downloaded from //aem.asm.org/content/aem/early/2012/09/04/aem...2012/09/04 · 103 immersed in dab...
TRANSCRIPT
1
Title: Effects of engineered Sinorhizobium meliloti on cytokinin synthesis and 1
tolerance of alfalfa to extreme drought stress 2
Running title: Effects of Sinorhizobium expressing the ipt gene 3
4
Ji Xu, Xiao-Lin Li, Li Luo* 5
6
State Key Lab of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, 7
Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 8
200032, China; 9
10
11
12
Correspondent footnote: 13
Li Luo 14
State Key Lab of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, 15
Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences 16
300 Fenglin Rd, Shanghai, 200032, China 17
Tel: +86-21-54924167 18
Fax: +86-21-54924015 19
E-mail: [email protected] 20
21
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01276-12 AEM Accepts, published online ahead of print on 7 September 2012
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 22
Cytokinin is required for the initiation of leguminous nitrogen-fixation nodules 23
elicited by rhizobia and the delay of the leaf senescence induced by drought stress. A 24
few free-living rhizobia have been found to produce cytokinin. However, the effects 25
of engineered rhizobia capable of synthesizing cytokinin on host tolerance to abiotic 26
stresses have not yet been described. In this study, two engineered Sinorhizobium 27
strains overproducing cytokinin were constructed. The tolerance of inoculated alfalfa 28
plants to severe drought stress was assessed. The engineered strains, which expressed 29
the Agrobacterium ipt gene under the control of different promoters, synthesized more 30
zeatins than the control strain under free-living conditions, but their own growth was 31
not affected. After a four-week inoculation period, the effects of engineered strains on 32
alfalfa growth and nitrogen fixation were similar to those of the control strain under 33
non-drought conditions. After being subjected to severe drought stress, most of the 34
alfalfa plants inoculated with engineered strains survived, and the nitrogenase activity 35
in their root nodules showed no apparent change. A small elevation in zeatin 36
concentration was observed in the leaves of these plants. The expression of 37
antioxidant enzymes increased and the level of reactive oxygen species decreased 38
correspondingly. Although the ipt gene was transcribed in the bacteroids of 39
engineered strains, the level of cytokinin in alfalfa nodules was identical to that of the 40
control. These findings suggest that the engineered Sinorhizobium synthesizing more 41
cytokinin could improve the tolerance of alfalfa to severe drought stress without 42
affecting alfalfa nodulation or nitrogen fixation. 43
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
3
Introduction 44
Cytokinin (CK) is a classical phytohormone. It regulates cell growth, cell 45
differentiation, apical dominance, and leaf senescence. It can be classified into two 46
types, adenine and phenylurea. Adenine-type CKs (zeatin, kinetin, and 47
6-benzylaminopurine) are mainly synthesized in roots by multiple enzymes, including 48
an adenosine phosphate-isopentenyltransferase (IPT), which acts in the first 49
biosynthetic reaction (13, 14). Some plant-pathogenic bacteria (such as 50
Agrobacterium) containing ipt genes can also synthesize CK and so affect their host 51
plant’s growth and development (1, 2). CK can also be produced by recycled tRNAs 52
in plants and bacteria (25). 53
CK is required for the symbiotic interactions between leguminous plants and 54
rhizobia (a group of mutualistic soil bacteria) and for the formation of nitrogen-fixing 55
root nodules (20, 23, 27). The Lotus japonicus HIT1 (encoding a sensor kinase gene 56
of CK) null mutant does not form root nodules (20). In a model rhizobium, 57
Sinorhizbium meliloti nodA- and nodB- mutants failed to produce active nodulation 58
factors (Nod factors), so no root nodules formed on the host alfalfa (Medicao sativa). 59
However, overexpression of a foreign ipt gene in these strains was found to rescue 60
this deficiency (8). 61
Drought tolerance is an important agronomic trait among land crops. This trait 62
can be enhanced by constructing a transgenic plant that overexpresses an IPT gene. 63
The plant then synthesizes more zeatins, and experiences delayed leaf senescence (13, 64
19, 24, 31). However, it is unclear whether S. meliloti overexpressing ipt can produce 65
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
4
more zeatins and thus improve its drought tolerance. In this study, two S. meliloti 66
strains expressing a foreign ipt gene (engineered S. meliloti) were constructed and 67
inoculated onto alfalfa seedlings. After a 4-week inoculation and drought treatment 68
period, the zeatin content, plant biomass, nodulation kinetics, nitrogenase activity, 69
accumulation of reactive oxygen species (ROS), and expression of antioxidant genes 70
were analyzed. The alfalfa plants inoculated with the engineered strains exhibited 71
superior drought tolerance, and a preliminary study into a possible mechanism was 72
performed. 73
Materials and Methods 74
Bacterial strains and plant materials 75
Sinorhizobium 1021 and derivative strains were grown in LB/MC medium 76
supplemented with 500 μg/ml streptomycin and 100 μg/ml neomycin at 28ºC. They 77
were shaken overnight at 200 rpm. Alfalfa (Medicago sativa cv. xinjiang) plants 78
inoculated with rhizobia were grown as described by Wang et al. (29). 79
Construction of engineered S. meliloti 80
The ipt gene from A. tumefaciens C58 was amplified with primers P1 and P2 81
(Table 1), digested with restriction enzymes Nde I and Pst I (BioLab, U.S.), ligated 82
into pSRK-Km with T4 DNA ligase (Takara, Dalian, China), and transformed into 83
DH5α competent cells (15). The colonies carrying recombinant plasmid were 84
screened on a LB agar plate containing kanamycin. The recombinant plasmids were 85
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
5
extracted using a plasmid extraction kit (Transgen, Beijing, China) and identified 86
using PCR, Nde I and Pst I digestion, and DNA sequencing (Invitrogen, Shanghai, 87
China). The ipt gene was under the control of a lac promoter called plac-ipt (18). The 88
recombinant plasmid was transferred into S. meliloti 1021 by conjugation with the 89
help of MT616/pRK600, also called LMG201 (17). The plasmid of pTZS (controlled 90
by a trp promoter) was transferred in Rm1021, called LMG202, and Rm1021 carrying 91
an empty vector (pSRK-Km) was used as a negative control (8). These Sinorhizobium 92
strains were inoculated onto alfalfa seedlings. 93
Severe drought treatment 94
Fifteen alfalfa plants inoculated with rhizobia were grown in barrels (50 cm in 95
diameter) in a greenhouse (29). The plants were watered with 80 ml of Jensen’s liquid 96
medium per barrel per week. After 4 weeks, alfalfa plants were not watered with 97
Jensen’s medium; this represented extreme drought (24). The plants were 98
photographed every day, and fresh and dry weight were measured. 99
ROS assay 100
DAB staining was used for ROS assay (26). Four weeks after inoculation, alfalfa 101
plants were subjected to 4 days of severe drought. Then their leaves were picked and 102
immersed in DAB solution (80 ml of Jemson’s solution + 10 ml of 100 mM 103
Menthol-NaOH +10 ml of 1% DAB-HCl) for 1 hour. They were then washed 3 times 104
with 95% boiled ethanol. The color of the leaves was observed under an optical 105
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
6
microscope (Leica, Germany). Pictures were taken using a digital camera (Nikon, 106
Japan). 107
RT-PCR assay of ipt and antioxidant enzyme genes 108
Primers of A. tumefaciens C58 ipt, S. meliloti rpsF, and the Medicago sativa genes 109
homologous to SOD, CAT, sAPX, thylAPX, DHAR, MDHAR, GR, GPX, and ACTIN 110
were designed and synthesized by Invitrogen and used in RT-PCR (Shanghai, China) 111
(11, 24, 30). The total RNA from freshly collected rhizobia (OD600=0.8) and 112
3-week-old root nodules collected 4 weeks after inoculation of roots and leaves were 113
extracted using RNA Extraction and Purification kits (Transgen, Beijing, China). The 114
total RNA was reverse transcribed as cDNA with a Takara Reverse Transcription Kit 115
(Takara, Dalian, China). RT-PCR was performed according to the protocol provided 116
with a PrimeScript RT Reagent Kit (Takara, Dalian, China). All primers are listed in 117
Table 1. 118
Zeatin content assay 119
An extraction and quantification protocol for CK was carried out as described by Pan 120
et al. with some modifications (21). The supernatant of 50 ml rhizobial LB/MC 121
cultures was prepared by centrifugation at 13,000 g for 10 minutes at 4°C. Then 0.5 g 122
of fresh tissue per sample was ground in 5 ml mixture of 2-propanol, H2O, and 123
concentrated HCl at a ratio of 2:1:0.002 by volume. After centrifugation, supernatants 124
were subjected to 6520 Accurate-Mass Q-TOF LC/MS analysis (Agilent, U.S.). 125
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
7
Purification and analysis conditions were as follows: column, Zorbax extend -C18 126
4.6*50 mm 1.8 μm; 5 μl injection; flow, 0.2 ml/min; flow phase, A= 0.1% FA H2O, 127
B=0.1% FA menthol; detection wavelength, DAD, 210, 254, 280, 320, 360, 226 nm; 128
mass range 50–400; nebulizer pressure 40 psig, drying gas N2 350C 9 L/min, ESIV 129
cap 3500 V; capillary, fragmentor 160 V, skimmer 65 V, Oct RFV pp750V; scanning 130
mode, negative ms scan mode 2 GHz Ext Dyn (1700). 131
Results 132
CK produced by engineered Sinorhizobium under free living conditions 133
The growth of engineered strains was analyzed in the complex medium. As shown 134
in Fig. 1A, the growth curve of LMG201 was identical to that of the control strain. 135
The growth of LMG202 increased after 36 hours of incubation (Fig. 1A). These data 136
suggest that the ipt gene on the plasmid does not suppress the growth of S. meliloti 137
under free-living conditions. 138
To determine whether the ipt gene carried by the plasmid is expressed in 139
free-living rhizobia, total RNA was extracted and RT-PCR was performed. No ipt 140
transcript was detected in the control strain (Fig. 1B). This was consistent with the 141
genomic data of S. meliloti 1021 (9). Unlike the control, the introduced ipt gene was 142
transcribed in the engineered rhizobia LMG201 and LMG202. The level of ipt 143
transcription was lower in LMG201 than in LMG202 (Fig. 1B). This suggests that the 144
introduced ipt gene is expressed in engineered S. meliloti stains. 145
To verify that the transcription of ipt is correlated with CK biosynthesis, zeatin 146
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
8
content was assessed using Q-TOF LC-MS. Although S. meliloti 1021 does not 147
contain any ipt homologous gene, the control strain still synthesized and secreted a 148
small amount of zeatin under free-living conditions (Fig. 1C). In contrast, the two 149
engineered strains produced 2.6 and 4.3 times the zeatin produced by the control 150
strain (Fig. 1C). This was consistent with the level of transcription of the ipt gene 151
(Fig. 1B). From this, it can be concluded that the genetically modified S. meliloti 152
synthesized more CK under free-living conditions than the control strain did. 153
Effects of genetically modified S. meliloti on alfalfa tolerance to extreme drought 154
stress 155
Because transgenic plants overexpressing an IPT gene are usually tolerant to 156
severe drought, the tolerance of alfalfa plants to drought after four-week inoculation 157
with engineered strains was evaluated (13, 19, 24, 31). After a four-week inoculation 158
and incubation period, the alfalfa plants appeared similar in appearance under the 159
ordinary conditions (Fig. 2A). From the beginning of the 5th week, these plants were 160
subjected to severe drought (no watering). After 3–4 days, alfalfa plants inoculated 161
with the control strain started to wilt. After 6 days, these plants became completely 162
wilted. However, plants inoculated with the engineered strains were only partially 163
wilted after 6 days (Fig. 2B). After the drought treatment, all plants were re-watered. 164
Alfalfa plants inoculated with engineered strains regained full or partial turgor, but 165
those inoculated with the control strain did not recover and died (Fig. 2C). 166
Before drought treatment, the biomass (fresh weight) showed no apparent 167
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
9
difference across alfalfa plants (both shoots and roots) inoculated with each rhizobial 168
strain (Figs. 3C–3D). However, the fresh weight of alfalfa plants inoculated with 169
LMG 202 was significantly higher than that of plants inoculated with the control 170
strain after drought treatment (Figs. 3C–3D). The dry weight of all alfalfa plants was 171
almost identical (whole plant, 0.041±0.004, 0.044±0.002 and 0.041±0.002 g/plant; 172
leaves, 0.026±0.002, 0.028±0.001 and 0.028±0.001g/plant). Therefore, water content 173
of alfalfa plants with treatment of extreme drought had about 50%, 30% and 5% after 174
inoculation of the control and two engineered strains, respectively. These data suggest 175
that alfalfa plants inoculated with engineered S. meliloti may maintain water content 176
more effectively than control plants under drought stress conditions. 177
Effects of engineered S. meliloti strains on nitrogen fixation 178
The transcription of ipt in bacteroids was first analyzed by RT-PCR. The 179
transcript of ipt was detected in bacteroids of both engineered strains, but no transcript 180
was observed in the control bacteroids (Fig. 4A), indicating that the ipt gene carried 181
by the plasmid is transcribed in the bacteroids of alfalfa nodules. 182
To determine whether S. meliloti expressing an introduced ipt gene affects 183
nodulation and nitrogen fixation in alfalfa, nodulation kinetics and nitrogenase 184
activity were assessed. The number of nodules from four-week alfalfa induced by the 185
two engineered strains was a little lower than in controls (13.3 % and 12.5%) 186
(Fig. 4B). However, a few large nodules were observed on some alfalfa plants 187
inoculated with both engineered strains, and the average fresh weight of nodules per 188
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
10
plant induced by each strain was not significantly different (0.005±0.02, 0.0052±0.01 189
and 0.0049±0.01 g/plant). Therefore, there was no significant difference in the 190
nitrogen-fixing capacity of alfalfa nodules hosting the two rhizobium strains (Fig. 4C). 191
This indicated that the transcription of the introduced ipt gene in S. meliloti does not 192
affect the nitrogen-fixing capabilities of inoculated alfalfa plants. 193
Because drought stress induces premature senescence and suppresses nitrogen 194
fixation in leguminous nodules, it seemed likely that engineered strains might delay 195
this process (10). Alfalfa nodules hosting the control strain appeared pale pink or gray 196
after drought treatment and during rewatering, but those exposed to the engineered 197
strains were completely pink. The nitrogenase activity of alfalfa nodules elicited by 198
the control strain was also significantly lower after drought stress and even after 199
rewatering than in plants not subjected to drought (by about 50% and 90%, 200
respectively) (Fig. 4C). The nitrogenase activity was only a little lower (by about 10% 201
and 15%, respectively) in nodules containing LM201, but it was not decreased in 202
nodules containing LMG202 (Fig. 4C). This suggests that engineered S. meliloti 203
strains delay the premature senescence that can be induced in alfalfa nodules by 204
drought stress and maintain nitrogenase activity. 205
CK biosynthesis, accumulation of ROS, and expression of antioxidant genes in 206
alfalfa leaves 207
The drought tolerance of alfalfa plants inoculated with engineered strains 208
inspired us to assay the level of CK in alfalfa nodules and leaves. The zeatin levels 209
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
11
were found to be slightly increased (17.79% and 13.97%) in alfalfa leaves inoculated 210
with engineered strains, but no difference was observed in root nodules (Figs. 3A–B). 211
It has been reported that CK delays leaf senescence by upregulating the 212
expression of antioxidant genes, causing decomposition of the reactive oxygen species 213
(ROS) induced by drought stress (24). For this reason, the level of H2O2 in alfalfa 214
leaves subjected to drought stress was tested by DAB staining. Our results showed 215
that less H2O2 accumulated in leaves of alfalfa plants inoculated with the engineered 216
strains than in those of controls (Fig. 5A). The transcription of ROS-scavenging 217
enzymes was analyzed by RT-PCR. Consistently, the transcripts of SOD, CAT, sAPX, 218
thylAPX, DHAR, MDHAR, GR, and GPX were all higher in leaves of alfalfa plants 219
inoculated with LMG202 after 4 days of drought treatment than in the control strain 220
(Fig. 5B). These results suggested that the inoculation of the engineered S. meliloti 221
strain probably promoted decomposition of ROS by increasing the expression of 222
antioxidant enzymes. 223
Discussion 224
It has been reported that engineered rhizobia expressing foreign IAA biosynthetic 225
genes can cause host plants to form fewer, larger nodules and so improve their 226
tolerance to salt and low-phosphate stresses (3–6). However, there has not yet been 227
description of the effects of engineered cytokinin-producing rhizobia on the tolerance 228
of host plants to abiotic stresses. In this study, we described that engineered 229
Sinorhizobium strains synthesied more CK and improved host tolerance to severe 230
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
12
drought stress during the period analyzed. 231
The production of zeatins from Bradyrhizobium japonicum was first determined 232
four decades ago (22). Here, the wild-type S. meliloti was also found to synthesize 233
zeatins (Fig. 1C). These zeatins are probably derived from tRNA molecules, as 234
indicated by the fact that no gene homologous to ipt was found in the genomes of 235
symbiotic Rhizobium (25). 236
Cytokinin is required for the formation of leguminous nodules (18, 21, 25). The 237
slight decrease in the number of alfalfa nodules induced by engineered strains 238
(Fig. 4B) may be due to the modification of cytokinin/auxin balance (5, 23). It has 239
been reported that overproduction of IAA by Rhizobium can reduce the number of 240
Medicago nodules (6). And CRE1-dependent inhibition of PINs changes the polar 241
transportation of auxins (CRE1 is a sensor kinase of CK, and PINs are the transporters 242
of auxin. 12, 23, 28). 243
The lack of any significant difference in nitrogen fixation capacity and growth of 244
alfalfa plants during the period analyzed suggests that larger nodules fix nitrogen 245
more efficiently (Figs. 4C, 2A, 3C, 3D). The use of our engineered S. meliloti strains 246
might not affect the yield of alfalfa plants under the conditions tested. Longer term 247
studies must be performed to confirm this. 248
The high nitrogenase activity of alfalfa nodules hosting engineered strains under 249
severe drought conditions (Fig. 4C) could be attributed to the delay of leaf senescence. 250
By maintaining leaves, photosynthate may thus be provided to nodules. It is possible 251
that the synthesized zeatins are transported from nodules to leaves, which may 252
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
13
increase the level of this phytohomone in leaves. 253
The increase in zeatin content from plants inoculated with engineered strains was 254
determined by both immunological and chromatographic methods, which may play a 255
key role in alfalfa tolerance to severe drought stress by increasing the expression of 256
scavenging genes and fostering the decomposition of ROS (Fig. 5). These data are 257
consistent with those from a study of transgenic plants expressing an ipt gene (24). 258
The increased concentration of zeatins in alfalfa leaves could also be attributed to 259
synthesis by colonized engineered strains, considering that Chi et al. reported that S. 260
meliloti lives freely in the plant roots, stems, and leaves (7). 261
In summary, the engineered Sinorhizobium strain carrying different ipt constructs 262
secreted more CKs. They did not affect the ability of alfalfa nodules to fix nitrogen, 263
but they did improve host tolerance to severe drought stress during the period 264
analyzed. This engineered Rhizobium strain has shown potential for development as a 265
new biotechnological approach to improving the tolerance of host legumes to abiotic 266
stresses. 267
Acknowledgements 268
We would like to thank Dr. Sharon Long for providing the pTZS plasmid, Ms. 269
Haiying Xue for preparing the plant materials, and Dr. Yi-Ning Liu for Q-TOF 270
LC-MS analysis. This work was supported by the National Key Program for Basic 271
Research (2011CB100702 and 2010CB126501), Natural Science Foundation of China 272
(31070218), Natural Science Foundation of Shanghai (09ZR1436500), and 273
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
14
Knowledge Innovation Program of Shanghai Institutes for Biological Sciences, 274
Chinese Academy of Sciences (2009KIP206) to L.L. 275
276
References 277
1. Akiyoshi DE, Klee H, Amasino RM, Nester EW, Gordon PM. 1984. T-DNA of 278
Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proc. Natl. 279
Acad. Sci. U. S. A. 81: 5994–98. 280
2. Barry GF, Rogers SG, Fraley RT, Brand L. 1984. Identification of a cloned 281
cytokinin biosynthetic gene. Proc. Natl. Acad. Sci. U. S. A. 81: 4776–4780. 282
3. Bianco C, Defez R. 2009. Medicago truncatula improves salt tolerance when 283
nodulated by an indole-3-acetic acid-overproducing Sinorhizobium meliloti strain. J. 284
Exp. Bot. 60: 3097-107. 285
4. Bianco C, Defez R. 2010. Improvement of phosphate solubilization and Medicago 286
plant yield by an indole-3-acetic acid-overproducing strain of Sinorhizobium meliloti. 287
Appl. Environ. Microbiol. 76: 4626-4632. 288
5. Bianco C, Imperlini E, Defez R. 2009. Legumes like more IAA. Plant Signal 289
Behav. 4:763-5. 290
6. Camerini S, Senatore B, Lonardo E, Imperlini E, Bianco C, Moschetti G, 291
Rotino GL, Campion B, Defez R. 2008. Introduction of a novel pathway for IAA 292
biosynthesis to rhizobia alters vetch root nodule development. Arch Microbiol. 190: 293
67-77. 294
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
15
7. Chi F, Shen SH, Cheng HP, Jing YX, Yanni YG, Dazzo FB. 2005. Ascending 295
migration of endophytic rhizobia, from roots to leaves, inside rice plants and 296
assessment of benefits to rice growth physiology. Appl. Environ. Microbiol. 71: 297
7271-7278. 298
8. Cooper JB, Long SR. 1994. Morphogenetic rescue of Rhizobium meliloti 299
nodulation mutants by trans-zeatin secretion. Plant Cell. 6: 215-225. 300
9. Galibert F, Finan TM, Long SR, Puhler A, Abola P, Ampe F, Barloy-Hubler F, 301
Barnett MJ, Becker A, Boistard P, Bothe G, Boutry M, Bowser L, Buhrmester J, 302
Cadieu E, Capela D, Chain P, Cowie A, Davis RW, Dreano S, Federspiel NA, 303
Fisher RF, Gloux S, Godrie T, Goffeau A, Golding B, Gouzy J, Gurjal M, 304
Hernandez-Lucas I, Hong A, Huizar L, Hyman RW, Jones T, Kahn D, Kahn ML, 305
Kalman S, Keating DH, Kiss E, Komp C, Lelaure V, Masuy D, Palm C, Peck MC, 306
Pohl TM, Portetelle D, Purnelle B, Ramsperger U, Surzycki R, Thebault P, 307
Vandenbol M, Vorholter FJ, Weidner S, Wells DH, Wong K, Yeh KC, Batut 308
J.2001. The composite genome of the legume symbiont Sinorhizobium meliloti. 309
Science. 293: 668-672. 310
10. Goicoechea N, Merino S, Sánchez-Díaz M. 2005. Arbuscular mycorrhizal fungi 311
can contribute to maintain antioxidant and carbon metabolism in nodules of Anthyllis 312
cytisoides L. subjected to drought. J Plant Physiol. 162:27-35. 313
11. Goodner B, Hinkle G, Gattung S, Miller N, Blanchard M, Qurollo B, 314
Goldman BS, Cao Y, Askenazi M, Halling C, Mullin L, Houmiel K, Gordon J, 315
Vaudin M, Iartchouk O, Epp A, Liu F, Wollam C, Allinger M, Doughty D, Scott 316
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
16
C, Lappas C, Markelz B, Flanagan C, Crowell C, Gurson J, Lomo C, Sear C, 317
Strub G, Cielo C, Slater S. 2001. Genome sequence of the plant pathogen and 318
biotechnology agent Agrobacterium tumefaciens C58. Science. 294: 2323-2328. 319
12. Grunewald W, van Noorden G, van Isterdael G, Beeckman T, Gheysen G, 320
Mathesius U. 2009. Manipulation of auxin transport in plant roots during rhizobium 321
symbiosis and nematode parasitism. Plant Cell. 21:2553–62 322
13. Huynh LN, Van Toai T, Streeter J, Banowetz G. 2005. Regulation of flooding 323
tolerance of SAG12:ipt Arabidopsis plants by cytokinin. J. Exp.Bot. 56: 1397-1407. 324
14. Kamada-Nobusada T, Sakakibara H. 2009. Molecular basis for cytokinin 325
biosynthesis. Phytochemistry. 70: 444-449. 326
15. Khan SR, Gaines J, Roop 2nd RM, Farrand SK. 2008. Broad-host-range 327
expression vectors with tightly regulated promoters and their use to examine the 328
influence of TraR and TraM expression on Ti plasmid quorum sensing. Appl. Environ. 329
Microbiol. 74: 5053–5062. 330
16. Kudo T, Kiba T, Sakakibara H. 2010. Metabolism and long-distance 331
translocation of cytokinins. J. Integr. Plant Biol. 52: 53-60. 332
17. Leigh JA, Signer ER, Walker GC. 1985. Exopolysaccharide-deficient mutants 333
of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. U. S. A. 82: 334
6231–6235. 335
18. Luo L, Xu J, Li XL. 2010. Chinese Patent: a new approach improving plant 336
quality. 2010101330890 337
19. Ma QH. 2008. Genetic engineering of cytokinins and their application to 338
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
17
agriculture. Crit. Rev. Biotechno. 28: 213-32. 339
20. Murray JD, Karas BJ, Sato S, Tabata, S, Amyot, L, and Szczyglowski, K. 340
2007. A cytokinin perception mutant colonized by Rhizobium in the absence of nodule 341
organogenesis. Science. 315: 101–104. 342
21. Pan X, Welti R, Wang X. 2010. Quantitative analysis of major plant hormones in 343
crude plant extracts by high-performance liquid chromatography–mass spectrometry. 344
Nat. Protoc. 5: 986-992 345
22. Phillips DA, Torrey JG. 1972. Studies on cytokinin production by Rhizobium. 346
Plant Physiol. 49:11-15. 347
23. Plet J, Wasson A, Ariel F, Le Signor C, Baker D, Mathesius U, Crespi M, 348
Frugier F. 2011. MtCRE1-dependent cytokinin signaling integrates bacterial and 349
plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula. 350
Plant J. 65: 622-633. 351
24. Rivero RM, Kojima, M, Gepstein A, Sakakibara H, Mittler R, Gepstein S, 352
Blumwald E. 2007. Delayed leaf senescence induces extreme drought tolerance in a 353
flowering plant. Proc. Natl. Acad. Sci. U. S. A. 104: 19631–19636. 354
25. Sakakibara H. 2006. Cytokinins: activity, biosynthesis, and translocation. Annu. 355
Rev. Plant Biol. 57: 431-449. 356
26. Thordal-Christensen H, Zhang Z, Wei Y, Collinge DB. 1997. Subcellular 357
localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive 358
response during the barley-powdery mildew interaction. Plant J. 11: 1187-1194. 359
27. Tirichine L, Sandal N, Madsen LH, Radutoiu S, Albrektsen AS, Sato S, 360
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
18
Asamizu E, Tabata S, Stougaard J. 2007. A gain-of-function mutation in a 361
cytokinin receptor triggers spontaneous root nodule organogenesis. Science. 315: 362
104–107. 363
28. van Noorden GE, Ross JJ, Reid JB, Rolfe BG, Mathesius U. 2006. Defective 364
long-distance auxin transport regulation in the Medicago truncatula super numeric 365
nodules mutant. Plant Physiol. 140:1494–506. 366
29.Wang Y, Xu J, Chen A, Wang Y, Zhu J, Yu G, Xu L, Luo L. 2010. GGDEF and 367
EAL proteins play different roles in the control of Sinorhizobium meliloti growth, 368
motility, exopolysaccharide production, and competitive nodulation on host alfalfa. 369
Acta Biochim.Biophys. Sin. (Shanghai) 42:410-417. 370
30. Yao SY, Luo L, Har KJ, Becker A, Rüberg S, Yu GQ, Zhu JB, Cheng HP. 371
2004. Sinorhizobium meliloti ExoR and ExoS proteins regulate both succinoglycan 372
and flagellum production. J. Bacteriol. 186:6042-9. 373
31. Zhang J, Van Toai T, Huynh L, Preiszner J. 2000. Development of 374
flooding-tolerant Arabidopsis thaliana by autoregulated cytokinin production. 375
Molecular Breeding. 6: 135–144. 376
Table 1 Primers used in PCR 377
378
Gene Primer Sequence
iptc forward CGTCATATGTTACTCCATCTCATCTACGGACC
reverse TAGCTGCAGTCACCGAATTCGCGTCAGC
Actin forward TGGCATCACTCAGTACCTTTCAAG
reverse ACCCAAAGCATCAAATAATAAGTCAACC
SOD forward AATGTCACCGTCGGTGATGATG
reverse GTTCATCCTTGCAAACCAATAATACC
CAT forward CCTATTTGATGATGTGGGTGTCC
reverse GTCTTGAGTAGCATGGCTGTGGT
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
19
sAPX forward ACCAACCTCGTTCAGTGTCCAT
reverse AGAGCGCTGTCTGCGTTCTATT
thylAPX forward TCATCCTCTTTTGATTCGTTTGG
reverse CTTTGATTGGCTGGAGAAGTTTC
DHAR forward GATTGGAGACTGCCCTTTTAGC
reverse CTGTAGCCTTTTCAGGTGGTGT
MDHAR forward AGCGTTCGTTTACGTGATTCTTG
reverse CATTTGGGAGTTAGCCTTTCCTC
GR forward TTTGAACAAAGGTGCAGAAGAAGG
reverse TGGGAACACAACCACGAATGAC
GPX forward TGGACAGGAGCCAGGATCTAGT
reverse ATTTTCAGAGGAGCGGTGGTAG
iptrt forward TTCGGACGCCTTTCTCAC
reverse GCCGCCCTGCATCAATAT
rpsF forward CCTCGCTCGGCAGGACAT
reverse GCCTTGCGGTTCTTCTTGAT
iptc, primers used to clone the ipt open reading frame; iptrt, primers used for analysis 379
of the expression of ipt during RT-PCR. 380
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
20
381
Fig. 1 Effects of engineered S. meliloti strains on cytokinin production under 382
free-living conditions. A. Growth curve of S. meliloti strains in LB/MC medium. B. 383
Expression of ipt in free-living S. meliloti strains. C. Cytokinin content in cultures of 384
S. meliloti (OD600≈2.0). Data from three independent experiments. Control, S. meliloti 385
1021 carrying an empty plasmid. LMG201 and LMG202, S. meliloti 1021 expressing 386
constructs of Plac-ipt and Ptrp-ipt, respectively. T-testing was performed in C. Single 387
stars indicate significant differences (P<0.05); two stars indicate highly significant 388
differences (P<0.01). 389
390
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
21
391
Fig. 2 Tolerance of alfalfa plants to extreme drought stress after inoculation with 392
engineered S. meliloti strains. A. Alfalfa plants at 4-WAI not subjected to drought 393
stress treatment. B. Alfalfa plants at 4-WAI subjected to severe drought (absence of 394
watering) for 3–4 days. C. Alfalfa plants at 5-WAI were re-watered after 6 days of 395
drought treatment. 396
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
22
397
Fig. 3 Effects of engineered S. meliloti strains on alfalfa growth. A. Cytokinin content 398
in alfalfa leaves. B. Cytokinin content in alfalfa nodules. C. Fresh weight of alfalfa 399
shoots. D. Fresh weight of alfalfa roots. Data from three independent experiments, 400
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
23
mean±SD, n>20. T-testing was performed. Single stars indicate significant differences 401
(P<0.05) 402
403
404
Fig. 4 Effects of engineered S. meliloti strains on alfalfa nodulation and nitrogen 405
fixation. A. Expression of ipt in alfalfa nodules induced by Rhizobium. B. The number 406
of nodules at 4-WAI (weeks after inoculation) in alfalfa plants. C. Nitrogenase activity 407
of alfalfa nodules induced by S. meliloti strains. Data from three independent 408
experiments, the mean±SD, n>20. T-testing was performed in B and C. Single stars, 409
indicate significant differences (P<0.05); two stars indicate highly significant 410
differences (P<0.01). 411
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
24
412
413
Fig. 5 Levels of ROS were detected in alfalfa leaves after inoculation with engineered 414
S. meliloti strains. A. H2O2 accumulation in alfalfa leaves as detected by DAB staining. 415
B. Expression of ROS scavenging enzyme genes in leaves of alfalfa plants subjected 416
to 4 days of severe drought. Data from one representative experiment are shown. The 417
experiment was repeated at least three times. 418
419
420
421
422
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from
Table 1
Gene Primer Sequence
iptc forward CGTCATATGTTACTCCATCTCATCTACGGACC
reverse TAGCTGCAGTCACCGAATTCGCGTCAGC
Actin forward TGGCATCACTCAGTACCTTTCAAG
reverse ACCCAAAGCATCAAATAATAAGTCAACC
SOD forward AATGTCACCGTCGGTGATGATG
reverse GTTCATCCTTGCAAACCAATAATACC
CAT forward CCTATTTGATGATGTGGGTGTCC
reverse GTCTTGAGTAGCATGGCTGTGGT
sAPX forward ACCAACCTCGTTCAGTGTCCAT
reverse AGAGCGCTGTCTGCGTTCTATT
thylAPX forward TCATCCTCTTTTGATTCGTTTGG
reverse CTTTGATTGGCTGGAGAAGTTTC
DHAR forward GATTGGAGACTGCCCTTTTAGC
reverse CTGTAGCCTTTTCAGGTGGTGT
MDHAR forward AGCGTTCGTTTACGTGATTCTTG
reverse CATTTGGGAGTTAGCCTTTCCTC
GR forward TTTGAACAAAGGTGCAGAAGAAGG
reverse TGGGAACACAACCACGAATGAC
GPX forward TGGACAGGAGCCAGGATCTAGT
reverse ATTTTCAGAGGAGCGGTGGTAG
iptrt forward TTCGGACGCCTTTCTCAC
reverse GCCGCCCTGCATCAATAT
rpsF forward CCTCGCTCGGCAGGACAT
reverse GCCTTGCGGTTCTTCTTGAT
on April 26, 2020 by guest
http://aem.asm
.org/D
ownloaded from