downloaded from on march 24, 2020 by guest€¦ · oxides, have received increasing attention in...
TRANSCRIPT
1
Antibacterial activity and mechanism of zinc oxide nanoparticles on Campylobacter jejuni 1
2
Yanping Xie1, Yiping He
2*, Peter L. Irwin
2, Tony Jin
3 and Xianming Shi
1* 3
4
1Joint Sino-US Food Safety Research Center & Bor Luh Food Safety Center, School of 5
Agriculture & Biology, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai, China 6
200240 7
2Joint US-Sino Food Safety Research Center & Molecular Characterization of Foodborne 8
Pathogens Research Unit, 3Residue Chemistry and Predictive Microbiology Research Unit, US 9
Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center 10
(USDA-ARS-ERRC), 600 East Mermaid Lane, Wyndmoor, PA, USA 19038 11
12
13
*Corresponding authors: 14
Yiping He 15
USDA-ARS-ERRC, 600 East Mermaid Lane, Wyndmoor, PA, USA 19038 16
Phone: (215) 233-6422, FAX: (215) 836-3742, E-mail: [email protected] 17
Xianming Shi 18
Mail Box 49#, School of Agriculture & Biology, Shanghai Jiao Tong University, 800 19
Dongchuan Road, Shanghai, China 200240 20
Phone & Fax: 86-21-3420-6616, E-mail: [email protected] 21
22
Running title: Antimicrobial mechanism of ZnO nanoparticles 23
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02149-10 AEM Accepts, published online ahead of print on 4 February 2011
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 24
The antibacterial effect of ZnO nanoparticles on Campylobacter jejuni was investigated for cell 25
growth inhibition and inactivation. The results showed that C. jejuni was extremely sensitive to 26
the treatment with ZnO nanoparticles. The minimal inhibitory concentration (MIC) of ZnO 27
nanoparticles for C. jejuni was determined to be 0.05-0.025 mg/ml, which is 8-16 fold lower than 28
that of Salmonella enterica Entertidis and Escherichia coli O157:H7 (0.4 mg/ml). The action of 29
ZnO nanoparticles on C. jejuni was determined to be bactericidal, not bacteriostatic. Scanning 30
electron microscopic examination revealed that the majority of the cells transformed from spiral 31
shapes into coccoid forms after exposure to 0.5 mg/ml ZnO nanoparticles for 16 hrs, which is 32
consistent with the morphological changes of C. jejuni under other stressed conditions. These 33
coccoid cells were found to have a certain level of membrane leakage by ethidium monoazide-34
quantitative PCR (EMA-qPCR) assay. To address the molecular basis of ZnO nanoparticle 35
action, a large set of genes involved in cell stress response, motility, pathogenesis, and toxin 36
productions were selected for a gene expression study. Reverse transcription-quantitative PCR 37
(RT-qPCR) analysis showed that in response to the treatment of ZnO nanoparticles, the 38
expression levels of two oxidative stress genes (katA and ahpC) and a general stress response 39
gene (dnaK) were increased 52-, 7-, and 17-fold, respectively. These results suggest that the 40
antibacterial mechanism of ZnO nanoparticles is most likely due to the disruption of the cell 41
membrane and the oxidative stress in Campylobacter. 42
43
44
Keywords: ZnO nanoparticles, Campylobacter jejuni, antibacterial mechanism, oxidative stress, 45
gene expression. 46
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
3
Introduction 47
To control microbial contaminants in food and extend the shelf life of fresh produce and meat, 48
directly adding antimicrobial agents to food or into packaging materials during food processing 49
is considered an effective means. In recent years, inorganic antimicrobial agents, such as metal 50
oxides, have received increasing attention in food applications because not only are they stable 51
under high temperatures and pressures which may occur in harsh food processing conditions, but 52
they are also generally regarded as safe to human beings and animals relative to organic 53
substances (6, 24). 54
Zinc Oxide (ZnO) is listed as “Generally Recognized as Safe” (GRAS) by the U.S. Food and 55
Drug Administration (21CFR182.8991). As a food additive, it is the most commonly used zinc 56
source in the fortification of cereal-based foods. Because of its antimicrobial properties, ZnO has 57
been incorporated into the linings of food cans in packages for meat, fish, corn and peas to 58
preserve colors and to prevent spoilage. Nano-sized particles of ZnO have more pronounced 59
antimicrobial activities than large size particles, since the small size (less than 100 nm) and high 60
surface-to-volume ratio of nanoparticles allow for better interaction with bacteria. Recent studies 61
have shown that these nanoparticles have selective toxicity to bacteria but exhibit minimal 62
effects on human cells (21). ZnO nanoparticles were shown to have a wide range of antibacterial 63
activities on both Gram-positive and Gram-negative bacteria, including major foodborne 64
pathogens like E. coli O157:H7, Salmonella, Listeria monocytogenes, and Staphylococcus 65
aureus (13, 14), but currently there is no information available on its antibacterial effect with 66
species of Campylobacter. Campylobacter jejuni is a leading cause of microbial foodborne 67
illness in the world. In fact it has been recently shown that approximately 80% of poultry 68
products are contaminated with this pathogen (11). Consumption of Campylobacter-69
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
4
contaminated food and water usually causes a mild to severe gastrointestinal infection in humans 70
which sometimes can develop into a life-threatening disease called Guillain-Barré syndrome 71
(28). Therefore, it is important to focus on the use of ZnO particles as a potential food safety 72
intervention technology to effectively control Campylobacter and other microbial contaminants 73
in food. 74
To make better use of ZnO nanoparticles in food products and assist in the development of 75
powerful, but nontoxic, antimicrobial derivatives, it is necessary to understand the mechanism of 76
action of ZnO nanoparticles in bacteria; but, to date, the process underlying their antibacterial 77
effect is not clear. However, a few studies have suggested that the primary cause of the 78
antibacterial function might be from the disruption of cell membrane activity (4). Another 79
possibility could be the induction of intercellular reactive oxygen species including hydrogen 80
peroxide (H2O2), a strong oxidizing agent harmful to bacterial cells (13, 22). Also, it has been 81
reported that ZnO can be activated by UV and visible light to generate highly reactive oxygen 82
species such as OH-, H2O2, and O2
2-. The negatively charged hydroxyl radicals and superoxides 83
cannot penetrate into cell membrane, and are likely to remain on cell surface, whereas H2O2 can 84
penetrate into bacterial cells (18). To better understand the nature of the inhibitory and lethal 85
effects of ZnO nanoparticles on bacteria, we used C. jejuni as a model organism to investigate 86
this mechanism. C. jejuni is a Gram-negative, spiral-shaped, highly motile, thermophilic and 87
microaerophilic bacterium, growing optimally in a neutral pH and microaerobic environment at 88
42oC. Unlike other major foodborne pathogens such as E. coli O157:H7, Salmonella and L. 89
monocytogenes, C. jejuni has a low tolerance to oxygen but does require some for growth (i.e., 90
microaerophilic). Due to the lack of some important oxidative stress response genes (soxRS and 91
oxyR) and a global stationary-phase stress response gene (rpoS), C. jejuni is extremely sensitive 92
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
5
to oxidative stress as well as other environmental stresses. Exposure of this organism to different 93
stresses results in a remarkable morphological shift from spiral-shaped cells to coccoid forms, 94
which is associated with the loss of culturability (10, 25). Due to these distinguishing 95
characteristics and sensitive stress responses, C. jejuni is highly suitable for studying ZnO 96
nanoparticle modes of action on bacterial cells, especially in the assessment of cell membrane 97
integrity and reactive oxygen species-induced stress response. 98
The purpose of this research was to evaluate the antibacterial effects and investigate the 99
mechanism of ZnO nanoparticle action on C. jejuni by examining cell morphology, membrane 100
permeability, and gene expression through the utilization of scanning electron microscopy as 101
well as advanced molecular methods. Results are compared to other foodborne pathogens 102
including E. coli O157:H7 and Salmonella. 103
104
Materials and Methods 105
ZnO nanoparticles 106
ZnO nanoparticles (99.7+ %) with average size of ~30 nm and Brunauer-Emmett-Teller (BET) 107
specific surface area of ~35m2/g were purchased from Inframat Advanced Materials LLC 108
(Manchester, CT). A stock suspension was prepared by resuspending the nanoparticles into 109
ddH2O to yield a final concentration of 100 mg/ml and kept at 4oC. Immediately after vigorous 110
vortex mixing, aliquots of the suspension were added into Mueller-Hinton medium (MH; Becton 111
Dickinson Co., Sparks, MD) for the following experiments. 112
113
Bacterial culture conditions and antibacterial test 114
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
6
C. jejuni strain 81-176, ATCC 35918, and ATCC 49943 were grown at 42oC in MH broth in a 115
microaerobic workstation (Don Whitley Scientific, Ltd., Shipley, UK) maintaining 5% O2, 10% 116
CO2, 85% N2, and 82% relative humidity. A mixed culture of the three C. jejuni strains was 117
prepared by combining equal volume (1/3) of each pure culture growing at the late-log phase. 118
Salmonella enterica Enteritidis ATCC 13076 and E. coli O157:H7 ATCC 43889 were 119
aerobically grown at 37oC in Luria-Bertani medium (Becton Dickinson). Bacterial growth 120
inhibition was tested by inoculating ca.104 CFU of C. jejuni cells on each MH agar plate or into 121
20 ml of MH broth containing various concentrations of ZnO nanoparticles (0, 0.025, 0.03, 0.04, 122
0.05, and 0.10 mg/ml). After a 16 hr incubation, the inhibition of cell growth was determined by 123
counting the number of colony forming units (CFU) on the plates or the turbidity of the cell 124
culture. The inoculations that showed no cell growth were further verified for cell culturability 125
by spreading 1 ml aliquots of the culture onto drug-free MH agar plates to determine the 126
bactericidal (bacteria-killing) or bacteriostatic (bacteria-inhibiting) effect of ZnO nanoparticles. 127
The minimal inhibitory concentration (MIC) of ZnO nanoparticles for C. jejuni, E. coli 128
O157:H7, and Salmonella and was determined using a broth microdilution method reported 129
previously (19). Briefly, serial two-fold dilutions of the nanoparticles ranging from 0.00625 to 130
1.6 mg/ml were prepared in a 96-well microtiter plate using MH or LB broth. Freshly grown 131
bacterial cells were inoculated into each well to give a final concentration of 104 CFU/ml. After 132
microaerobic incubation for 24 hrs at 42 oC for C. jejuni or aerobic incubation for 16 hrs at 37
oC 133
for E. coli O157:H7 and Salmonella, cell growth in each well was monitored and compared with 134
the positive control in which no ZnO nanoparticles were added. MIC was recorded as the lowest 135
concentration of ZnO nanoparticles that completely inhibited cell growth. 136
137
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
7
Examination of cell morphology by scanning electron microscope (SEM) 138
Mid-log phase C. jejuni cultures were treated with 0.5 mg/ml ZnO nanoparticles for 12 hrs under 139
the microaerobic conditions. Aliquots of 200 µl treated and untreated cell suspensions were 140
deposited on glass coverslips. After air drying for 1 hr, the coverslips were fixed with a primary 141
fixative solution containing 2.5% glutaraldehyde and 0.1 M imidazole buffer solution (pH 7.2) 142
for 2 hours. Subsequently, the fixative solution was exchanged with 0.1M imidazole buffer, 143
followed by dehydration with a series of ethanol solutions (50%, 80% and 100%) with three 144
ethanol changes at each concentration. Finally the coverslips were dried with liquid CO2-ethanol 145
exchange in a DCP-1 Critical Point Dryer (Denton Vacuum, Inc., Cherry Hill, NJ). The 146
coverslips were mounted on SEM stubs with carbon adhesive tabs, then sputter-coated with a 147
thin layer of gold using a Scancoat Six Sputter Coater (BOC Edwards, Wilmington, MA). Digital 148
images of the treated and untreated C. jejuni cells were acquired using a Quanta 200 FEG 149
scanning electron microscope (FEI Inc., Hillsboro, OR) at an accelerating voltage of 10 kV and 150
instrumental magnifications of 25,000x. 151
152
EMA treatment, DNA isolation, and EMA-qPCR assay 153
Ethidium monoazide (EMA) treatment of C. jejuni cells and a follow-up qPCR assay were 154
carried out as described before (10). Briefly, 1 ml of freshly grown cells was treated with 20 155
mg/ml EMA in the dark for 5 min and subsequently exposed to a 600 W halogen light for 1 min. 156
Cells were then immediately washed with Phosphate-Buffered Saline and subjected to DNA 157
extraction using the DNAeasy Tissue kit (Qiagen, Valencia, CA) following the manufacturer’s 158
instruction. In the qPCR analysis, the hipO gene was selected as a target for detection because of 159
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
8
the uniqueness of the DNA sequence to C. jejuni. The primers and TaqMan probe of hipO used 160
in this experiment were reported in previous work (9). 161
162
RNA preparation and RT-qPCR analysis of gene expression 163
To prepare total cellular RNA, 80 ml of the C. jejuni 81-176 culture in the late-log phase of 164
growth were treated or not treated with ZnO nanoparticles at 0.1 mg/ml for 30 min. The ZnO 165
concentration used herein was determined from the cell killing results shown in Figure 1A. After 166
the treatment, cells were harvested by centrifugation at 4000 x g for 10 min at 4 oC. RNA 167
isolation was carried out using the TRI-Reagent following the manufacturer’s instructions 168
(Molecular Research Center, Inc. Cincinnati, OH). DNase I treatment and reverse transcription 169
of the RNA samples were processed as described before (8). Quantification of the cDNA was 170
performed on a 7500 Real-time PCR system (Applied Biosystems, Foster City, CA). For PCR, 171
all the listed primers were designed using the Primer 3 software (http://frodo.wi.mit.edu/cgi-172
bin/primer3/primer3_www.cgi). Each 20 µl PCR mixture contained 0.25x Evagreen dye 173
(Biotium, Hayward, CA), 0.25 µM of each primer, 2 µl of cDNA template, 5 Units of Platinum 174
Taq DNA polymerase, and buffer (Invitrogen, Inc., Carlsbad, CA). The amplification program 175
was 50oC for 2 min, 95
oC for 10 min, followed by 40 cycles of 95
oC for 15 sec and 60
oC for 1 176
min. The gyrA gene was used as a reference for data normalization. Housekeeping genes tsf and 177
16s rRNA were also included as controls to ensure data reliability. All the samples, including no-178
RT and no-template controls, were analyzed in triplicate. Data analysis was performed using 2-
179
∆∆Ct method, where ∆∆Ct = ∆Ct (treated sample) - ∆Ct (untreated sample), ∆Ct = Ct (target 180
gene) - Ct (gyrA), and Ct is the threshold cycle value for amplified gene (15). 181
182
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
9
Results 183
Growth inhibition of C. jejuni by ZnO nanoparticles 184
Growth inhibition of C. jejuni 81-176 was examined both on agar plates and in broth containing 185
a range of concentrations (0, 0.025, 0.03, 0.04, 0.05, and 0.10 mg/ml) of ZnO nanoparticles. On 186
the plates spread with 104 CFU/plate and in the broth inoculated with the equivalent number of 187
the cells, bacterial growth was completely inhibited at ≥0.03 mg/ml of ZnO nanoparticles. 188
However, at a concentration of 0.025 mg/ml, ZnO nanoparticles had a modest effect on cell 189
growth resulting in the recovery of fewer viable cells than the untreated controls. To determine if 190
the growth inhibition was caused by an inhibitory or lethal effect of ZnO nanoparticles, 100 µl 191
aliquots of the treated cell suspension were spread onto drug-free MH plates. The results showed 192
that the cells treated with ≥ 0.03 mg/ml of the nanoparticles for 16 hrs were no longer culturable, 193
suggesting a lethal effect of ZnO nanoparticles on C. jejuni. In addition, the MIC of ZnO 194
nanoparticles for all three C. jeuni strains was determined to be between 0.05 and 0.025 mg/ml, 195
which was 8-16 fold lower than that (0.4 mg/ml) for E. coli O157:H7 and S. Enteritidis, clearly 196
indicating a higher susceptibility of C. jejuni to ZnO nanoparticles. 197
198
Lethal effect of ZnO nanoparticles on C. jejuni 199
The lethal effect of ZnO nanoparticles on C. jejuni was further investigated using ca. 108 200
CFU/ml of freshly grown pure and mixed cultures of C. jejuni strain 81-176, ATCC 35918, and 201
ATCC 49943. Cell culturability of all three C. jejuni strains was affected by ZnO nanoparticles 202
at all the concentrations tested (Fig. 1A-D). Most significantly, 0.5, 0.3 and 0.1 mg/ml of ZnO 203
nanoparticles resulted in a complete killing (100%) of 108 CFU/ml C. jejuni cells in 3 hrs or less. 204
The pure and mixed cultures of three C. jejuni strains showed a similar susceptibility to ZnO 205
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
10
nanoparticles. In contrast to the strong and rapid bactericidal action on C. jejuni, 20-100 fold 206
higher concentrations (10 mg/ml) of ZnO nanoparticles only caused a 1 or 2 log reduction of 207
viable E. coli O157:H7 and S. Enteritidis cells after an 8-hr exposure (Fig. 1E&F). These results 208
demonstrated that ZnO nanoparticles were effective at killing C. jejuni even at low 209
concentrations. 210
211
Morphological analysis of C. jejuni 212
Effects of ZnO nanoparticles on C. jejuni cell morphology were examined by scanning electron 213
microscopy. After a 12-hr treatment with 0.5 mg/ml ZnO nanoparticles in MH broth under 214
microaerobic conditions, spiral-shaped C. jejuni cells underwent a dramatic change from spiral to 215
coccoid morphological forms. The SEM image in Figure 2A illustrates the dominance of coccoid 216
forms in the treated cells as well as showing the formation of irregular cell surfaces and cell wall 217
blebs in greater detail. These coccoid cells remained intact and possessed sheathed polar flagella. 218
The image of the untreated cells clearly displayed spiral shapes (Fig. 2B). Moreover, this ZnO 219
nanoparticle-induced formation of coccoid cells was confirmed by confocal microscopic 220
visualization (data not shown). Not surprisingly, the similar morphology transformation was also 221
observed when C. jejuni was exposed to different environmental stresses including oxidative 222
stress (10, 25). To determine the bactericidal versus bacteriostatic effect of ZnO nanoparticles 223
cultures previously exposed to ZnO nanoparticles exhibiting a coccoid cell morphology were 224
spread plated. No growth of the coccoid cells was observed on drug-free MH plates, confirming 225
that they were no longer culturable. These results together suggested that ZnO nanoparticles 226
caused not only cell morphology changes but also lethal effect on C. jejuni. 227
228
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
11
EMA-PCR assessment of cell membrane integrity 229
Ethidium Monoazide (EMA) selectively enters into membrane compromised cells and binds to 230
cellular DNA, which subsequently inhibits PCR amplification of the DNA. The reduction of 231
PCR amplification has been used as an indicator of cell membrane leakage (17). To assess 232
membrane integrity of the coccoid cells, EMA-qPCR analysis was performed on the C. jejuni 233
cultures treated with 0, 0.1, 0.3 and 0.5 mg/ml of ZnO nanoparticles for 12 hrs. The results in 234
Figure 3 showed that the cells treated with 0.3 and 0.5 mg/ml of ZnO nanoparticles had more 235
than 10 fold (1 log) reduction of DNA amplification, indicating an increased EMA penetration in 236
the treated cells. This result demonstrated that the treatment of ZnO nanoparticles on C. jejuni 237
increased cell membrane permeability (i.e., damaged membrane integrity). 238
239
Gene expression profile of C. jejuni in response to ZnO nanoparticle treatment 240
To understand the molecular basis of the ZnO nanoparticle action on bacterial cells, a set of C. 241
jejuni genes involved in general and oxidative stress responses, motility, pathogenesis, and toxin 242
production were selected for a gene expression study (Table 1). After exposing late-log phase 243
cells to 0.1 mg/ml ZnO nanoparticles for 30 min, the transcripts of these genes were quantified 244
by RT-qPCR assay. Most significantly, two oxidative stress genes, katA (encoding catalase) and 245
ahpC (encoding alkyl hydroperoxide reductase), and one general stress gene, dnaK (encoding a 246
chaperone), were found to be up-regulated 52-, 7- and 17-fold, respectively, in response to the 247
treatment. The transcription levels of other stress response genes as well as the analyzed 248
virulence genes were not significantly up- or down- regulated (less than 3 fold) (Fig. 4). As 249
expected, the expression of three housekeeping genes (gyrA encoding gyrase subunit A, tsf 250
encoding elongation factor TS, and 16S ribosomal RNA) were not changed regardless of the 251
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
12
treatment (Fig. 4). Similar gene expression results were also obtained from those cells treated 252
with 0.05 mg/ml of ZnO nanoparticles for the same length of time (data not shown). All these 253
results suggest that the antibacterial mechanism of ZnO nanoparticles is likely due to the 254
oxidative stress in C. jejuni cells. 255
256
Discussion 257
ZnO nanoparticles have a broad spectrum of antibacterial activities. At concentrations higher 258
than 0.24 mg/ml, it inhibited the growth of E. coli O157:H7, L. monocytogenes, and S. Enteritidis 259
(12, 14). The inhibitory effect of ZnO nanoparticles on Bacillus subtilis, Staphylococcus aureus, 260
Staphylococcus epidermidis, Streptococcus pyogenes, and Enterococcus faecalis was reported as 261
well (13). In this study, the antibacterial properties of ZnO nanoparticles were first investigated 262
in C. jejuni, the most common foodborne pathogen. Our results showed that C. jejuni was 263
extremely sensitive to ZnO nanoparticles with a MIC 8-16 fold lower than E. coli O157:H7 and 264
Salmonella. Antibacterial tests on agar plates and in broth both showed that 0.03 mg/ml of ZnO 265
nanoparticles was sufficient to inactivate C. jejuni, whereas the concentration of the 266
nanoparticles needed for 100% inhibition of E. coli O157:H7 growth was between 0.24-0.98 267
mg/ml (4, 14), approximately 8-32 times higher than the lethal dosage to C. jejuni. It has 268
previously been reported that the antibacterial activity of ZnO nanoparticles increases with the 269
reduction in particle size (16). The number of bacterial cells and growth media used could also 270
contribute to variation in results. For data consistency, we used the 30 nm (average size) ZnO 271
nanoparticles to test similar numbers of bacterial cells. 272
Previously, it was unclear whether ZnO nanoparticles function as a bactericidal or bacteriostatic 273
agent, except for a few reports on the inhibition of bacteria growth (13, 14). In this study, we 274
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
13
demonstrated that the action of ZnO nanoparticles on C. jejuni was bactericidal, not 275
bacteriostatic, by showing no recovery of the treated cells on drug-free MH plates as well as the 276
rapid killing of 108 CFU/ml freshly grown cells of three different C. jejuni strains. The 277
effectiveness of ZnO nanoparticles to inactivate C. jejuni was also compared with other major 278
foodborne pathogens. For E. coli O157:H7 and Salmonella, a 20-100 fold higher concentration 279
of ZnO nanoparticles was needed in order to reduce 1-2 log of viable cells (Fig. 1). Therefore, 280
the bactericidal action of ZnO nanoparticles on C. jejuni was extremely effective. 281
Although the antibacterial mechanism of ZnO nanoparticles is still unknown, the possibilities of 282
membrane damage caused by direct or electrostatic interaction between ZnO and cell surfaces, 283
cellular internalization of ZnO nanoparticles, and the production of active oxygen species such as 284
H2O2 in cells due to metal oxides were proposed in earlier studies (6, 24). The generation of 285
H2O2 in ZnO slurries was determined by oxygen electrode analysis and spectrophotofluorometry 286
(23, 27). In examining cell morphology, membrane integrity, and gene expression in C. jejuni, 287
we found that all of these aspects were affected ZnO nanoparticles. A dramatic change in C. 288
jejuni cell morphology was revealed by SEM analysis by showing the dominance of coccoid 289
forms in the treated cells whereas the untreated cells remained to be spiral. This considerable 290
alteration on cell morphology was not only observed in C. jejuni treated with ZnO nanoparticles 291
but also has been found in Campylobacter and the closely related genus Helicobacter exposed to 292
different stresses (1, 5, 10). It might be specific to spiral bacteria as no significant changes in cell 293
shape were found in E. coli O157:H7 after exposure to ZnO except that the nanoparticles 294
adhered to cell surface (29). In addition to changes in cell structure in C. jejuni, ZnO 295
nanoparticles also resulted in the formation of irregular cell surfaces and membrane blebbing, as 296
well as the increase in membrane permeability. This induced membrane leakage was also 297
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
14
consistently observed in E. coli O157:H7 by transmission electron microscopy and Raman 298
spectroscopy when the cells were treated with ZnO nanoparticles (14). 299
When extracellular environments change, bacteria adopt mechanisms that quickly regulate the 300
synthesis of defensive proteins in response to stress. In Campylobacter, a number of 301
genes/proteins playing critical roles in protecting cells from different stresses, especially 302
oxidative stress, have been identified (26). Most importantly, to eliminate reactive oxygen 303
species and assist the organism to defend against oxidative stress, superoxide dismutase (SodB) 304
breaks down O-
2 to H2O2 and O2; catalase (KatA) inactivates H2O2 and interrupts the formation of 305
toxic intermediates; alkyl hydroperoxide reductase (AhpC) can destroy toxic hydroperoxide 306
intermediates and repair damaged molecules caused by oxidation (3, 20). In addition to these 307
oxidative stress response proteins, general stress response proteins (DnaK, DnaJ, GroES, and 308
GroEL), which act as molecular chaperones play a critical role in preventing protein aggregation 309
and refolding, are also important for cell survival (2). The analysis of ZnO nanoparticle-310
modulated stress gene expression has shown that the transcription levels of two oxidative stress 311
genes (ahpC and katA) and one general stress response gene (dnaK) were significantly increased 312
up to 7-52 folds, whereas another 4 stress response genes (sodB, dps, groEL, and groES) were 313
also approximately 2-3 times higher. Expression of all other stress response genes was either 314
unchanged or down-regulated. Because KatA is a single catalase enzyme expressed higher upon 315
exposure to H2O2 in C. jejuni (7), the 52-fold induction of KatA expression suggests a high 316
probability that more intercellular H2O2 is produced in response to the ZnO nanoparticles. From 317
these experiments and the role of the oxidative stress regulatory system in Campylobacter, we 318
can conclude that the antibacterial mechanism of ZnO nanoparticles was very likely through the 319
increased levels of oxidative stress in bacterial cells. Furthermore, the expression of a number of 320
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
15
virulence factors related to cell motility, toxin production, and adhesion to host cells was also 321
examined in response to ZnO nanoparticles. All of the analyzed virulence genes were found to be 322
down-regulated, suggesting the decreased pathogenicity of the bacterium after the treatment. 323
In summary, ZnO nanoparticles exhibited remarkable antibacterial activity and demonstrated a 324
lethal effect against C. jejuni, even at low concentrations. ZnO nanoparticles induced significant 325
morphological changes, measurable membrane leakage, and substantial increases (up to 52 fold) 326
of oxidative stress gene expression in C. jejuni. Based on these phenomena and cell responses, a 327
plausible mechanism of ZnO inactivation of bacteria involves the direct interaction between ZnO 328
nanoparticles and cell surfaces, which affects membrane permeability where nanoparticles enter 329
and induce oxidative stress in bacterial cells, subsequently resulting in the inhibition of cell 330
growth and eventually cell death. 331
332
Acknowledgments 333
This research was jointly supported by the Agriculture Research Service, U.S. Department of 334
Agriculture, the Ministry of Science and Technology of China (grant nos. 2009BADB9B01 and 335
2009BAK43B31), and the Science & Technology Commission of Shanghai Municipality (grant 336
number no. 09DZ0503300). The authors thank Ms. Guoping Bao in the Microscopy Imaging 337
Facility at the USDA, ARS, ERRC, for technical assistance in acquiring the SEM images, and 338
Dr. George Paoli in the Molecular Characterization of Foodborne Pathogens Research Unit at the 339
USDA, ARS, ERRC, for providing the C. jejuni ATCC strains. 340
341
References 342
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
16
1. Adams, B. L., T. C. Bates, and J. D. Oliver. 2003. Survival of Helicobacter pylori in a 343
natural freshwater environment. Appl. Environ. Microbiol. 69:7462-7466. 344
2. Arsene, F., T. Tomoyasu, and B. Bukau. 2000. The heat shock response of Escherichia coli. 345
Int. J. Food Microbiol. 55:3-9. 346
3. Baillon, M. L., A. H. van Vliet, J. M. Ketley, C. Constantinidou, and C. W. Penn. 1999. 347
An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative 348
stress resistance to the microaerophilic pathogen Campylobacter jejuni. J. Bacteriol. 349
181:4798-4804. 350
4. Brayner, R., R. Ferrari-Iliou, N. Brivois, S. Djediat, M. F. Benedetti, and F. Fievet. 2006. 351
Toxicological impact studies based on Escherichia coli bacteria in ultrafine ZnO 352
nanoparticles colloidal medium. Nano Lett. 6:866-870. 353
5. Catrenich, C. E., and K. M. Makin. 1991. Characterization of the morphologic conversion 354
of Helicobacter pylori from bacillary to coccoid forms. Scand. J. Gastroenterol. Suppl. 355
181:58-64. 356
6. Fu, G., P. S. Vary, and C. T. Lin. 2005. Anatase TiO2 nanocomposites for antimicrobial 357
coatings. J. Phys. Chem. B. 109:8889-8898. 358
7. Grant, K., and S. Park. 1995. Molecular characterization of katA from Campylobacter 359
jejuni and generation of a catalase-deficient mutant of Campylobacter coli by interspecific 360
allelic exchange. Microbiology 141:1369-1376. 361
8. He, Y., J. G. Frye, T. P. Strobaugh, and C. Y. Chen. 2008. Analysis of AI-2/LuxS-362
dependent transcription in Campylobacter jejuni strain 81-176. Foodborne Pathog. Dis. 363
5:399-415. 364
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
17
9. He, Y., X. Yao, N. Gunther, Y. Xie, S. Tu, and X. Shi. 2010. Simultaneous Detection and 365
Differentiation of Campylobacter jejuni, C. coli, and C. lari in Chickens Using a Multiplex 366
Real-Time PCR Assay. Food Anal. Methods, 137:168-174. 367
10. He, Y. P., and C. Y. Chen. 2010. Quantitative analysis of viable, stressed and dead cells of 368
Campylobacter jejuni strain 81-176. Food Microbiol. 27:439-446. 369
11. Jacobs -Reitsma, W. F., U. Lyhs, and J. Wagenaar. 2008. Campylobacter in the food 370
supply, p. 627-644. In I. Nachamkin, C. M. Szymanski, and M. J. Blaser (ed.), 371
Campylobacter, 3rd ed. ASM Press, Washington, DC. 372
12. Jin, T., D. Sun, J. Y. Su, H. Zhang, and H. J. Sue. 2009. Antimicrobial efficacy of zinc 373
oxide quantum dots against Listeria monocytogenes, Salmonella Enteritidis, and Escherichia 374
coli O157:H7. J. Food Sci. 74:M46-52. 375
13. Jones, N., B. Ray, K. T. Ranjit, and A. C. Manna. 2008. Antibacterial activity of ZnO 376
nanoparticle suspensions on a broad spectrum of microorganisms. FEMS Microbiol. Lett. 377
279:71-76. 378
14. Liu, Y., L. He, A. Mustapha, H. Li, Z. Q. Hu, and M. Lin. 2009. Antibacterial activities of 379
zinc oxide nanoparticles against Escherichia coli O157:H7. J. Appl. Microbiol. 107:1193-380
1201. 381
15. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using 382
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 383
16. Nair, S., A. Sasidharan, V. V. D. Rani, D. Menon, S. Nair, K. Manzoor, and S. Raina. 384
2009. Role of size scale of ZnO nanoparticles and microparticles on toxicity toward bacteria 385
and osteoblast cancer cells. J. Mater. Sci. Mater. Med. 20:235-241. 386
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
18
17. Nogva, H. K., S. M. Dromtorp, H. Nissen, and K. Rudi. 2003. Ethidium monoazide for 387
DNA-based differentiation of viable and dead bacteria by 5'-nuclease PCR. BioTechniques 388
34:804-813. 389
18. Padmavathy, N., and R. Vijayaraghavan. 2008. Enhanced bioactivity of ZnO 390
nanoparticles—an antimicrobial study. Sci. Technol. Adv. Mater. 9:1-7. 391
19. Petersdorf, R. G., and J. C. Sherris. 1965. Methods and significance of in vitro testing of 392
bacterial sensitivity to drugs. Am. J. Med. 39:766-779. 393
20. Purdy, D., S. Cawthraw, J. H. Dickinson, D. G. Newell, and S. F. Park. 1999. Generation 394
of a superoxide dismutase (SOD)-deficient mutant of Campylobacter coli: evidence for the 395
significance of SOD in Campylobacter survival and colonization. Appl. Environ. Microbiol. 396
65:2540-2546. 397
21. Reddy, K. M., K. Feris, J. Bell, D. G. Wingett, C. Hanley, and A. Punnoose. 2007. 398
Selective toxicity of zinc oxide nanoparticles to prokaryotic and eukaryotic systems. Appl. 399
Phys. Lett. 90:2139021-2139023. 400
22. Sawai, J. 2003. Quantitative evaluation of antibacterial activities of metallic oxide powders 401
(ZnO, MgO and CaO) by conductimetric assay. J. Microbiol. Methods 54:177-182. 402
23. Sawai, J., E. Kawada, F. Kanou, H. Igarashi, A. Hashimoto, T. Kokugan, and M. 403
Shimizu. 1996. Detection of active oxygen generated from ceramic powders having 404
antibacterial activity. J. Chem. Eng. Jpn. 29:627-633. 405
24. Stoimenov, P. K., R. L. Klinger, G. L. Marchin, and K. J. Klabunde. 2002. Metal oxide 406
nanoparticles as bactericidal agents. Langmuir 18:6679-6686. 407
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
19
25. Tangwatcharin, P., S. Chanthachum, P. Khopaibool, and M. W. Griffiths. 2006. 408
Morphological and physiological responses of Campylobacter jejuni to stress. J. Food. Prot. 409
69:2747-2753. 410
26. van Vliet, A. H., J. M. Ketley, S. F. Park, and C. W. Penn. 2002. The role of iron in 411
Campylobacter gene regulation, metabolism and oxidative stress defense. FEMS Microbiol. 412
Rev. 26:173-186. 413
27. Yamamoto, O., M. Komatsu, J. Sawai, and Z. E. Nakagawa. 2004. Effect of lattice 414
constant of zinc oxide on antibacterial characteristics. J Mater Sci Mater Med 15:847-51. 415
28. Yuki, N., and M. Koga. 2006. Bacterial infections in Guillain-Barré and Fisher syndromes. 416
Curr. Opin. Neurol. 19:451-457. 417
29. Zhang, L. L., Y. H. Jiang, Y. L. Ding, M. Povey, and D. York. 2007. Investigation into the 418
antibacterial behavior of suspensions of ZnO nanoparticles (ZnO nanofluids). J. Nanopart. 419
Res. 9:479-489. 420
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
20
Figure legends 421
Fig. 1. Antibacterial activities of ZnO nanoparticles on C. jejuni, S. enteric Enteritidis, and 422
E. coli O157:H7. Freshly grown bacterial cultures (108-9
CFU/ml) were treated with a range of 423
concentrations of ZnO nanoparticles. The culturable cell number was determined at certain time 424
intervals after the treatment. The values of CFU/ml are the means of 12 replicates. Error bars 425
indicate standard deviations of means. 426
Fig. 2. Scanning electron microscopic images of C. jejuni. (A) C. jejuni cells in the mid-log 427
phase growth were treated with 0.5 mg/ml ZnO nanoparticles for 12 hrs under the microaerobic 428
conditions; (B) The untreated cells from the same growth conditions were used as a control. 429
Fig. 3. EMA-qPCR of C. jejuni membrane integrity. Mid-log phase cells exposed to different 430
concentrations of ZnO nanoparticles were briefly treated with (black bars) and without (white 431
bars) EMA. The inhibition of DNA amplification was quantified by real-time PCR analysis of 432
hipO gene. Reduced DNA amplification in the cells exposed to 0.3 and 0.5 mg/ml ZnO 433
nanoparticles indicated a certain degree of membrane leakage in the treated cells. 434
Fig. 4. Relative gene expression levels between ZnO nanoparticle treated and untreated C. 435
jejuni. C. jejuni cells in the late-log phase of growth were treated with 0 or 0.1 mg/ml ZnO 436
nanoparticles for 30 min. Transcripts of the selected genes were quantified by RT-qPCR, and the 437
data was analyzed using the comparative critical threshold (∆∆Ct) method. Relative expression 438
ratio of each gene is presented in a log2 value in the histogram. The ratio greater than zero (>0) 439
indicates up-regulation and below zero (<0) indicates down-regulation of gene expression. The 440
error bars indicate the standard deviations of three replicates.441
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
21
Table 1. Genes and primers selected for reverse transcription qPCR analysis 442
Function/protein Gene Primer Sequence (5’→3’)
Oxidative stress response genes
Forward TTCAATCTCTTTAGCGACGG Peroxide-sensing regulator perR
Reverse CACATTTGGCGCAAACAACA
Forward TCCACCAAGACTAAGCCCTG Flavodoxin I fldA
Reverse CAGAAGGAGCGGCTAATACAA
Forward CCACTAATGTTAATATGCGTTCC Iron-binding protein dps
Reverse TGTGCTTGATAATCTTGCGACAA
Forward TGGCGGTTCATGTCAAAGTA Superoxide dismutase(Fe) sodB
Reverse ACCAAAACCATCCTGAACCA
Forward AGTTGCCCTTCGTGGTTCGT Alkyl hydroperoxide
reductase ahpC
Reverse ATCGCCCTTATTCCATCCTG
Forward ACCGTTCATGCTAAGGGAAG Catalase katA
Reverse CCTACCAAGTCCCAGTTTCC
Forward TTCTTCTTCGTGTTGTTCGC Nonheme iron-containing
ferritin cft
Reverse GCTGGAGCCTTCTTGTTTGC
Forward CCCCACTTCTCATATCAGCG Ferredoxin fdxA
Reverse ATGCGTTGAATGCGTAGGAC
Forward TGCAGCAGTTACTAGGTTTT Rubrerythrin rbr
Reverse AGACATTTTAGAGAAGCGGC
Forward CCATTTCTTTTGGTTCAGCAG Ferric uptake regulator fur
Reverse TGCAATCAAGGCTTGCTGTC
Forward TCAAAGTCGTTCAAACAGGG Carbon storage regulator csrA
Reverse TCATTCTGAACAACAGAATGC
General stress response genes
Forward GCCAGTTACAATGGTGCTGA Probable thiol peroxidase tpx
Reverse TTTGCCACAAAATCACTTGC
Forward AAACAACAGCCTCAGGCATAA Co-chaperonin groES
Reverse TTCTGTTCCACCGTATTTAGCA
Forward GCAGGCGATGGAACAACTAC Chaperonin groEL
Reverse TCCATACCGCGTTTTACCTC
Forward CGGTATGCCACAAATCGAAG Chaperone dnaK
Reverse GCTAAGTCCGCTTGAACCTG
Forward TTTAAAAGGCGGTGGATTTG Co-chaperone dnaJ
Reverse TTTTCTACGACGCGATGATG
Forward ACCCCAGGTTGTACTACAGAAG Bacterioferritin comigratory
protein homolog BCP
Reverse AGCAATCTTACCTGTTTCATCG
Forward GCCCCAATAGCCCATAGAC RelA/Spot family protein spoT
Reverse ACCCCAAGCAAATCAAGAAC
Forward GAGCCTTCTGTTGTGGCAGTT Rod shape-determining
protein mreB
Reverse AGCGGATCATTTTTTCAGTCAT
Forward TATTACGCCGCTAACTTGAG RND efflux system,
membrane fusion protein cmeA
Reverse CAGCAAAGAAGAAGCACCAA
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
22
Forward TAATCCAGGTATGGGAGGTA RND efflux system, inner
membrane transporter cmeB
Reverse GGAAAGATAGAAATGTAAGCG
Forward GGACGTTGAAGCAAGATGGT RND efflux system, outer
membrane lipoprotein cmeC
Reverse AGTTGGCGCTGTAGGTGAAT
Forward TTGATAGCGAACTTGATGAT Major outer membrane
protein porA
Reverse ATACGAAGTCAGCACCAACG
Forward CTATTTCCATACCCCACAGC Inner membrane protein yagU
Reverse CCTTTAATTGCAGAAGTTCC
Forward GTAGGAGCTGGAAGCACAGG ATP-dependent CLP protease
ATP-binding subunit clpA
Reverse ACGGCGACTTAGGGGTTTAT
Virulence factors and toxins
Forward TCCACATTTGTGCGTGATTG cdtA
Reverse GATTTGGCGATGCTAGAGTTT
Forward AAAGCATCATTTCCATTGCG cdtB
Reverse ACCAAGAACAGCCACTCCAA
Forward CCAAAAGGAAGTTCATCAGC
Cytolethal distending toxin
cluster
cdtC Reverse AGCCTTTGCAACTCCTACTG
Forward CTCATCATTTGGAACGACTTG Invasion antigen B ciaB
Reverse AATTATACTCATGCGGTGGC
Forward CCAATGTCGGCTCTGATTTG Flagellin A flaA
Reverse GCGCAGGAAGTGGATTTTC
Forward CCGTTTCCATCACCATCTTC Flagellin B flaB
Reverse ACACGCTTTGAAACAGGAGG
Forward TGCTTGTGGAGCTGGACGAG Outermembrane fibronectin-
binding protein cadF
Reverse TAAAAGCGGTGGATTTGGAC
Forward TGTTGAAGTGGGACTAAGCG N-acetylneuraminic acid
synthetase neuB
Reverse TCTAACTTGCCATCGCCTAA
Forward AAGGACGAGGTAGCATAGGT Vacuolating cytotoxins vacB
Reverse CAAACGGCGATAGTGTTGAT
Housekeeping genes
Forward TGCTAAAGTGCGTGAAATCG Gyrase subunit A gyrA
Reverse GCATTGGTGCGTTTTCCTAT
Forward GAACTCCGCGAAAGTACAGG Elongation factor TS tsf
Reverse TTGCCACAAAATCTGTTTCG
Forward GCTCGTGTCGTGAGATGTTG 16S ribosomal RNA 16S rRNA
Reverse TCACCGTAGCATGGCTGAT
443
444
445
446
447
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
23
448
Figure 1 449
Xie et al. 450
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
24
451
452
Figure 2 453
Xie et al. 454
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
25
455
456
Figure 3 457
Xie et al. 458
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
26
Figure 4
Xie et al.
on April 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from