![Page 1: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/1.jpg)
WHAT IS BIOLOGY?
• Technically, the “study” (Gr =logos) of “life” (Gr = bios)
• Where do we draw the line between living and non-living entities?
• For examples: Are viruses alive?
* They consist of only a protein coat and an inner core of nucleic acid
* They can reproduce only inside living cells
* They can be crystallized and kept in a bottle for years and still infect their host cells
![Page 2: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/2.jpg)
What Makes Something Alive?
1. Living organisms take in energy and/or nutrients from the environment.
2. Living organisms sense and respond to the environment in controlled ways.
3. Living organisms grow and reproduce.
4. Living organisms contain genetic material.
5. Living organisms demonstrate homeostasis: the ability to regulate the internal environment to keep it within certain limits.
6. Living organisms have the capacity to evolve.
![Page 3: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/3.jpg)
Hierarchy in BiologyAtoms
Molecules
Macromolecules
Organelles
Cells
Tissues
Organs
Organ Systems
Individual Organisms
Populations
Communities
Ecosystems
Biosphere
![Page 4: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/4.jpg)
Meet the cell
Hi! I’m Sammy Cell.
I am an animal cell. I am microscopic and live inside the human body along with billions of other cells identical to me.
![Page 5: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/5.jpg)
Two types of organisms*
* Every biological ‘rule’ has exceptions!
![Page 6: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/6.jpg)
Animal cell
![Page 7: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/7.jpg)
Nucleus: administrative center of the cell
It consists of chromatin, the unstructured form of the cell's DNA that will organize to form chromosomes during mitosis or cell division.
It coordinates the cell's activities, which include intermediary metabolism, growth, protein synthesis, and reproduction (cell division).
Occupies about 10 percent of a cell's volume, making it the cell's most prominent feature.
![Page 8: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/8.jpg)
A schematic diagram of a prokaryotic cell
![Page 9: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/9.jpg)
Prokaryotic vs. Eukaryotic
Type of cell Definition Examples
Eukaryotic Cell that containsorganelles, largerthan Prokaryoticcells
Majority of livingcells
Prokaryotic Cells that lackorganelles,smaller thanEukaruotic cells
Mostly single-celled organisms
![Page 10: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/10.jpg)
Fundamental DogmaDNA
RNA
Proteins
Circuits
Phenotypes
Populations
GenBankEMBLDDBJ
MapDatabases
SwissPROTPIRPDB
Gene Expression?
Clinical Data ?
Regulatory Pathways? Metabolism?
Biodiversity?
Neuroanatomy?
Development ?
Molecular Epidemiology?
Comparative Genomics?
the post-genomic era will need many more to collect, manage, and publish the coming flood of new findings.
Although a few databases already exist to distribute molecular information,
If this extension covers functional genomics, then “functional genomics” is equivalent to biology.
![Page 11: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/11.jpg)
Chromosomes and DNA
![Page 12: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/12.jpg)
Human Chromosome Banding Patterns
![Page 13: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/13.jpg)
Human Chromosomes
![Page 14: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/14.jpg)
![Page 15: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/15.jpg)
Human somatic cells have 46 chromosomes diploid number (2n) = 46
23 from mom - 23 from dad
22 pairs are autosomes –true homologous pairs
1 pair is not necessarily homologous
- sex chromosomesfemales are XX
males are XY – a non homologous pair.
![Page 16: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/16.jpg)
Genes are linearly arranged along chromosomes
![Page 17: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/17.jpg)
DNA can be simplified to a string of four letters
GATTACA
![Page 18: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/18.jpg)
DNA Structure (overview)
![Page 19: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/19.jpg)
Adenine (A) Guanine (G) (Purines)
Thymine (T) (DNA) (Pyrimidines)
Cytosine (C)
Uracil (U) (RNA)
Nucleotide Bases
![Page 20: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/20.jpg)
Genomic Nucleotide Composition
![Page 21: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/21.jpg)
DNA Reading Frames
AGCTACGTAGCTAGCTAAGCTACGTAGCTAGCTAAGCTACGTAGCTAGCTAAGCTACGTAGCTAGCTA
mRNA has only three reading frames, whereas dsDNA has six!
![Page 22: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/22.jpg)
![Page 23: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/23.jpg)
Genome AnnotationThe Process of Adding Biology Information andPredictions to a Sequenced Genome Framework
![Page 24: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/24.jpg)
Genome AnnotationThe Process of Adding Biology Information andPredictions to a Sequenced Genome Framework
![Page 25: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/25.jpg)
DNA intron-exon structure
promoter
轉錄起始點5’ UTR exon intron Donor site
Acceptor site
Splice site
Start Codon Stop Codon
3’ UTR PolyA
![Page 26: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/26.jpg)
Nucleotide codesA Adenine W Weak (A or T)
G Guanine S Strong (G or C)
C Cytosine M Amino (A or C)
T Thymine K Keto (G or T)
U Uracil B Not A (G or C or T)
R Purine (A or G) H Not G (A or C or T)
Y Pyrimidine (C or T) D Not C (A or G or T)
N Any nucleotide V Not T (A or G or C)
![Page 27: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/27.jpg)
DNA Replication
• The DNA strand that is copied to form a new strand is called a template
• In the replication of a double-stranded or duplex DNA molecule, both original (parental) DNA strands are copied
• When copying is finished, the two new duplexes, each consisting of one of the original strands plus its copy, separate from each other (semiconservative replication)
![Page 28: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/28.jpg)
Schematic diagram of DNA replication.
![Page 29: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/29.jpg)
DNA is unwinding
DNA Synthesis
![Page 30: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/30.jpg)
![Page 31: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/31.jpg)
(RT)
![Page 32: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/32.jpg)
Protein Synthesis
![Page 33: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/33.jpg)
Proteins
• Proteins: macromolecules composed of one or more chains of amino acids
• Amino acids: class of 20 different organic compounds containing a basic amino group (-NH2) and an acidic carboxyl group (-COOH)
• The order of amino acids is determined by the base sequence of nucleotides in the gene coding for the protein
• Proteins function as enzymes, antibodies, structures, etc.
![Page 34: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/34.jpg)
Standard Genetic Code
![Page 35: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/35.jpg)
Amino acid codesAlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSerThrTrpTyrVa lAsxGlxSecUnk
ARNDCQEGHILKMFPSTWYVBZUX
AlanineArginineAsparagineAspartic acidCysteineGlutamineGlutamic acidGlycineHistidineIsoleucineLeucineLysineMethioninePhenylalanineProlineSerineThreonineTryptophanTyrosineValineAsn or AspGln or GluSelenocysteineUnknown
![Page 36: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/36.jpg)
Primary Protein Structure
![Page 37: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/37.jpg)
Multiple Levels of Protein Strucure
( Protein folding)
![Page 38: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/38.jpg)
Tertiary Structure ofSperm whale myoglobin (1MBN)
![Page 39: WHAT IS BIOLOGY? • Technically, the “study” (Gr =logos) of “life” (Gr = bio s)](https://reader036.vdocument.in/reader036/viewer/2022062410/56815dec550346895dcc1589/html5/thumbnails/39.jpg)
Sequence to Structure:It’s a matter of dimensions!
• 1D Nucleic acid sequence
AGT-TTC-CCA-GGG…• 1D Protein sequence
Met-Ala-Gly-Lys-His…M – A – G – K – H…
• 3D Spatial arrangement of atoms