is called DNA Microinjection

Glo Gene: ATCCTAGTATA

DNA code for glowing protein

ATCCTAGTATA Normal Zebrafish DNA:

AGTTATGACCTCATTCAGCGTATCTTransgenic Glofish!

Page 10: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Think back to the video

Page 11: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Journal Question : Should humans be altering the DNA of

organisms?

Page 13: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

If you could choose which traits your baby will have,

would you do it? Explain.

Page 14: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: Do soul mates exist?

Explain.

Page 15: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: What are enzymes, and why are they so important for living

organisms? You need your textbook today.

Page 16: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

H2O + CO2 H2CO3

ReactantsProduct

What is an enzyme?Specialized proteins that speed up the rate of a chemical reaction by

lower its activation energy.

Page 17: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Structure of an Enzyme• Active Site – for

attaching onto reactants aka substrates

• The chemical(s) that enzyme attaches to is called the substrate.

• Highly specific with what they bind onto.

• Lock and Key analogy

Page 18: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Analogies for Enzymes

• Mentos and Diet coke

Active site? _______ Substrate? _______

• Stapler analogy Active site? _______ Substrate? _______

link

Page 19: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Essential Concept: Enzymes are involved in almost every

cellular process, including DNA replication

Read pages 300 - 303 in your text book, and answer

questions 1, 2, 5 on pages 303

Page 20: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: Why does DNA need to replicate

itself?

Page 21: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

What is DNA replication?

Replication is the process where DNA makes an exact copy of

itself. Why does DNA

replicate?

Page 22: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Original DNA

Building Blocks for new DNA

(Nucleotides)

DNA Helicase (Protein)

DNA Polymerase

(Protein)

2 identical pieces of DNA

Page 23: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

DNA Replication Steps1. DNA Helicase (enzyme) splits open

double strand right through hydrogen bonds in the middle.

3. DNA Polymerase (enzyme) attaches free floating nucleotides to the open strands, making sure to proofread along the way.4. End product is two identical strands of DNA.

2. Binding Proteins holds two strands apart, so they don’t reattach to one another.

Page 24: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Where do the free-floating nucleotides come from?

Link

Page 25: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

DNA Replication Play - Brainstorm1. What roles, or characters, will we need

to perform a play about DNA replication?

2. How will we form, or represent our DNA using people?

Page 26: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

How do the enzymes make all this happen?

In order to break a bond within a molecule, a certain amount of energy must be used.

Reactants

ActivationEnergy

ProductsGlucose & Galactose

C12H22O11 C6H12O6 + C6H12O6

Page 27: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

If you wanted that bond to break more easily, you would have to lower the amount

of energy it would require to break the bond. An enzyme can lower the “Activation

Energy” of a reaction

Reactants

ActivationEnergy

Products

Lactose

Glucose & Galactose

C12H22O11 C6H12O6 + C6H12O6

Page 28: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Reactants

Products

AE w/o Enzyme

AE w/ Enzyme

Reaction pathway with enzyme

Reaction pathway w/o enzyme

Page 29: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: Why does your body sweat

& shiver? Okay I know what you will say, “to regulate body temperature.”

That is true, but why must you

do that?

Page 30: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Enzymes Only Work in Specific Conditions

Enzymes need the right

conditions to work In extreme

conditions they Denature –

change shape and don’t work

Page 31: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Toothpick Enzyme Activity

1. Read the Pre-Lab, and answer the pre-lab questions.

2. Read through the lab

3. Find a partner, and perform the lab

4. Clean up

5. Collect Class Data on Board

6. Answer Post-Lab Questions

Page 32: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Class Data:Name Normal Cold

Average

Name Normal Denatured (taped)

Average

Page 33: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Journal Question: What are three things that you are thankful for?

Page 34: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

H2 + O2 H2OReactants Products

Energy-Absorbing Reaction

Bonds are formed

Activation energy

Reactants

Products

Energy-Absorbing Reaction

Page 35: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Potential Energy

•Energy at rest. Stored Energy.

Page 36: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

H2 + O2H2O

Reactants Products

Energy-Releasing Reaction

Bonds are broken

Decomposition

Energy-Releasing Reaction

Products

Activation energy

Reactants

Page 37: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Kinetic Energy

•Energy in motion. Releasing energy.

Page 38: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Lactase Post Lab Discussion

1. What happens when you alter the environment of an enzyme?

2. What happens when you alter the active site of an enzyme?

Page 39: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

HomeostasisNegative feedback systems &

positive feedback systems

Page 40: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Welcome to the day you’ve been

preparing for all semester long.

You have 10 minutes to prepare for your

presentation.Please hand in the

presentation rubrics you were given.

Good Luck!-Romanoffski

Page 41: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Why can’t scientists just

inject your arm today with glo-fish genes and

have you glow?

Page 42: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Review DNA Model

1. Monomer & Polymer

2. Sides vs. Center3. Base pairing4. Hydrogen

Bonding5. # of DNA strands6. Antiparallel7. Helix8. Function9. Genes

Page 43: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

What does a typical day look like for a

cell?

When does a cell divide? Is it the same for every

cell?

Page 44: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Cell Type Life Span Cell Division

Red Blood Cell Less than 120 days

NO

Skeletal Muscle Long-lived NOLining of

Esophagus2-3 days Yes

Stomach Cell 2 days YesNerve Cell Very Long

Lived??Most Do Not

Sperm Cell 2-4 days outside the

body

Yes

How long do certain cells live within your body?

Page 45: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Let’s take a look at the

life cycle of a somatic cell!

Page 46: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

1.All body cells except sperm or egg cells

2. Somatic cells are Diploid Cell

What is a somatic cell?

Page 47: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

# of sets

# of DNA pieces in each set

What is a diploid cell?

Page 48: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

N = 23; 23 pieces from MOM & 23 from DAD

What would a human somatic cell look like?

Page 49: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Dad’s & Mom’s Chromosomes are homologous – meaning they match up.

Dad’s Chromo.

Mom’s Chromo

Eye Color Gene

Blue EyesBrown

Eyes

What is unique about mom and dads chromosomes?

Page 50: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: Do you think humans will ever become immortal? Would you want to

live forever?

Page 51: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Karyotype – shows an organism’s homologous chromosomes in order

How is this karyotype different from the first?

Page 52: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: No Journal Question today.

Hand in your Group’s Avatar Scientific Paper

Page 53: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: Why would our cells need to make more

of themselves? Give specific examples.

Page 54: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: What is the most prized

thing that you own? Explain.

Page 55: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

What does the cell cycle look like?

Two Parts: 1. Interphase 2. m-phase

Cell Cycle Visual Non-Audio Version

M-phase

Page 56: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Part 1: Interphase – Cell growth, DNA

replication and Preparation for

Division

Page 57: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Part 2: M-phase – Division of Nucleus

& Cytoplasm

Mitosis is the division of the nucleus (DNA).

Cytokinesis is the division of the cytoplasm (cell).

Page 58: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

After Interphase? After

Mitosis?After

Cytokinesis?

M-phase

9246

46

4646

Page 59: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

•Animal cell – cell membrane pinches in forming a cleavage furrow = 2 new cells

How does cytokinesis work?

•Plant cell – cell plate (membrane & wall) forms between two cells = 2 new cells

Page 60: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

How long does it take to make a new cell?

Page 61: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

If Dr. Evil and mini me’s

cells are the same size, what make

them different?

Page 62: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Large cells require too

many proteins to be made at

the same time. DNA

cannot keep up.

1. DNA Overload

Page 63: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Big cells demand more nutrients

and produce more waste, but do not

have enough roadways to get the nutrients in and waste out

efficiently.

2. Supply and Demand Issues

Page 65: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Stem Cells:Cells that haven’t turned into a specific cell type yet (they’re undifferentiated)

Once a stem cell becomes particular cell type (heart cell, liver cell, lung cell) it is called Differentiated

Page 66: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

All of the somatic cells in your body have the same DNA in them, and the same genes in them

Not all 20,000 genes are turned on at the same time maybe 5,000 at a time

Example: heart cell has different genes turned on than liver, muscle, or brain cell.

How does a stem cell turn into a specialized cell?

Page 68: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Please read the article and answer the questions to

follow

Cancer and Cell Phones

Page 69: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: What is Interphase? Recap what

occurs during interphase.(Take out

your homework)

Page 70: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

How does a cell know when to

divide? Every cell

contains proteins called cyclins

which monitors external and

internal activity, and communicate to cells when it is

time to make a new one.

Page 71: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Cell Cycle! Making new

cells.

Page 72: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: Do children really need

parents? Explain.

Page 73: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

P53

Cyclin & CDK the protein

supervisors of the cell cycle!

Page 74: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: Propose a way that we

can stop cancer. (Think outside the box. There are no silly

ideas)

Page 75: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 76: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Retinal Cancer

Page 77: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Cancer is the uncontrolled cell

growth of abnormal cells in

the body.

What is cancer?

Page 78: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

How do cells become

abnormal?•Cyclin is a protein that turns the cell cycle on and off.

• If the gene for cyclin is mutated, or cell’s ability to respond to cyclin fails, cancer can occur

Page 79: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

How do cells become

abnormal?• DNA miscopying• Exposure to mutagens – agents that can mutate DNA

Examples: Food, UV Rays, Tobacco products, viruses, non-stick pans, chemical carcinogens, cell phones?

Page 80: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

mutation causes cell to lose its ability to start and

stop cell replication.Cyclin is Sleeping

Page 81: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

continual cell growth will lead to a

mass of cells called a tumor.

Page 82: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

What types of tumors exist?

Page 83: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Fast growing and are likely to

spread to other parts of the body

and cause problems

(metastasize – when a tumor spreads)

Malignant Tumors

Page 84: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Slow growing and do not

metastasize. ISOLATED

Benign Tumors

Page 85: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Warning: Graphic Content

Page 86: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 87: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 88: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 89: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 90: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 91: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 92: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 93: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 94: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 95: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 96: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 97: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 98: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?
Page 99: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Cancer Treatment Activity:Cancer treatment has come a long way, but we still have

much more work to do as a species. Cancer is the leading cause of death worldwide

I will assign you and a partner one of the following treatments: Radiation, Chemotherapy, Targeted therapy, transplants, gene therapy

Using your smartphone/electronic device, access this website: http://www.cancer.gov/cancertopics/treatment/types-of-treatment

Write answers the following questions, and be prepared to explain them to the class next time. A few sentences for each.

1. What is your treatment?2. What does it do?3. How does it work?4. What are the side effects?5. Other important / interesting information?

Page 100: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

Please read the article and answer the questions to

follow

Cancer and Cell Phones

Page 101: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

If all of your diploid cells

have the same DNA in it, then what makes a

skin, heart, lung, and brain

cell so different?

Journal Question:

Page 102: What is a Genetically Modified Organism (GMO)?  Would you ever eat a GMO?

JQ: If humans make 2.5x10^7 cells per minute, how many will they make in 1

hour? Place answer in scientific notation.


Top Related