dual inhibition of hedgehog and c-met pathways for ... · abdomen was opened via a left subcostal...

Small Molecule Therapeutics

Dual Inhibition of Hedgehog and c-Met Pathwaysfor Pancreatic Cancer TreatmentAgnieszka A. Rucki1,2,3, Qian Xiao1,2,4,5, Stephen Muth1,2, Jianlin Chen1,2,6,Xu Che1,2,7, Jennifer Kleponis1,2, Rajni Sharma8, Robert A. Anders1,2,8,Elizabeth M. Jaffee1,2,3,8,10, and Lei Zheng1,2,3,9,10

Abstract

Pancreatic ductal adenocarcinoma (PDAC) is one of the mostchemotherapy- and radiotherapy-resistant tumors. The c-Metand Hedgehog (Hh) pathways have been shown previously byour group to be key regulatory pathways in the primary tumorgrowth and metastases formation. Targeting both the HGF/c-Met and Hh pathways has shown promising results in pre-clinical studies; however, the benefits were not readily trans-lated into clinical trials with PDAC patients. In this study,utilizing mouse models of PDAC, we showed that inhibitionof either HGF/c-Met or Hh pathways sensitize the PDAC tumors

to gemcitabine, resulting in decreased primary tumor volumeas well as significant reduction of metastatic tumor burden.However, prolonged treatment of single HGF/c-Met or Hhinhibitor leads to resistance to these single inhibitors, likelybecause the single c-Met treatment leads to enhanced expres-sion of Shh, and vice versa. Targeting both the HGF/c-Metand Hh pathways simultaneously overcame the resistance tothe single-inhibitor treatment and led to a more potent anti-tumor effect in combination with the chemotherapy treatment.Mol Cancer Ther; 16(11); 2399–409. �2017 AACR.

IntroductionPancreatic ductal adenocarcinoma (PDAC) has the worst prog-

nosis of any major malignancy, with 5-year survival of about 5%(1, 2), and is one of the most chemotherapy- and radiotherapy-resistant tumors (2, 3). PDAC is characterized by very densestroma that makes up anywhere from 60% to 90% of the totaltumor volume (4). The stromal compartment is made up of avariety of different cells and proteins that act together to develop

an environment that is suppressive to the immune system, drugresistant, and protumorigenic (5). Although there have beennumerous new therapies developed for other cancers, little pro-gression has been made finding new therapies for PDAC despitepromising results from preclinical studies.

It is well documented that c-Met receptor and its ligandHGF areupregulated in PDAC (6). Upregulation of c-Met and HGF isdetected early in PDACdevelopment and promotes tumorigenesisin conjunction with other oncogenic signals (7). Because HGFis exclusively secreted by stromal fibroblasts (8) and stromalexpression of HGF was correlated with decreased disease-freesurvival (9), activation of c-Met in neoplastic cells is believed tobe subject to the regulation of signals from the stroma. Morerecently, HGF/c-Met has been investigated as a therapeutic targetforPDAC.The combinationof gemcitabineandcrizotinib, a small-molecule c-Met inhibitor, was tested in murine models and wasshown to enhance the intratumoral delivery of gemcitabine andresult in tumor reduction of the PDAC xenograft (10). Moreover,Jin andcolleagues showed that antibody targetingof c-Met receptorin an orthotopic mouse model of PDAC led to decreased tumorburden and prolonged survival (11). More recently, HGF/c-Metinhibitors have been tested in multiple early-phase clinical trials,which have shown promising results in a variety of solid cancers(10). Unfortunately, the phase II trial of cabozantinib showedminimal benefits in patients with PDAC, despite promising resultsin subjects with other solid tumors (12, 13).

The hedgehog (Hh) pathway, specifically the activating ligand,Sonic hedgehog (Shh), is overexpressed by PDAC tumor cells;however, its function is restricted to the stromal compartment(14–16). It has been noted that Hh pathway activation and Smoreceptoroverexpressiononlyoccur in cancer-associatedfibroblastsbut not the neoplastic cells (17). It was subsequently reported thattargetingHh pathway inmurinemodels of PDACdepletes stromaand sensitizes primary tumors to gemcitabine, leading to tumor

1The Sidney Kimmel Comprehensive Cancer Center, The Johns Hopkins Univer-sity School of Medicine, Baltimore, Maryland. 2Department of Oncology, TheJohns Hopkins University School of Medicine, Baltimore, Maryland. 3GraduateProgram in Cellular and Molecular Medicine, The Johns Hopkins UniversitySchool of Medicine, Baltimore, Maryland. 4Department of Surgical Oncology,the Second Affiliated Hospital of the Zhejiang University School of Medicine,Hangzhou, China. 5Cancer Institute, University School of Medicine, Hangzhou,China. 6Department of Hepatobiliary Oncology, Sun Yat-sen University CancerCenter, State Key Laboratory of Southern China, Collaborative InnovationCenter for Cancer Medicine, Guangzhou, China. 7Pancreatic and Gastric SurgeryDepartment, Cancer Hospital, Peking Union Medical College, Chinese Academyof Medical Sciences, Beijing, China. 8Department of Pathology, The JohnsHopkins University School of Medicine, Baltimore, Maryland. 9Department ofSurgery, The Johns Hopkins University School of Medicine, Baltimore, Maryland.10The Skip Viragh Center for Pancreatic Cancer, The Johns Hopkins UniversitySchool of Medicine, Baltimore, Maryland.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

A.A. Rucki and Q. Xiao contributed equally to this article.

Corresponding Author: Lei Zheng, Department of Oncology, Sidney KimmelCancer Center at Johns Hopkins University School of Medicine, 1650 OrleansStreet, CRB1, Room 488, Baltimore, MD 21231. Phone: 410-502-6241; Fax: 410-614-8216; E-mail: [email protected]

doi: 10.1158/1535-7163.MCT-16-0452

�2017 American Association for Cancer Research.

MolecularCancerTherapeutics

www.aacrjournals.org 2399

on January 13, 2020. © 2017 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst September 1, 2017; DOI: 10.1158/1535-7163.MCT-16-0452

http://crossmark.crossref.org/dialog/?doi=10.1158/1535-7163.MCT-16-0452&domain=pdf&date_stamp=2017-10-16

http://mct.aacrjournals.org/

shrinkage (18, 19).However, targeting theHhpathway in patientswith PDAC showed no additional benefit when added to thestandard-of-care chemotherapy treatments (20).

Although targeting both the HGF/c-Met and Hh pathways hasshown promising results in preclinical studies, the benefits werenot readily translated into clinical trials with PDAC patients(20–23). Thus, we investigated the mechanisms of resistance tothe single inhibitor of HGF/c-Met or Hh pathway and determinedwhether targeting both the HGF/c-Met and Hh pathways simul-taneously would overcome the resistance to single inhibitortreatment and lead to a more potent antitumor effect in combi-nation with chemotherapy treatment.

Materials and MethodsCell culture

Themurine pancreatic tumor cell lines KPC andmouse cancer-associated fibroblasts (mCAF) were established in accordancewith the Johns Hopkins Medical Institution Institutional ReviewBoard (JHMI IRB)-approved protocols, obtained between 2011and 2015, authenticated by DNA and gene expression profiling,and cultured as described previously (24, 25). Briefly, cells weremaintained in RPMI1640 medium (Gibco) supplemented with10% FBS (Gibco), 2 mmol/L L-glutamine (Gibco), 1% nonessen-tial amino acids (Gibco), 1 mmol/L sodium pyruvate (Gibco),50 U/mL penicillin, and 50 mg/mL streptomycin (Gibco). TheKPC cells were grown at 37�C in 5% CO2.

Mouse models of PDACAll animal experiments conformed to the guidelines of the

Animal Care andUseCommittee of the JohnsHopkinsUniversity(Baltimore, MD), and animals were maintained in accordancewith the guidelines of the American Association of LaboratoryAnimal Care. All mice were monitored twice a day.

A genetically engineered mouse model of PDAC, designatedKPC mice, was previously established through a knock-in ofpancreatic-specific, conditional alleles of the KRASG12D andTP53R172H mutations on a mixed 129/SvJae/C57Bl/6 back-ground. These mice, when crossed with PDX-1-CREþ/þ mice,develop PanIN lesions that progress stepwise, similar to humandisease, into PDAC (26).

The mouse pancreatic orthotopic model was described pre-viously (27). In brief, 2 � 106 KPC cells were subcutaneouslyinjected into the flanks of syngeneic female C57Bl/6 mice. After1 to 2 weeks, the subcutaneous tumors were harvested and cutinto approximately 1-mm3 pieces. New syngeneic femaleC57Bl/6 mice, ages 8 to 10 weeks, were anesthetized. Theabdomen was opened via a left subcostal incision. A smallpocket was prepared inside the pancreas using microscissors,into which one piece of the subcutaneous tumor wasimplanted. The incision in the pancreas was closed with asuture. The abdominal wall was sutured, and the skin wasadapted using wound clips.

c-Met and Hh inhibitor and gemcitabine treatmentsFor the in vivo studies, the Hh signaling pathway inhibitor (28)

NVP-LDE225 (provided by Novartis) was used at 50 mg/kg andthe HGF/c-Met inhibitor INCB28060 (purchased from AbMole;refs. 29, 30) was used at 1 mg/kg, and both inhibitors wereresuspended in DMSO. DMSO was used as a vehicle control forall treatments. The KPC and orthotopic transplant model mice

were dosed daily by oral (31) gavage with NVP-LDE225,INCB28060, NVP-LDE225 þ INCB28060 (at the same dose astheir corresponsive single inhibitor treatments) or DMSO for 7,14, or 21 days as indicated in the treatment schemas (Figs. 1, 3,and 4). In vitro experiments utilizing the abovementioned inhi-bitors were described previously (25). Gemcitabine (Sigma-Aldrich) was reconstituted in deionized and distilled water at20 mg/mL and 100 mL administered via intraperitoneal injectioninto respective mice.

Ultrasound and tumor measurementKPCmice of 12 to 14weekswere examined byultrasound using

the VEVO770 (VisualSonics) small animal ultrasound to confirmprimary tumors. Mice bearing tumors of similar sizes were chosenfor the study. Orthotopic mice were examined by ultrasound5 days after tumor implantation to confirm the presence of thetumor and establish a baseline tumor volume. Ultrasound on themice was performed again on day 7 of treatment in all experi-ments and on treatment day 14 and 21 in experiments with 14-and 21-day treatments. Tumor volume was calculated from thefollowing formula: [L (long axes) � S2 (short axes)]/2. In total,three images of each tumor were captured, and the image with thelargest value was used to calculate the tumor volume. Tumorvolume fold change was determined for each 7 days of treatmentby calculating the ratio of tumor volume from week 1/baseline,week 2/week 1, and week 3/week 1.

TUNEL assayThe TUNEL (terminal deoxynucleotidyl transferase–mediated

deoxyuridine triphosphate nick end labeling) assay was per-formed according to the manufacturer's instructions (Roche).Briefly, the slides were baked at 62.5�C for 30 minutes to meltthe paraffin. Then, the slides were hydrated and proteinase K wasadded for 30 minutes at room temperature to expose the tissue.Following 5-minute wash in PBS, the TUNEL reaction solutionwas added to slides and positive control (DNAse I–mediatedDNA breakage) and incubated for 60 minutes at 37�C,protected from light. For negative control, label solution onlywas added to a slide and incubated as above. Then, all slides werewashed 3 times in PBS (5 minutes for each wash). After thewashes, converted POD was added to the slides, and theslides were incubated again for 60 minutes at 37�C, protectedfrom light. Following another 3 washes in PBS (5 minutes each),DAB was added to develop the reaction (10 minutes). Finally,the slides were washed as above, dehydrated, mounted, andsubjected to analysis.

IHC and ImmunofluorescenceIHC staining for Shh, c-Met, E-cadherin, IGF-1, and Ki67 were

performed by hand. Tissue blocks with poor quality were exclud-ed from the study. The slides for all stainings were hydrated;antigen retrieval was performed in a pressure cooker with citratebuffer (pH 6.0) for Shh and Ki67, in a steamer with citrate buffer(pH 6.0) for c-Met and IGF-1 and with Tris-EDTA buffer (pH 9.0)for E-cadherin. Then, the slides were blocked in peroxidase,avidin, and biotin block sequentially. Goat-anti-Shh (R&D),rabbit-anti-c-Met (Santa Cruz Biotechnology), rabbit anti-IGF-1(Abcam), rabbit anti-E-Cadherin (Abcam), or rabbit anti-Ki67(Abcam) primary antibodies at 1:50 (Shh, c-Met, E-cadherin), 1:500 (Ki67), and 4 mg/mL (IGF-1) were added, and the slides wereincubated for 1 hour at room temperature. Then, rabbit anti-goat

Rucki et al.

Mol Cancer Ther; 16(11) November 2017 Molecular Cancer Therapeutics2400




or goat anti-rabbit biotinylated secondary antibodies (VectorLaboratories), respectively, were added for 30 minutes at roomtemperature. The signal was amplified and detected using the ABCVectastain Kit (Vector Laboratories) according to the manufac-turer's instructions. The slides were developed using DAB andcounterstained by hematoxylin. Finally, the slides were dehy-drated and mounted. All IHC slides were analyzed and scoredby a pathologist. Immunofluorescence staining of c-Met and Shhwas described in Supplementary Materials and Methods.

shRNA knockdown of c-MetViral supernatants were produced as previously described

using shRNA against mouse c-Met or scrambled shRNA control(Dharmacon; ref. 27). Then, KPC cells were plated at 50% con-

fluency and allowed to adhere for 24 hours. On the day of viralinfection, the KPC media were aspirated and replaced withappropriately tittered viral supernatant (1mL/1 well of 6-wellplate) with polybrene (8 mg/mL). The infection was allowed toproceed for 24 hours. After 24-hour infection, the cells weretreated with appropriate inhibitors or vehicle control for addi-tional 24 hours. Then, the cells were harvested and Annexin Vexpression was analyzed as described previously (32). Knock-down of c-Met was confirmed by qRT-PCR as described below.

qRT-PCRThe RNeasy Micro Kit (Qiagen Inc.) was used to extract total

RNA from cell pellets. The RNA was then converted to cDNAusing the Superscript III First Strand Synthesis Supermix Kit

Figure 1.

Short-term inhibition of HGF/c-Met or Hh signaling enhances the sensitivity of PDAC tumors to gemcitabine in transgenic and orthotopic mouse models ofPDAC. A, Schematic representation of 1-week treatment regimen in the transgenic (KPC) and orthotopic mouse models of PDAC. Day 0 represents the dayof the orthotopic implantation of primary pancreatic tumors. Mice in the orthotopic model were subjected to ultrasound on postoperative day 5 to establishbaseline tumor data. Daily treatment by oral gavage with inhibitor(s) or vehicle control was initiated on the day after ultrasound. In the KPC mouse model,ultrasound was performed 1 day prior to treatment initiation. In both models, gemcitabine was administered biweekly by intraperitoneal injection. Secondultrasound was performed on the last day of treatment. Mice from all groups were euthanized on the last day of treatment and the panreata and livers wereharvested for analysis. B and C, The KPC (B) and orthotopic (C) mouse models of PDAC were treated with daily Hh and/or HGF/c-Met inhibitors and biweeklygemcitabine as shown in A. Tumor volumes were obtained at baseline and on the last day of treatment. The data show tumor volume fold changescalculated as a ratio by comparison of the posttreatment tumor volume to the baseline tumor volume. Data are representative of one experiment. Mice thatdied before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem,gemcitabine (n ¼ 8); Hh-Hh inhibitor þ gemcitabine (n ¼ 9); c-Met-HGF/c-Met inhibitor þ gemcitabine (n ¼ 7); DMSO-vehicle control (n ¼ 14); Hh þ c-Met þgemcitabine (n ¼ 8). � p < 0.05, �� p < 0.01 �� P < 0.001; �� P < 0.0001; n.s., non significant; (unpaired Student t test).

Dual Inhibition of Hedgehog and c-Met Pathways

www.aacrjournals.org Mol Cancer Ther; 16(11) November 2017 2401




(Life Technologies). qPCR was performed on the StepOnePlusReal Time PCR System (Life Technologies) and analyzed by theStepOne software V2.1. The expression of c-Met, HGF, and Shhwas measured by SYBR Green–based qPCR. All gene expressionwas normalized to the expression of GAPDH. All PCR reactionswere performed in triplicate. The primers used for RT-PCR areas follow:

c-Met: F-50TGTCCGATACTCGTCACTGC30

R-50CATTTTTACGGACCCAACCA 30(Invitrogen),Shh: F-50GGCCAAGGCATTTAACTTGTR-50CCAATTACAACCCCGACATC30(Invitrogen),GAPDH: F-50TTGATGGCAACAATCTCCAC30,R-50CGTCCCGTAGACAAAATGGT 30 (Invitrogen).

Coculture assayTreatment utilizing the transwell system (BD Biosciences) was

performed by plating KPC cells in the bottom chamber andmCAFs in the top chamber to spatially separate the cell types.c-Met was knocked down from KPC cells, whereas the mCAFswere kept in a separate 6-well plate(s) during infection. After 24-hour infection, the cells were treated in no serum media asdescribed previously (25). After 24-hour treatment, KPC cellswere harvested and Annexin V analyzed.

Statistical analysisStatistical analysis and graphing was performed using Graph-

Pad Prism version 6.0 software (GraphPad Software). The data arepresented as themeans� SEM. Student t test was used to comparedifferences between groups. Fisher exact test was used to comparedifferences between treatment groups in the metastasis study andapoptosis study. For all analyses, a P value of less than 0.05 wasconsidered statistically significant.

ResultsShort-term inhibition of HGF/c-Met or Hh signaling enhancesthe sensitivity of PDAC tumors to gemcitabine in transgenic andorthotopic mouse models of PDAC

To understand the discrepancy in the efficacies observedbetween preclinical mouse studies and clinical studies of Hhinhibitors and HGF/c-Met inhibitors for treating PDACs, weexamined both inhibitors in mouse models of PDAC. To thisend, we utilized two mouse models of PDAC. The first is agenetically engineered PDAC mouse model with knock-in allelesof both KrasG12D and p53R172H mutants (KPC mice), whichexhibits a multistage tumorigenesis that progresses from normal,throughPanIN lesions, to invasive andmetastatic PDAC (26). Thesecond is an orthotopic implant model where tumors are grownsubcutaneously from a cell line (the KPC cells) derived from KPCmice. Then, tumors of similar size are implanted orthotopicallyinto the pancreas of syngeneicmice (24). The treatment schema isshown in Fig. 1A. Briefly, mice in both models were subjected tothe small animal ultrasound examination to obtain baselinetumor volume.On the second day following the ultrasound,micebegan daily treatment of either Hh inhibitor or HGF/c-Met inhib-itor together with biweekly gemcitabine injection for a course of7 days. On the last day of treatment, the mice were subjected to asecond ultrasound to determine tumor volume. After the ultra-sound, the mice were euthanized and their pancreata were har-vested for analysis. In both models, the treatment of gemcitabinealone showed a modest, however not significant decrease ofprimary tumor growth when compared with the vehicle treat-ment. Addition of Hh inhibitor to the gemcitabine resulted in afurther trend of tumor shrinkage when compared with gemcita-bine treatment alone. Addition of c-Met inhibitor to the gemci-tabine however did not result in additional tumor shrinkage. The

Figure 2.

Combination of Hh and/or HGF/c-Metinhibitor(s) with gemcitabine in short-term treatment regimen results inenhancement tumoral cell death in thetransgenic (KPC) and orthotopic mousemodels. A and B, The KPC (A) andorthotopic (B) mouse models of PDACwere treatedwith Hh and/or HGF/c-Metinhibitor(s) and biweekly gemcitabineas shown in Fig. 1A. Primary tumors fromboth mouse models were harvested onthe last day of treatment and subjectedto TUNEL staining for apoptotic cells.Representative images for eachtreatment group in both models areshown. The images are representativeof one experiment. Mice that diedbefore the completion of the plannedtreatment or whose quality of tumorwas not adequate for analysis due tonecrosis were excluded. Gem-gemcitabine (n ¼ 8), Hh-Hh inhibitor þgemcitabine (n¼ 9), c-Met- HGF/c-Metinhibitorþ gemcitabine (n¼ 7), DMSO-vehicle control (n ¼ 14), Hh þ c-Met þgemcitabine (n¼ 8). Scale bar, 200 mm.

Rucki et al.





additional effect on tumor shrinkage observed with Hh inhibitorbut not the c-Met inhibitor can be explained by the targets of theinhibitors. The Hh inhibitor affects stroma, whereas the c-Metinhibitor works predominantly on the neoplastic cells (25). Thedata suggest that combination of both inhibitors with gemcita-bine shows a trend in shrinkage of primary tumor volume in bothmousemodels of PDACafter 1week of treatment regimen (Fig. 1Band C).

To assesswhether theobserved tumor shrinkage is due to tumorcell death, but not a decrease in the stroma compartment, weperformed terminal deoxynucleotidyl transferase (TdT) dUTPnick-end labeling (TUNEL assay) staining on the primary tumorsharvested from the KPC and the orthotopic mouse models(Fig. 1A) to evaluate tumor cell apoptosis. Tumors from neithermodel showed significant difference in tumor cell apoptosis in thegemcitabine treatment group when compared with the vehicletreatment (Fig. 2A and B). However, we observed an increasedapoptosis in PDACs treated with gemcitabine in combinationwith c-Met inhibitor. In contrast, little enhanced apoptotic activitywas seen in the tumors treated by the combination of gemcitabine

and Hh inhibitor compared with gemcitabine alone, suggestingthat the observed tumor shrinkage by ultrasoundmay represent adecrease in the stromal component. The apoptotic activity intumors treated by gemcitabine and c-Met inhibitor was similarto that in tumors treated by gemcitabine and both inhibitors(Fig. 2A and B). Taken together, following 1 week of treatment,there are some enhancements in antitumor activity by adding c-Met or Hh inhibitor or both to gemcitabine. Although theenhancement is modest in our study, it is consistent with thepublished preclinical studies.

Prolonged treatment of single HGF/c-Met or Hh inhibitor leadsto resistance, which can be overcome by the combination ofboth c-Met and Hh inhibitors

Next, we examined whether resistance to the c-Met and Hhinhibitors is developed after a longer course of treatment. To thisend, we treated the orthotopic model for 2 weeks and KPC micefor 3 weeks. Mice in the orthotopic model could not be treatedfor more than 2 weeks due to the aggressive nature of this model(24, 25). We subjected those mice to ultrasound examination to

Figure 3.

Prolonged combination treatment of transgenic mouse model (KPC) with Hh and HGF/c-Met inhibitors in combination with gemcitabine leads to reductionin primary tumor volume and increased apoptosis. A, Schematic representation of 3-week treatment regimen in the KPC mouse model of PDAC. Baselinetumor volume was determined one day before treatment, following weekly ultrasounds until the last day of treatment. Mice were treated daily by oralgavage with Hh and/or HGF/c-Met inhibitors or vehicle control. Gemcitabine was administered biweekly via intraperitoneal injection. B, The change in tumorvolume (calculated as ratio between week 3 and baseline tumor volume) is shown. C, Semiquantification of TUNEL staining for apoptotic cells in KPCmouse model after 3 weeks of treatment (as shown in A). The scoring method used score between 0 and 3, where 0 is no positive staining and 3 is highpositive staining. The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumorwas not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n ¼ 7), Hh-Hh inhibitor þ gemcitabine (n ¼ 6), c-Met- HGF/c-Metinhibitor þ gemcitabine (n ¼ 5), DMSO-vehicle control (n ¼ 9), Hh þ c-Met þ gemcitabine (n ¼ 4). ns, not significant; � , P < 0.05; ��, P < 0.01; ��, P < 0.001;�� , P < 0.0001 (unpaired Student t test).






obtain baseline tumor volumes. The treatment regimen wasinitiated on the second day following ultrasound and consistedof daily treatment of Hh inhibitor, HGF/c-Met inhibitor, orvehicle control together with biweekly gemcitabine administra-tion. Second ultrasound was performed 7 days after the first one.For KPCmice, the last ultrasoundwas performedon the last day of21-day treatment, and for the orthotopic model, the last ultra-soundwas performedon the last dayof 14-day treatment (Figs. 3Aand 4A). Interestingly, gemcitabine treatment had no effect ontumor size in the KPC mice (Fig. 3B); however, it did result insignificant reduction of primary tumors in the orthotopic model(Fig. 4B). Gemcitabine is in the family of nucleoside analoguemedications, and it works by blocking the creation of new DNA(33).We therefore examined the proliferation capacity of both theKPC and orthotopic tumors and showed that the activity ofgemcitabine with or without Hh or c-Met inhibitor does notappear to correlate with the proliferation status of the tumors(Supplementary Fig. S1). Moreover, c-Met but not Hh inhibitorfurther enhanced the antitumor response of gemcitabine in the

KPC but not the orthotopic model. More importantly, the com-bination of c-Met and Hh inhibitors significantly enhanced thetumor response to gemcitabine in both the KPC and orthotopicmouse models (Figs. 3B and 4B). We did not observe significanttoxicities with the treatments, as we did not observe any weightloss in the mice. Treatment with single target inhibitor shows nobenefit in terms of tumor shrinkage (25). We observed largevariability of tumor growth in the control group and the gemci-tabine-alone group. This may be explained by our recent findingshowing intertumoral heterogeneity of stromal signaling, namelythe HGF/c-Met and Shh/IGF-1/IGF-1R pathways in mouse mod-els of PDAC (25). The large variability in growth of untreatedtumors and tumors treated by gemcitabine alone may be becausesome tumors express high Shh signaling, whereas other tumorsexpress high c-Met signaling. However, when the tumors aretreated by stroma-targeting agents, their responses to gemcitabinebecome more uniform. To determine the effect of the treatmentregimen, we analyzed the apoptosis of tumor cell via the TUNELassay following more than 1 week of treatment. As expected,

Figure 4.

Prolonged combination treatment of orthotopic mouse model with \Hh and HGF/c-Met inhibitors in combination gemcitabine leads to reduction inprimary tumor volume and metastatic burden. A, Schematic representation of 2-week treatment regimen in the orthotopic mouse model of PDAC. Baselinetumor volume was determined on postoperative day 5, following by weekly ultrasounds until the last day of treatment. Mice were treated daily beginningone day after the first ultrasound by oral gavage with Hh and/or HGF/c-Met inhibitors or vehicle control. Gemcitabine was administered biweekly viaintraperitoneal injection. In the metastasis study (C), livers, lungs, gut, and peritoneum were harvested for gross and histologic analysis of metastases.B, The change in tumor volume (calculated as ratio between week 3 and baseline tumor volume) is shown. Data are representative of one experiment.C, Summary of total numbers of metastases formed (gross and histologic) in each group. The data are representative of one experiment. Mice that diedbefore the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine(n ¼ 7), Hh-Hh inhibitor þ gemcitabine (n ¼ 8), c-Met- HGF/c-Met inhibitor þ gemcitabine (n ¼ 10), DMSO-vehicle control (n ¼ 6), Hh þ c-Met þ gemcitabine(n ¼ 8). ns, not significant; � , P < 0.05; �� , P < 0.01; �� , P < 0.001; �� , P < 0.0001 (unpaired Student t test in B and Fisher exact test in C).

Rucki et al.





gemcitabine only group shows a minimal increase in tumor celldeath when compared with the vehicle treatment (Fig. 3C).Moreover, the addition of single inhibitor seems to have no effecton the incidence of apoptotic tumor cells, suggesting that theresistance to single inhibitors is developed following a longercourse (14 or 21 days) of treatment. Importantly, only dualinhibition of both Hh and HGF/c-Met pathways shows increasedsensitivity to gemcitabine as demonstrated by the significantlyincreased tumor cell death (Fig. 3C). These results suggest that theresistance to the c-Met and Hh inhibitor is developed following aprolonged treatment of each individual inhibitor; however, theresistance may be overcome by combining both c-Met and Hhinhibitors.

Next, wewanted to determinewhether prolonged combinationtreatment of dual stromal inhibitors and gemcitabine has an effecton incidence of metastasis. We utilized the orthotopic model forthis part of the study, as it allows for the establishment of primarytumors of similar size (24). We previously showed that untreatedmice become morbid and die between day 17 and day 25 with amedian survival of 21 days (25). Thus, following 2-week treat-ment (Fig. 4A), we chose to stop the experiment on day 19 beforethe majority of mice would have died, specifically, before therewere no more than 2 dead mice in each treatment group. Weeuthanized all the mice and harvested their livers, gut, lungs, andperitoneum for further analysis. Gross examination followed byhistologic examination of the metastasis formed revealed that

Figure 5.

Single c-Met or Hh inhibitor treatment leads to the enhanced expression of the other target and the combination of both c-Met and Hh inhibitorssuppresses the expression of both targets more effectively. A and B, Representative IHC images of primary tumors from the transgenic mouse model-KPCstained for expression of Shh (A) and c-Met (B) showing upregulation of Shh in the c-Met treatment group and vice versa, that can be overcome bycombination treatment of Hh and c-Met inhibitors with gemcitabine. C and D, Representative IHC images of primary tumors from the orthotopic mousemodel stained for expression of Shh (C) and c-Met (D) showing upregulation of Shh in the c-Met treatment group and vice versa, that can be overcome bycombination treatment of Hh and c-Met inhibitors with gemcitabine. Mice in both models were treated for 1 week (as shown in Fig. 1A). The data arerepresentative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate foranalysis due to necrosis were excluded. Arrows, positive staining. Gem-gemcitabine (n ¼ 8), Hh-Hh inhibitor þ gemcitabine (n¼ 9), c-Met- HGF/c-Met inhibitor þgemcitabine (n ¼ 7), DMSO-vehicle control (n ¼ 9), Hh þ c-Met þ gemcitabine (n ¼ 8). Scale bar, 200 mm.






single-stromal agents in combination with gemcitabine show atrend in the reduction of metastases formation, which is consis-tent with literature reports (Fig. 4C; refs. 34, 35). Importantly, thegroup with dual inhibitor treatment in addition to gemcitabineshowed no metastases (Fig. 4C). This result suggests that thecombination of c-Met and Hh inhibitors in addition to gemcita-bine has significantly suppressed metastasis formation.

Single c-Met or Hh inhibitor treatment leads to enhancedexpression of the other target, and the combination of bothc-Met and Hh inhibitors suppresses the expression of bothtargets more effectively

We then sought to understand the lack of effect of Hh or c-Metinhibitiononprimary tumor volumeby examining the expressionof their targets in PDACs from treated mice. We performed IHCstaining on primary tumors from both the KPC (Fig. 5A) and theorthotopic (Fig. 5B) mouse models that have been treated withgemcitabine alone or in combination with the inhibitors for oneweek (Fig. 1A). As anticipated, either single c-Met or Hh inhibitorin combination with gemcitabine lead to decrease of the c-Metand Shh expression, respectively (Fig. 5; Supplementary Fig. S2).However, in the mice treated with c-Met inhibitor, the expressionof Shh was enhanced, and in mice treated with Hh inhibitor, theexpression of c-Met was enhanced following one week of treat-ment. Similar results were observed in PDACs from the micetreated for three weeks (Supplementary Fig. S3). These resultssuggest that the ineffectiveness of these inhibitors in furthersensitizing PDAC to the gemcitabine treatment beyond one weekmay be attributed to the activation of alternative pathways.Consistent with this notion, inhibition of both c-Met and Hhpathways along with gemcitabine treatment shows a decrease inthe expression of both c-Met and Shh when compared with thegemcitabine-alone treatment group.

Compensatory overexpression/activation of alternativepathways may account for single-target resistance in PDAC

To further investigate the mechanism of resistance to gemcita-bine in combination with one inhibitor, we first examined theeffect of Shh inhibitor and c-Met inhibitor onKPC tumor cells andmCAF cells, respectively. As shown in Fig. 6A, Shh inhibitordecreased the expression of Shh, but increased the expression ofHGF from mCAF cells. In addition, c-Met inhibitor decreased theexpression of c-Met, but increased the expression of Shh from theKPC tumor cells. This result suggests that when Shh is inhibited,theHGF/c-Met pathway is activated as a compensation, andwhenc-Met is inhibited, the Shh expression is induced. Second, weconfirmed that inhibition of c-Met and/or Shh via the pharma-ceutical agents utilized in the study, leads to blockade of theirrespective pathways by analyzing downstream targets of eachpathway (Fig. 6B and C). Our recently published study placedIGF-1 downstream of Shh (25). Analysis of IGF-1 expression inPDAC tumors from orthotopic mouse model confirmed thatexpression of the protein is decreased in samples treated withHh inhibitor but not in the c-Met–treated samples when com-pared with vehicle control. As expected, combination treatmentresulted in decreased expression of IGF-1.Moreover, no differencein the amount of IGF-1was noted between the vehicle control andgemcitabine groups (Fig. 6B). E-Cadherin is downstream of bothHGF/c-Met and Shh pathways (5, 25, 36); therefore, either inhib-itor was able to activate E-cadherin. When both inhibitors wereused, the expression of E-cadherin was higher than that seen with

single inhibitors (Fig. 6C). Third, we tested the selectivity of c-Metinhibitor utilizing tumor cells with c-Met knockdown by shRNA.As shown in Table 1, when c-Met is knocked down (Supplemen-tary Fig. S4A), c-Met inhibitor is no longer capable of increasingapoptosis, although c-Met knockdown itself can induce apopto-sis. Interestingly, Shh inhibitor also failed to increase the apo-ptotic rate in cells with c-Met knockdown, suggesting that theeffect of the combination of c-Met and Shh inhibitors alsodepends on c-Met. Moreover, this finding suggests that c-Met cannot only mediate the effect of Hh, but it also implies thatknockdown and small molecule targeting of c-Met has a differenteffect on Shh expression (Fig. 6A; Supplementary Fig. S4B).

DiscussionPDAC is still one of the deadliest cancers worldwide with

limited therapeutic options (2). Here, we demonstrate that com-bination of targeted stromal pathway inhibition of the c-Met andHhpathways alongwith gemcitabine treatment lead to significantreduction of primary tumor volume and diminished metastasesformation in mouse models of PDAC. We also provide evidencethat this dual stromal therapy overcomes single-agent resistanceand increases gemcitabine sensitivity.

This study not only confirms the prior finding but also providesan additional mechanistic explanation to the affectivity of dualstromal inhibition in terms of the decrease in PDAC tumorburden. It also explains why single stromal agent clinical trialsfail to show efficacy in human subjects (37). One of the reasons isthe development of resistance to those agents by overexpressionof other, nontargeted pathways. We demonstrated that the upre-gulation of those nontargeted protumorigenic pathways tends tobe more prominent in longer term treatments.

The use of PDAC mouse models, although very informative,has some limitations. Mice with implanted tumors have a veryshort lifespan (�3 weeks) without treatments; thus, we used the"2-week" treatment course tomimic the long course of treatment.Although KPC spontaneous tumor models could be treated for alonger course, we found that the mice could not tolerate aprolonged course of treatment with daily oral gavage and wereconcerned about inadvertent effect from oral gavage. Those lim-itations lead to difficulty in accessing survival benefit in thesestudies. Nevertheless, the data presented in these studies supportfurther testing of the combination of Hh and c-Met inhibitors inclinical trials.

Numerous studies reported the benefit of stromal modulationin enhancing chemosensitivity in mouse models of PDAC (19,38–41); however, the use of Hh inhibitor in combination withchemotherapy agents in clinical trials with human subjects failedto show benefit (20–23). The importance of Hh and c-Met path-ways as potential PDAC targets has been well documented (25,42–44). The role of Hh signaling in PDAC has been rathercontroversial. Some studies show that targeting the pathway isbeneficial in PDAC (45), whereas others documented that acti-vation of Hh signaling can slow tumorigenesis (46). We recentlypublished a study showing that expression of Shh and HGF isheterogeneous in the tumor microenvironment of PDAC, andonly blockade of both pathways has a beneficial effect on metas-tasis of PDAC (25). This current study offers an insight into thelack of success of trials as well it begins to answer the opposingreports in current literature on the role of Hh pathway by showingthat combinational targeted therapy results in PDAC tumor

Rucki et al.





sensitization to gemcitabine and overcomes the resistance mech-anism of single-agent targeted therapies. Targeting c-Met withcabozantinib was shown to increase gemcitabine efficacy oncultured pancreatic tumor cells. The fact that cabozantinibreduced stemcellmarkers and also self-renewalpotential of PDACcells may account for the mechanism of inhibition of c-Met inovercoming the resistance of PDAC to chemotherapy (43, 44).Our recent study described the role of stroma in c-Met inhibition(25), which provides a separate mechanism to overcomingresistance to chemotherapy, although we show that inhibitionof c-Met is compensated by increased levels of another stromalpathway,namely theHhpathway.AsHhsignaling is also involvedin self-renewal of PDAC, it is possible that the combination of Hhand c-Met inhibition overcomes the resistance in PDAC to gem-citabine through inhibiting the self-renewal potential of PDAC.

Table 1. Summary of the rate of apoptosis in KPC cells with/without c-Metknockdown after inhibitor treatment

c-Met statusTreatmentgroup

Percentage of AnnexinV–positive cells(�SEM)

shRNA-Ctrl DMSO 10.59 � 0.23c-Met 22.36 � 1.09Hh 36.47 � 0.85

shRNA-c-Met DMSO 69.19 � 2.56c-Met 70.26 � 0.98Hh 71.17 � 1.12

NOTE: Fisher test was performed. There is a statistically significant difference(P < 0.0001) between the DMSO-treated and Hh inhibitor–treated KPC tumorcells transfected with shRNA-Ctrl. There is no statistical difference betweentreatments of cells transfectedwith c-Met shRNA. Data are shown as themean�SEM.

Figure 6.

Compensatory overexpression/activationof alternative pathways explains singletarget resistance in PDAC. A, qRT-PCRanalysis of c-Met, Shh, and GAPDH(control) in KPC tumor cells after c-Metinhibitor treatment and qRT-PCR analysisof Shh, HGF, and GAPDH (control) inmCAFs after Hh inhibitor treatment. Thegene was normalized to GAPDH and isshown as a fold change. B and C,Representative IHC images of primarytumors from the orthotopic mouse modelstained for expression of IGF-1 (B) andE-cadherin (C). Mice were treated for 1week (as shown in Fig. 1A). The data arerepresentative of one experiment. Micethat died before the completion of theplanned treatment or whose quality oftumor was not adequate for analysis dueto necrosis were excluded. Gem-gemcitabine (n ¼ 8), Hh-Hh inhibitor þgemcitabine (n ¼ 9), c-Met- HGF/c-Metinhibitor þ gemcitabine (n ¼ 7), DMSO-vehicle control (n ¼ 9), Hh þ c-Met þgemcitabine (n ¼ 8). Scale bar, 200 mm.






Further studies are warranted to determine the exact molecularmechanism underlying the role of c-Met and Hh signaling inchemotherapy resistance in PDAC.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: A.A. Rucki, R.A. Anders, L. ZhengDevelopment of methodology: A.A. Rucki, Q. Xiao, R. Sharma, R.A. AndersAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): A.A. Rucki, Q. Xiao, J. Chen, X. Che, J. Kleponis,R.A. AndersAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): A.A. Rucki, Q. Xiao, X. Che, L. ZhengWriting, review, and/or revision of the manuscript: A.A. Rucki, R. Sharma,E.M. Jaffee, L. Zheng

Administrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): A.A. Rucki, S. Muth, J. KleponisStudy supervision: E.M. Jaffee, L. Zheng

Grant SupportThis work was supported in part by NIH R01 CA169702 (to L. Zheng),

NIH K23 CA148964-01 (to L. Zheng), Viragh Foundation, the Skip ViraghPancreatic Cancer Center at Johns Hopkins (to E.M. Jaffee and L. Zheng),Lefkofsky Family Foundation (to L. Zheng), the NCI SPORE in GastrointestinalCancers P50 CA062924 (to E.M. Jaffee and L. Zheng), and a LustgartenFoundation grant (to L. Zheng).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received July 13, 2016; revised February 8, 2017; accepted August 25, 2017;published OnlineFirst September 1, 2017.

References1. Bond-Smith G, Banga N, Hammond TM, Imber CJ. Pancreatic adenocar-

cinoma. BMJ 2012;344:e2476.2. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin

2014;64:9–29.3. WarshawAL, Fernandez-del Castillo C. Pancreatic carcinoma. N Engl JMed

1992;326:455–65.4. Maitra A, Hruban RH. Pancreatic cancer. Ann Rev Pathol 2008;3:157–88.5. Rucki AA, Zheng L. Pancreatic cancer stroma: understanding biology leads

to new therapeutic strategies. World J Gastroenterol 2014;20:2237–46.6. Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt P, et al. Core

signaling pathways in human pancreatic cancers revealed by global geno-mic analyses. Science 2008;321:1801–6.

7. Yu J, Ohuchida K, Mizumoto K, Ishikawa N, Ogura Y, Yamada D, et al.Overexpression of c-met in the early stage of pancreatic carcinogenesis;altered expression is not sufficient for progression fromchronic pancreatitisto pancreatic cancer. World J Gastroenterol 2006;12:3878–82.

8. Ide T, KitajimaY,Miyoshi A,Ohtsuka T,MitsunoM,OhtakaK, et al. Tumor-stromal cell interaction under hypoxia increases the invasiveness of pan-creatic cancer cells through the hepatocyte growth factor/c-Met pathway.Int J Cancer 2006;119:2750–9.

9. Ide T, Kitajima Y, Miyoshi A, Ohtsuka T, Mitsuno M, Ohtaka K, et al. Thehypoxic environment in tumor-stromal cells accelerates pancreatic cancerprogression via the activation of paracrine hepatocyte growth factor/c-Metsignaling. Ann Surg Oncol 2007;14:2600–7.

10. Avan A, Caretti V, Funel N, Galvani E, Maftouh M, Honeywell RJ, et al.Crizotinib inhibits metabolic inactivation of gemcitabine in c-Met-drivenpancreatic carcinoma. Cancer Res 2013;73:6745–56.

11. JinH, YangR, Zheng Z, RomeroM, Ross J, Bou-ReslanH, et al.MetMAb, theone-armed 5D5 anti-c-Met antibody, inhibits orthotopic pancreatic tumorgrowth and improves survival. Cancer Res 2008;68:4360–8.

12. Yap TA, Olmos D, Brunetto AT, Tunariu N, Barriuso J, Riisnaes R, et al.Phase I trial of a selective c-MET inhibitor ARQ 197 incorporating proof ofmechanism pharmacodynamic studies. J Clin Oncol 2011;29:1271–9.

13. Sharma N, Adjei AA. In the clinic: ongoing clinical trials evaluating c-MET-inhibiting drugs. Ther Adv Med Oncol 2011;3:S37–50.

14. Tian H, Callahan CA, DuPree KJ, Darbonne WC, Ahn CP, Scales SJ, et al.Hedgehog signaling is restricted to the stromal compartment duringpancreatic carcinogenesis. Proc Natl Acad Sci U S A 2009;106:4254–9.

15. Li X, Ma Q, Duan W, Liu H, Xu H, Wu E. Paracrine sonic hedgehogsignaling derived from tumor epithelial cells: a key regulator in thepancreatic tumor microenvironment. Crit Rev Eukaryotic Gene Exp2012;22:97–108.

16. Bailey JM, Swanson BJ, Hamada T, Eggers JP, Singh PK, Caffery T, et al.Sonic hedgehog promotes desmoplasia in pancreatic cancer. Clin CancerRes 2008;14:5995–6004.

17. Walter K, Omura N, Hong SM, Griffith M, Vincent A, Borges M, et al.Overexpression of smoothened activates the sonic hedgehog signalingpathway in pancreatic cancer-associated fibroblasts. Clin Cancer Res 2010;16:1781–9.

18. Khan S, Ebeling MC, Chauhan N, Thompson PA, Gara RK, Ganju A, et al.Ormeloxifene suppresses desmoplasia and enhances sensitivity ofgemcitabine in pancreatic cancer. Cancer Res 2015;75:2292–304.

19. Olive KP, Jacobetz MA, Davidson CJ, Gopinathan A, McIntyre D, HonessD, et al. Inhibition of Hedgehog signaling enhances delivery of chemo-therapy in a mouse model of pancreatic cancer. Science 2009;324:1457–61.

20. Kim EJ, Sahai V, Abel EV, Griffith KA, Greenson JK, Takebe N, et al.Pilot clinical trial of hedgehog pathway inhibitor GDC-0449(vismodegib) in combination with gemcitabine in patients withmetastatic pancreatic adenocarcinoma. Clin Cancer Res 2014;20:5937–45.

21. Pant S, Saleh M, Bendell J, Infante JR, Jones S, Kurkjian CD, et al. A phase Idose escalation study of oral c-MET inhibitor tivantinib (ARQ 197) incombination with gemcitabine in patients with solid tumors. Ann Oncol2014;25:1416–21.

22. Catenacci DV, Junttila MR, Karrison T, Bahary N, Horiba MN, Nattam SR,et al. Randomized phase Ib/II study of gemcitabine plus placebo orvismodegib, a hedgehog pathway inhibitor, in patients with metastaticpancreatic cancer. J Clin Oncol 2015;33:4284–92.

23. Michaud NR, Wang Y, McEachern KA, Jordan JJ, Mazzola AM, HernandezA, et al. Novel neutralizing hedgehog antibody MEDI-5304 exhibitsantitumor activity by inhibiting paracrine hedgehog signaling. Mol CancerTher 2014;13:386–98.

24. Foley K, Rucki AA, XiaoQ, ZhouD, Leubner A,MoG, et al. Semaphorin 3Dautocrine signaling mediates the metastatic role of annexin A2 in pancre-atic cancer. Sci Signal 2015;8:ra77.

25. RuckiAA, FoleyK, ZhangP, XiaoQ,Kleponis J,WuAA, et al.Heterogeneousstromal signaling within the tumor microenvironment controls themetas-tasis of pancreatic cancer. Cancer Res 2017;77:41–52.

26. Hingorani SR, Wang L, Multani AS, Combs C, Deramaudt TB, Hruban RH,et al. Trp53R172H and KrasG12D cooperate to promote chromosomalinstability and widely metastatic pancreatic ductal adenocarcinoma inmice. Cancer Cell 2005;7:469–83.

27. Zheng L, Foley K, Huang L, Leubner A, Mo G, Olino K, et al. Tyrosine 23phosphorylation-dependent cell-surface localization of annexin A2 isrequired for invasion and metastases of pancreatic cancer. PLoS One2011;6:e19390.

28. Pan S, Wu X, Jiang J, Gao W, Wan Y, Cheng D, et al. Discovery of NVP-LDE225, a potent and selective smoothened antagonist. ACS Med ChemLett 2010;1:130–4.

29. Liu X, Wang Q, Yang G, Marando C, Koblish HK, Hall LM, et al. A novelkinase inhibitor, INCB28060, blocks c-MET-dependent signaling, neoplas-tic activities, and cross-talk with EGFR and HER-3. Clin Cancer Res2011;17:7127–38.

30. Weng L, Qiao L, Zhou J, Liu P, Pan Y, inventorsp; Incyte Corporation,assignee. Salts of 2-fluoro-N-methyl-4-[7-(quinolin-6-yl-methyl)-imi-dazo[1,2-b][1,2,4]triazin-2-yl]benzamide and processes related to prepar-ing the same. Europe Patent WO 2009143211. 2009 Mar 4.

Rucki et al.





31. Al-Muhsen S, Letuve S, Vazquez-Tello A, Pureza MA, Al-Jahdali H, Baham-mam AS, et al. Th17 cytokines induce pro-fibrotic cytokines release fromhuman eosinophils. Resp Res 2013;14:34.

32. Black CM, Armstrong TD, Jaffee EM. Apoptosis-regulated low-aviditycancer-specific CD8(þ) T cells can be rescued to eliminate HER2/neu-expressing tumors by costimulatory agonists in tolerized mice. CancerImmunol Res 2014;2:307–19.

33. BurrisHA,MooreMJ 3rd, Andersen J,GreenMR, RothenbergML,ModianoMR, et al. Improvements in survival and clinical benefit with gemcitabineas first-line therapy for patients with advanced pancreas cancer: a random-ized trial. J Clin Oncol 1997;15:2403–13.

34. OgunwobiOO,PuszykW,DongHJ, LiuC. Epigenetic upregulation ofHGFand c-Met drivesmetastasis in hepatocellular carcinoma. PLoS one 2013;8:e63765.

35. Hanna A, Shevde LA. Hedgehog signaling: modulation of cancer properiesand tumor mircroenvironment. Mol Cancer 2016;15:24.

36. Penchev VR, Rasheed ZA, Maitra A, Matsui W. Heterogeneity and targetingof pancreatic cancer stem cells. Clin Cancer Res 2012;18:4277–84.

37. Kundranda M, Kachaamy T. Promising new therapies in advanced pan-creatic adenocarcinomas. Future Oncol 2014;10:2629–41.

38. Quint K, Tonigold M, Di Fazio P, Montalbano R, Lingelbach S, Ruckert F,et al. Pancreatic cancer cells surviving gemcitabine treatment expressmarkers of stem cell differentiation and epithelial-mesenchymal transi-tion. Int J Oncol 2012;41:2093–102.

39. Huang FT, Zhuan-Sun YX, Zhuang YY, Wei SL, Tang J, Chen WB, et al.Inhibition of hedgehog signaling depresses self-renewal of pancreaticcancer stem cells and reverses chemoresistance. Int J Oncol 2012;41:1707–14.

40. BahraM,KamphuesC,Boas-KnoopS, Lippert S, EsendikU, SchullerU, et al.Combination of hedgehog signaling blockage and chemotherapy leads totumor reduction in pancreatic adenocarcinomas. Pancreas 2012;41:222–9.

41. Noguchi K, Eguchi H, Konno M, Kawamoto K, Nishida N, Koseki J, et al.Susceptibility of pancreatic cancer stem cells to reprogramming. Cancer Sci2015;106:1182–7.

42. Onishi H, Katano M. Hedgehog signaling pathway as a new therapeutictarget in pancreatic cancer. World J Gastroenterol 2014;20:2335–42.

43. Hage C, Rausch V,GieseN, Giese T, Schonsiegel F, Labsch S, et al. The novelc-Met inhibitor cabozantinib overcomes gemcitabine resistance and stemcell signaling in pancreatic cancer. Cell Death Dis 2013;4:e627.

44. Li C, Wu JJ, HynesM, Dosch J, Sarkar B, Welling TH, et al. c-Met is amarkerof pancreatic cancer stem cells and therapeutic target. Gastroenterology2011;141:2218–27.e5.

45. Thayer SP, di Magliano MP, Heiser PW, Nielsen CM, Roberts DJ, LauwersGY, et al. Hedgehog is an early and late mediator of pancreatic cancertumorigenesis. Nature 2003;425:851–6.

46. Lee JJ, Perera RM,WangH,WuDC, Liu XS,Han S, et al. Stromal response toHedgehog signaling restrains pancreatic cancer progression. ProcNatl AcadSci U S A 2014;111:E3091–100.






2017;16:2399-2409. Published OnlineFirst September 1, 2017.Mol Cancer Ther Agnieszka A. Rucki, Qian Xiao, Stephen Muth, et al. Cancer TreatmentDual Inhibition of Hedgehog and c-Met Pathways for Pancreatic

Updated version

10.1158/1535-7163.MCT-16-0452doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2017/09/01/1535-7163.MCT-16-0452.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/16/11/2399.full#ref-list-1

This article cites 45 articles, 20 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/16/11/2399To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-16-0452

http://mct.aacrjournals.org/content/suppl/2017/09/01/1535-7163.MCT-16-0452.DC1

http://mct.aacrjournals.org/content/16/11/2399.full#ref-list-1

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/16/11/2399


dual inhibition of hedgehog and c-met pathways for ... · abdomen was opened via a left subcostal...

Documents