e d. green et al . nature 470 , 204 - 213 (2011) doi:10.1038/nature 09764

1

E D. Green et al. Nature 470, 204-213 (2011) doi:10.1038/nature09764 Schematic representation of accomplishments across five domains of genomics research

Upload: colby-james

Post on 31-Dec-2015

64 views

Category:

Documents

4 download

Report

Download

Embed Size (px):

DESCRIPTION

Schematic representation of accomplishments across five domains of genomics research. E D. Green et al . Nature 470 , 204 - 213 (2011) doi:10.1038/nature 09764. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: E D. Green et al . Nature 470 , 204 - 213 (2011) doi:10.1038/nature 09764

E D. Green et al. Nature 470, 204-213 (2011) doi:10.1038/nature09764

Schematic representation of accomplishments across fivedomains of genomics research

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3107 Supplementary Figure 3 Distribution of P values from multiple-association analyses at 55 SNPs having a prior

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A