PowerPoint Presentation

Observations, Updates, and Trends From ISU VDL

Iowa Pork CongressJanuary 26, 2017

Dr. Rodger Main Professor and Director

Dr. Pablo PineyroAsst. Professor and Diagnostic Pathologist

1

Outline

MainIntroduction & General Updates on VDLTrends in PEDV and PRRSV at National Level

Pineyro Case based observations and trendsSwine Disease Topics of Interest Senecavirus A

ISU-VDL is part of the ISU College of Vet Med

ISU-VDL Who we are TodayTotal 145 People 25 Faculty120 Technical Staff

Full Service & Fully Accredited Laboratory

Veterinary Diagnostic MedicinePathologyVirology and Molecular DxBacteriologySerology/ImmunologyToxicology & NutritionClinical PharmacologyEpidemiologyInformation Management Technology

4

Preeminent Food Animal Veterinary Diagnostic Laboratory

Comprehensive Diagnostic Service, Teaching, and Applied ResearchCreate = New Knowledge & CapabilitiesShare = Students, Practitioners, & StakeholdersApply = Providing World Class Diagnostic Services

Tripartite Mission Consistent with Land Grant University

Veterinary Diagnostic LaboratoryIowa State University

Network of Interdependent Relationships to Improve & Protect Food Animal Agriculture

Food AnimalAgricultureConsumerGeneticsFacilities / EnvironmentNutritionHealthManagementBusiness / FinancePracticing VeterinarianVeterinaryDiagnosticLabsProduction AnimalMedicineSuppliersOf Health Products

Producer

Pathology Virology Bacteriology Serology ToxicologyPharmacologyEpidemiology Parasitology

State and Federal VeterinaryOfficials & Agencies

Strategic Alliances Service, Innovation, & Teaching

Veterinary Diagnostic LaboratoryIowa State University6

Serving Food Animal Agriculture Comprehensive Diagnostic Service, Teaching, and Discovery(Iowas only Full-Service & Fully Accredited Veterinary Diagnostic Laboratory)

Processing > 75,000 cases/year from livestock producers for across USApplying world-class technology to solve real-world problems

Veterinary Diagnostic LaboratoryIowa State University

7

ISU VDL Diagnostician receives the case from the local veterinarianSelect diagnostic tests based on history and gross lesionsResults coordinated to arrive at a diagnosisBacteriologyVirologyToxicology& NutritionSerology

Transmit diagnosis to and assist local veterinarian with intervention strategies and establishment of best practices

MolecularDiagnosticsHistopathologyClinical Pharmacology> 75,000/yearInformsteachingandresearchprograms

8

75% Swine, 10% Bovine, 10% Poultry and 5% Everything Else

Veterinary Diagnostic LaboratoryIowa State University Distribution of ISU VDLs 80,000 Cases Accessions Last Year

95% of Diagnostic Services Food Animal Agriculture

Veterinary Diagnostic LaboratoryIowa State University

10

Location of Pigs in the US

New VDL Infrastructure Capital Project (2017 Session)

Capital Project OverviewNew VDL Space 60,000 to 83,000 square feetRepurposing 27,500 square feet of current facility repurposed for College of Veterinary Medicine research and teaching purposes$124 M = $100 M (State of IA) + $24M Donor & University

VDL 1974 10 Faculty & 20 Technical StaffISU VDL Facility InfrastructureDesigned in 1973-74 and Populated in 1976Located within the CVM Building

Present Day 25 Faculty & 120 Technical Staff

15

Enhance the Quality and Connectivity of VDL Record

ConsistentCompleteTraceableFit for Digital Era (Incoming & Outgoing)

What could VDL improve its role in support HPAI preparedness / response ? Early Detection, Rapid Response, & Effective Communication (Seamless, Timely, Clear) Competency of Personnel & VDL Systems Quality of Test & Results Sensitivity of Assay Testing Capacity Turn-around Time Quality of Information in VDL RecordComplete, Consistent, Traceable, Fit for Digital Transmission ````

Observation at VDLManually Entered Premises Level Identifiers (Farm Site Information) Are Not Compatible With Web-Based Data Management Applications

Need To Transcend VDL Records Into Digital Era

Sustained Responses to Large-Scale Emerging Disease Events: Real Life Is Not A Drill

Preparedness is best defined by the systems used and practices implemented in-mass on a daily basis.

Fantasy Island

Electronic Submissions

Omission of Submission Fee on Qualifying Web or Electronic Submissions, Effective, July 1, 2016Objective = Improve Quality of Veterinary Diagnostic Record & its Fitness for Digital Era

Electronic Submission ToolCreate New Web SubmissionsCreate, Manage, Use Submission TemplatesRecurring Test Requests, Instructions, Affiliations, Bill PartyPending Web Submissions Client Specific = Library of Owner & Sites Web or Paper-Based SubmissionsWeb-Submissions Editable Until Received @ VDLAll Customizable Functionality in Hands and Control of VDL Client

that can be used repeatedly for submissions that involve a common set of test requests and/or instruction

21

10X increase in web submission since Jan 2015Web = 50% of Swine Submissions in Dec 2016 100% of Web-Submissions Have Correct Site Info & PINS

22

Web Submssion ID #

Electronic (E) Forms For Use On Paper-Based Submissions

25

Daily Summary Report

Launched October 2016

Mobile-Friendly Summary of All Open & Active Cases

Hyperlink to Full Case Report

Tool To ForwardAny Individual Case via E-Mail Within Clients E-mail Browser

My Profile & Reporting PreferencesAccess through Client Web PortalEnables VDL Clientele to Actively Manage: Clinic & Veterinarians Contact informationReporting PreferencesDaily Summary ReportWho, When, & How Often

Single point of contact within a clinic can manage the information & preferences for all the veterinarians associated with their practice.

Clinic Preferences (All Cases From Clinic)Vet A Preferences (Only Vet A Cases)Vet B Preferences (Only Vet B Cases)Vet C Preferences (Only Vet C Cases)

Continue to Improve VDL Web Reporting Tool

Two New Features VDL Web Reporting* E-mail live link to dynamic case report * Submit additional test requests

Mobile Friendly Version of VDL Client Portal (Results & Submissions)

Coming In2017

Swine Diagnostic Data Standardization Project

Rodger Main - ISU VDLGary Anderson - KSU VDLJane Hennings SDSU ADRDLJerry Torrison & Stephanie Rossow UMN VDLSarah Tomlinson USDA NAHLN* Mike Martin Clemson University

$716,000; 15 month, Infrastructure Development ProjectFunded via Swine Health Information Center & USDACommenced fully in July 2016* Dr. Martin is providing the primary technical guidance and support to this project. Mike is a nationally recognized leader and expert in veterinary diagnostic informatics and HL-7 messaging.

37

1 Monitoring Health Status of Swine Farms Overtime(Operation, Production System, Clinic, or Area-Regional Level)2 Health Status = Qualitative, Quantitative, and/or Strains Active

Swine Diagnostic Data Standardization ProjectDeveloping infrastructure to help harness the capabilities the digital age will have to offer for years to come

Interstate Construction, 1958Current Day

Link to on-line report on AASV Web-Site

VDLs

Trends in US PEDV and PDCoV Diagnostic Data1st US History = Diagnostic test results electronically captured from all VDLs located throughout the US and integrated into a dynamic web-based reporting tool.

US Trends in PEDV PCR Diagnostic Testing Reported to USDACase-Level Summary of PEDV PCR Test Results from Across USA

US Trends in PEDV PCR Positive CasesCase-Level Summary of PEDV PCR Test Results from Across USA

Enables Visualization of Trends Within Each State

Trends in PEDV PCR Positive Cases in Top 4 Hog Production States

47

Trend in PRRS Outbreaks in US Herds

Swine Health Monitoring Project University of Minnesota; Dr. Bob Morrision, et al

Swine Health Monitoring Project University of Minnesota; Dr. Bob Morrision, et al1 Positive Unstable2 fvi Positive Stable, Ongoing field virus exposure2 vx Positive Stable, Live virus vaccinated2. Positive Stable3. Provisionally Negative4. PRRSV Elisa Negative

Aggregate Data Summary Applications ISU VDL Historical PRRSV ORF5 Sequencing DataTrends in the most prevalent field strains of NA PRRSV RFLP Groupings and EU PRRSV

Trends in most prevalent NA PRRSV RFLP Groupings and EU PRRSV Aggregate Data Summary Applications ISU VDL Historical PRRSV ORF5 Sequencing Data

ISU VDL Historical PRRSV ORF5 Sequencing Data(Top 4 Hog Production States)Trends in most prevalent NA PRRSV RFLP Groupings and EU PRRSV (by State)

52

Cluster #1Cluster # 2Survival of the Fittest

Outline

MainIntroduction & General Updates on VDLTrends in PEDV and PRRSV at National Level

Pineyro Case based observations and trendsSwine Disease Topics of Interest PCV3Porcine PestivirusSenecavirus A

Cases by system in past 20 months (DX codes)24 months (2013-15)SystemTotal%Respiratory803244%Enteric552930%Systemic368620%Reproductive3782%CNS2852%Arthritis2341%Heart1371%Skin1041%Skeletal470%Grand Total18432100%

Respiratory DiseasePRRSVPPIV-1?

Swine Respiratory Pathogens

Number of Bronchointerstitial Pneumonia Caused by PRRSV Diagnosed at ISU-VDL

Number of cases / year

PRRSV diagnosis

PRRS InformationTotal cases analyzed 10401-3-4 pattern: 1441-7-4 patter: 896

PRRS MLV PCRPCR - PRRSV BIVI MLV-likeAnimal IDSpecimenCt / ResultCommentB, OF, Tube #2Oral fluid>40 / Negative

Sequencing and Analysis - PRRSVAnimal IDSpecimenTarget GeneRFLPCommentB, OF, Tube #2Oral fluidORF51-3-4Wild type

Sequence HomologyReference VirusInglevac ATPLelystadPrime PacInglevac MLVFosteraPercent Identity84.6%62.7%85.4%84.8%85.6%

NucleotideATGTTGGGGAAATGCTTGACCGCGGGTTATTACTCGCAATTGCTTTTTTTGTGGTGTATCGTGCCATTCTGTCTTGTTGCGCTCGCCAACGCCAACAACGGCAGCAGCTCTCATTTACAGTTGATTTATAACCTGACGATATGTGAGCTGAACGGCACAGATTGGCTGAACGATCATTTCAGCTGGGCGGTGGAGACTTTCGTCATCTTCCCTGCGTTGACCCACATTGTCTCTTATGGCGCCCTCACCACTAGCCATTTTCTTGACACGGTCGGCCTGATCACTGTGTCCACCGCCGGATATTATCACAAGCGGTATGTATTGAGCAGCATTTACGCTGTTTGTGCCCTGGCTGCGTTGGTTTGCTTCGCCATTAGGTTGGCGAAAAATTGCATGTCCTGGCGCTACTCGTGTACTAGATATACCAATTTTCTCCTGGACACTAAGGGCAAACTCTACCGCTGGCGGTCACCCGTCATCATAGAGAAGGGGGGTAAAGTTGATGTTGAGGGCCATTTGATTGACCTCAAAAGAGTTGTGCTTGATGGTTCCGCGGCAACTCCTGTAACCAAAGTTTCAGCGGAACAATGGGGTCGTCCTTAG

PCR Applied Biosystems - PRRSVAnimal IDSpecimenUS Ct / ResultEU Ct / ResultCommentB, OF, Tube #2Oral fluid25.3 / Positive>=37 / NegativePCR has primers to MLV vaccine virusPositive indicates vaccine virusNote:Cant rule out wild-type infection in addition to vaccine virusSlide courtesy of Dr. Darin Madson

PRRS SequencingCan there be more than 1 PRRS isolate within a clinical sample?When you sequence the PCR product, which isolate do you get?Is the most predominate (highest titered sample) sequenced?Is that virus the issue?

PRRS sequencing primers are close to MLV vaccine virus; preferential will sequence this virus even if there are other present If near somewhat equal quantities

May need to use Next Generation Sequencing (NGS) to determine

Slide courtesy of Dr. Darin Madson

New respiratory disease diagnosed that ISU has been involved

Asymptomatic pigs reportedISU-VDL offers PCRPCR is based on K-State information We screened 300 random samples, including nasal swabs, lung tissue or oral fluids, and found that 6% tested positive for the parainfluenza virus, Hause says. We were also able show that the virus replicates in the upper respiratory tract. We then developed a serology assay to look for antibodies to see how common it is for pigs to have been exposed to this, and about 50-60% of the samples were positive. This suggests the virus did not just arrive here or that it is in just one area of the country.~ Dr. Hause

Palinsky et al, 2016

Prevalence of Porcine Parainfluenza Virus Type 1 (PPIV-1) in U.S. Swine HerdsGauger P, Harmon K, Lin XK, Park J, Pineyro P, Welch M, Zhang JQIowa State University Animal Industry Report - 2017PPIV-1 qRT-PCR Positive specimens by state

PPIV-1 Sample breakdown by age reportedPrevalence of Porcine Parainfluenza Virus Type 1 (PPIV-1) in U.S. Swine HerdsGauger P, Harmon K, Lin XK, Park J, Pineyro P, Welch M, Zhang JQ

Enteric DiseaseSalmonellosis

Agents of pig diarrhea: > 6 weeks of age (ISU-VDL)Slide courtesy of Dr. Darin Madson

68

Nursery Enteric (last 3 years)

Slide courtesy of Dr. Darin Madson

Grow-Finish Enteric (last 3 years)

Slide courtesy of Dr. Darin Madson

ISU-VDL total #of Salmonella isolates/year ISU-VDL

Antibiotic sensitivity was performed on all Salmonella isolates used to build this chart# of IsolatesSlide courtesy of Dr. Darin Madson

Sick Pig Salmonella sp isolationsSlide courtesy of Dr. Darin Madson

Total cases of Salmonella cholerasuis septicemia diagnosed# of IsolatesSlide courtesy of Dr. Darin Madson

Salmonella - antibiotic resistance over the years

This information is from a on-going project and contain preliminary data. Slide courtesy of Dr. Darin Madson

74

Systemic DiseasePCV3?Porcine PestivirusSVA

A novel porcine circovirus associated with porcine dermatitis and nephropathy syndrome and reproductive failure (PCV3)

A novel porcine circovirus associated with porcine dermatitis and nephropathy syndrome and reproductive failure (PCV3)

A novel porcine circovirus associated with porcine dermatitis and nephropathy syndrome and reproductive failure (PCV3)

Slide courtesy of Dr. Darin MadsonCongenital tremor (Pestivirus)

Background congenital tremors Myoclonia congenital (CT)Repeated contractions of skeletal muscle present at/shortly after birth that go away when piglets are sleeping

First described ~ 90 years agoDancing pigs in 1922

Globally reported Sporadic disease

Slide courtesy of Dr. Darin Madson

80

Slide courtesy of Dr. Darin Madson

Background congenital tremors

AIAIIAIIIAIVAVCauseCSFUnknown virusGenetic: sex-linkedGenetic: autosomal Trichlorfon% litters affectedHighHighLowLowHighMortalityMedium to highLowHighHighHigh

Slide courtesy of Dr. Darin Madson

82

Slide courtesy of Dr. Darin Madson

Pestivirus Identification

NS3

Npro

Slide courtesy of Dr. Darin Madson

84

Slide courtesy of Dr. Darin Madson

86

Sow Inoculation Study

Slide courtesy of Dr. Darin Madson

87

Porcine congenital tumors - Testing OptionsRT-qPCR available ISU-VDLSerumCentral nervous system tissueHeartLymph node

88

Idiopathic vesicular disease and neonatal mortality associated (Seneca Virus A)

Introduction- Clinical Signs & LesionsVesicular lesions of the snout and feet of sows, lamenessNo additional lesions found on necropsy

Canning et al. 2016.

Lesions identical to those of FMDV, vesicular erythema of swine, swine vesicular disease, vesicular stomatitis. Need to rule out FAD through testing. Heal in 10-14 days. Associated with some lameness, fever, anorexia.

Piglets + on RT-PCR with 98,8-100% NT identity on sequencing--- becoming a multiple organ disease with tropism for many organs

90

Senecavirus A in neonatal pigs

Slide courtesy of Dr. Chris RademacherPiglets- death of weakness, lethargy, diarrhea, hyperemia

Senecavirus A diagnosis

Slide courtesy of Jordan Kraft

What is the serological prevalence in U.S. herds?

Total PrevalenceSeroprevalence resultsBetween Farm Prevalence

Total prevalence96

http://www.drodd.com/images13/blank-us-map28.png0/00/00/00/00/00/062/155 40%0/29 0%0/00/00/00/00/01/293%28/5551%3/2512%30/5060%0/290%16/6027%13/101 13%23/18412%0/00/00/016/145 11%157/391 40%4/3113%57/125 45%0/00/00/00/00/00/00/034/29312%0/30 0%0/051/25220%0/00/00/00/00/00/0Seroprevalence in adult pigs by state. Positive/total (percentage)

97

Seroprevalence in grower and fattener pigs by state. Positive/total (percentage)

http://www.drodd.com/images13/blank-us-map28.png0/00/00/00/00/00/300%0/00/00/00/027/1090/00/00/300%0/024/3796%54/22524%22/8526%8/889%4/726%118/67517%20/10419%0/00/02/773%41/695 6%59/282 21%14/457 3%0/00/00/00/00/00/00/012/197 6%54/406 13%0/00/00/00/00/00/00/00/600%

98

Increment in cases of Idiopathic Vesicular Disease associate with the presence of SV-A in show and finisher pigs

Increment in cases of PWM associated with Idiopathic Vesicular Disease in sow and associate with the presence of SV-A

We identified a new SV-A contemporary strain genetically different from the historical SV-A US strain

We determine the serological prevalence of SVA in sow herds and finisher farms

Summary

Viral mutation origin Host-pathogen interactionPredisposing factorsClinical, serological and viral prevalenceViral persistence in the environmentViral inactivation Questions to be answered

Questions?Thank you for your attention

Observations, Updates, and Trends From ISU VDL

Thank You & Questions

Dr. Rodger Main Professor and Director

Dr. Pablo PineyroAsst. Professor and Diagnostic Pathologist

103