effect of 10 mt magnetic fields exposure on testicular germ cells,

8/18/2019 Effect of 10 Mt Magnetic Fields Exposure on Testicular Germ Cells,

1/12

Egypt. J. Exp. Biol. (Zool.), 3: 271 – 281 (2007). © The Egyptian Society of Experimental Biology

h t t p : / / w w w. e g y p t s e b . o r g

R E S E A R C H A R T I C L E

M o h a m e d M . B e k h i t e

EFFECT OF 10 mT M AGNETIC FIELDS EXPOSURE ON TESTICULAR GERM CELLS,THE ROLE OF VEGF, AND THE AMELORATIVE EFFECT OF VITAMIN CSUPPLEMENT

ABSTRACT:The present study aimed to elucidate

the potential adverse effects of magneticfields (MFs) exposure on the testis of mice.Significant decreases in body weight gain andtestis weight were recorded in adult malesthat exposed to 10 mT alternate current (AC)or direct current (DC) MFs 8h/d for 6successive weeks. Moreover, the inactiveseminiferous tubules of exposed males weremarkedly increased, associated with missing

of both spermatids and sperms, in addition toincreasing of abnormal sperm head and tailshapes. Moreover, Sertoli cells were alsodegenerated. Some histopathological changesaccompanied with significant increase in cellapoptosis were detected in the testicular germcells of exposed mice. A significant inhibitionof vascular endothelial growth factor (VEGF)was observed after exposure to MFscompared with control group. However, adaily intraperitoneally injection (i.p.) withantioxidant L-Ascorbic acid (100 µm) duringthe exposure period abolish the adverseeffects of MFs. The study indicated that MFsexposure exerts some adverse effects on

reproductive capacity of mice in the absenceof VEGF and free radical scavenger.

KEY WORDS:Magnetic fields (MFs), L-Ascorbic acid,vascular endothelial growth factors (VEGF),testis, mice.

CORRESPONDING:Mohamed M. BekhiteDepartment of zoology, Faculty of Science,University of Tanta, Tanta, Egypt.E-mail : m b e k h i t e @ y a h o o . c o m

INTRODUCTION:Magnetic radiation is a form of energy,

which is transmitted in the form of waves. Thebiological effects of magnetic fields (MFs) inwhich humans are exposed to every day havebeen the subject of study after their harmfulpossibility raised the concern of the generalpopulation (Stavroulakis, 2003; Feychting andForssen 2006).

The possible adverse effects of MFs onthe reproductive activity have been studiedamong workers in generating stations, powerline repairers, electricians, welders, andelectric railway locomotive drivers (Miller etal . , 1996; Kheifets et al. , 1997). However,limited data have been published about thesepotential adverse effects (De Vita et al . , 1995;Furuya et al . , 1998; Ryan et al . , 1999; Al-

Ak hr as et al . , 2001; Ramadan et al . , 2002).Moreover, there have been conflicting findingsregarding the alteration of spermatogenicfunctions. A number of studies showed thatexposure to MFs did not induce any adverseeffects on spermatogenesis of experimental

animals and human (Kowalczuk et al . , 1995;Lundsberg et al. , 1995; Heredia-Rojas et al .,2004; Chung et al . 2005; Kim et al . , 2006). Incontrast, many studies showed clear damageto spermatogenesis (WHO, 1987; Furuya, etal . , 1998; Al-Akhras, et al . , 2001; Ramadan,et al . , 2002; Lee, et al . , 2004; Abou-Zaid etal . , 2006).

Irgens et al . (1997) reported that themale proportion in offspring of men inindustries with electromagnetic field wasslightly reduced. Also the sex ratio wassignificantly decreased after mice irradiationby an electromagnetic pulse (Wang et al .,2003; Saadat, 2005).

A free exc ha ng e of prec urso rs,metaboli tes , intratest icular regulatory factors ,and endocrine substances within andbetween seminiferous tubules and Leydigcell clusters is assured by a highly developedmicrovasculature. Maintenance ofmicrocirculation is an important localregulatory determinant of test icularfunctions. In this context, the vascularendothelial growth factor (VEGF), which hasbeen shown to be present in the testes ofhuman (Ergün et a l . , 1997 & 1998) and mice


2/12

Egypt. J. Exp. Biol. (Zool.), 3: 271 – 281 (2007)272

(Marti and Risau, 1998), may play animportant role in spermatogenesis.

VEGF is a highly specific mitogen forvascular endothelial cells, it inducesendothelial cell proliferation, promotes cellmigrat ion and inhibi ts apoptosis (Ferrara etal . , 1992). Recent findings have alluded to anovel role for VEGF in male fertility(LeCouter et a l . , 2003). VEGF has beenshown to be expressed by several cell typesin male genital tract including Leydig andSertoli cells of the testis, certain epithelialcells and peritubular cells of the epididymis,and the epithel ium of the prostate andseminal vesicle. Concentration of VEGF insemen is very high, ~300 µM, which is wellabove the levels measured in tumor effusionsor serum (Young and Nelson, 2000). Both

types of VEGF receptors are expressed intest icular microvasculature and have beendetected also in vascular endothelium of the

epididymies (Brown et a l . , 1995).The functional role and regulat ion of

VEGF and i ts receptors in the test is ,particularly in relation to high endothelial cellproliferation and vascular permeability in thisorgan, have not been studied. Indirectevidence does, however, suggest that VEGFcould play an important role in testicularphysiology and pathology (LeCouter et al . ,2003). VEGF may be also involved inmediating testicular growth and regression inseasonally breeding animals (Young andNelson, 2000).

The permeabil i ty potency of this growthfactor is 50000 t imes greater than that ofhistamine (Keck et al . , 1989), and i t is ,hence, also called a vascular permeabilityfactor. VEGF can play a major role in the cellular transport of blood borne factors suchas glucose (Ergün et a l . , 1998). Therefore, i tis conceivable that VEGF plays a pert inentrole in the maintenance of testicular

functions by virtue of its ability to facilitatetransport of blood borne hormones andnutritional elements. Also, it appears that theexpression of VEGF within the testes mustbe finely regulated in order to be optimallyeffective, because an overexpression ofVEGF in the testes leads to a massivedisruption of spermatogenesis , result ing ininfertility (Korpelainen et a l . , 1998). I t maybe proposed that a fine regulation of VEGFproduction in the testes is essential in orderto faci l i tate and maintain cross talk amongthe endocrine, endothelial, and gametogeniccompartments of the testes. However, theunderlying mechanism of the regulation ofVEGF production by testicular cells remainsobscure.

The transgenic mice expressing VEGF(121 isoform) under the control of the

polyepithel ial mucin-1 (muc-1) promotershowed a reduction in male fertility due toimpaired spermiogenesis. Expression of

VEGF in normal testes, prostate, andseminal vesicles, and its high concentrationin semen (200–500 pmol/ l) f i rs t suggestedthat VEGF could play a role in malereproductive physiology (Huminiecki et a l . , 2001).

Therefore, the present s tudy aimed toevaluate the effects of MFs exposure on thetest is , the role of VEGF, and the ameliorat iveaction of vitamin c.

MARERIALS AND METHODS:Animals:

Ad ul t (60 da y- ol d) mal e BA LB /c mic e(35 – 40 g) were used in the study. Animalswere housed in a standard animal facilityunder controlled temperature 23 ± 2° C and50 ± 10 % humidity and photoperiod (12 h oflight, 12 h of darkness), with free access tostandard chow and water ad libitum .Exposure system and experimental design:

The MF exposure system was

manufactured to provide a uniform magneticfield distribution in long cylindrical coil whencurrent passes. During construction, siliconwas layered between coils to glue themtogether. This minimizes vibration noise whenthe coils are activated. The coils are woundon PVC tube; therefore it is completelyshielded against emission of electric fields.The exposure system is calibrated in order toobtain the uniform MFs continuously withinthe exposure time (Bekhite, 2005). A variableFH 51 Gauss-/Teslameter (MAGNET-PHYSIK,model No. 2000510, Köln, Germany) with asmall probe 761 was used.

Sixty male mice were divided at randominto 6 groups of 10 animals each. A: Control(shame treated control). B: Control injectedintraperitoneally (i.p.) with vitamin C (L-

As co rb ic ac id : 10 0 µm ; Ca lb io ch em , Ba dSoden, Germany) C: Males exposed to 10 mTalternate current (AC) MF and injected withvitamin C. D: Males exposed to 10 mT directcurrent (DC) MF and injected with vitamin C.E: Males exposed to 10 mT AC MF. F: Malesexposed to 10 mT DC MF. Experimentalgroups were exposed 8 h/day (from 9 a.m. to17 p.m.) for 6 weeks and each experimentwas performed a minimum of three times (n =3).

The present used strengths werechosen because the magnetic field emitted bypower lines, industrial power-chargeddevices, diagnostic and therapeuticalappliances that human exposed is ~10 mT(Sienkiewicz et al . , 1991; Allen et al . , 1994;Van Zijl et al . , 2007).Testis weight and morphometric analysis:

At the en d of ex po su re , mic e of bo thcontrol and experimental groups weresacrificed by cervical dislocation and bothtestes and epididymies were excised out of


3/12

Bekhite M. M., Effect of 10 mT MFs Exposure on Testicular Germ Cells, The Role of VEGF, and …. 273

the body in 0.9% saline. The epididymieswere separated from the testes of each groupand pooled in 1mL 0.9% saline. Testesweights were determined for each individualof experimental group calculated andrecorded then processed for routine paraffinembedding for either haematoxylin and eosinor immunofluorescence staining. Forassessments of morphometric analysis, the

numbers of seminiferous tubules werecounted. The average ratio of active andinactive seminiferous tubules was determined.The active tubules mean that the presence ofsperms and increased thickness of germ celllayers in the seminiferous tubules comparedto those of the control.

Sperm anomalies:The pooled epididymies were minced

with fine scissors, pipetted vigorously, andthe resulting suspension was placed in waterbath at 37˚C f or 10 minutes and then f i l teredthrough four layers of gauze to separate thesperm from t issue fragments. Ten sl ides of

sperm suspension were prepared for eachindividual. After air-drying, the slides wereexamined by microscope.

Immunofluorescence staining:For immunofluorescence staining of

VEGF, Phosphorylated extracellular signal-regulated protein kinase (Erk1/2) andcleaved caspase-3 staining the tissues werefixed for 1 h at 4°C in 4% paraformaldehydein phosphate buffer sal ine (PBS). Themonoclonal anti-VEGF (Biogenesis, Poole,UK), the rabbit polyclonal anti-Erk1/2(phosphorylated form of the proteins) (NewEngland Biolabs, Frankfurt , Germany,

dilution 1:50) and the rabbit polyclonalcleaved caspase-3 antibody (Calbiochem,Bad Sodden, Germany, dilution 1:100) wereused. Cy5-conjugated goat anti mouse IgG(VEGF, Dianova, Hamburg, Germany) or aCy3-conjugated goat anti-rabbit IgG (Erk1/2,Cleaved caspase-3; Dianova, Hamburg,Germany) at a concentrat ion of 3.8 µg/ml inPBS containing 10% milk powder were usedas a secondary antibody. Fluorescencerecordings were performed by laser scanningconfocal microscope (LSCM 410, Zeiss,Jena, Germany) connected to an invertedmicroscope (Axiovert 135, Zeiss) .

Reverse Transcription-Polymerase ChainReaction (RT-PCR):

To examine further mRNA expressionlevels of VEGF following the exposure toMFs, RT-PCR was performed to total RNAthat isolated from the t ests of the experimentgroups. Total RNA was isolated from frozentissues using TRIzol (Invitrogen, Karlsruhe,Germany). cDNA was synthesized from 2µgtotal RNA using a Superscript II reverse

transcriptase (Invitrogen, Karlsruhe,Germany) according to manufacturer ’sinstruct ions and using random primer. TheRT product was diluted 1:10 and PCR wasperformed with primer specif ic for miceVEGF. The VEGF forward primer was TCC

AC CA TGCC AA GTG GT an d the VEG F reve rseprimer was TCGGGGTACTCCTGGAAGAT. ßactin used as house keeping gene, the

forward primer was GATGACCCAGATCATGTTTGAG and the reverse primer wasCCATCACAATGCCTGTGGTA (Sigma,Deisenhofen, Germany). The PCR wasperformed in 38 cycles with Denaturation at94°C, Annealing at 57°C and elongation at72°C), with REDTaq Mix (Sigma,Deisenhofen, Germany)) in a thermal cycler(Eppendorf Mastercycler personal) yieldingan expected product for VEGF. Gel imageswere subsequently captured using a 1%agarose gel.

Western Blot Assay:The Western blot assays were carr ied

out by washed the tissues in PBS and lysedin lysis buffer (20 mM Tris-HCl [pH 7.5] , 150mM NaCl, 1 mM EDTA, 1 mM EGTA, 1%Triton X-100, 2.5 mM sodium pyrophosphate,1 mM -glycerophosphat e, and 1 mM Na 3 VO 4 )that contained a 1 mM phenylmethylsulfonylf luoride (a protease inhibi tor) for 30 min onice. Samples were centrifuged at 14,000 x g for 5 min to pel let t issues debris . After

determination of the t issues proteinconcentration using the Bio-Rad proteinassay (Bio-Rad,), 20 µg of tissues proteinsamples was mixed with sample buffer(Invitrogen, Karlsruhe, Germany), boiled,resolved on NuPAGE Bis-Tris Gel (4 to 12%),and transferred to ni trocel lulose membranesby electroblotting at 100 V, 350 mA for 1 h.Membranes were blocked with 5% (wt/vol)dry fat-free milk in Tris-buffered sal ine with0.1% Tween (TBST) for 60 min at roomtemperature. The primary antibody tophosphorylated Erk1/2 (Cell SignalingTechnology) was incubated at 4°C overnight.

Af ter wa sh in g wi th TBS T, the membr ane wa sincubated with a secondary antibody (CellSignaling) for 60 min at room temperature.The blot was developed using the ECLdetect ion ki t (Amersham, Freiburg, Germany)to produce a chemiluminescence signal,which was captured on x-ray film.

Stat is t ical analysis :Data are given as mean values ±S.D

unless otherwise indicated. GraphPad InStat-3 software (GraphPad Software Inc. , SanDiego, USA) was applied for t - test unpaireddata. A value of P < 0.05 is consideredsignificant ( *) .


4/12


RESULTS: A si gn if ic an t de cr ea se in bo dy we ig ht

gain was recorded in males that exposed to10 mT AC or DC MFs. However the reductionin weights was non-significant in the groupsthat injected with vitamin C during the MFsexposure period (Fig. 1).Fig.1. Weight gain of males exposed to 10 mT MFs

for 6 weeks (8 h/day).

0 1 2 3 4 5 6

R e

l a t i v e w e

i g h t g a

i n ( % )

90

10 0

11 0

12 0

13 0

14 0

C o n t r o lC o n t r o l + V i t . C1 0 m T A C M F + V i t . C1 0 m T D C M F + V i t. C1 0 m T A C M F1 0 m T D C M F

We e k s o f e x p o s u r e

**

Moreover, a significant decrease in

testis weight was detected in 10 mT AC or DCMFs exposed males. In contrast, there are no-

significant changes in testis weight of miceinjected with vitamin C during the MFsexposure period compared to that of control(Fig. 2). No mortality was found among miceof different group.Fig. 2. Weight of test is for mice exposed to 10 mT

MFs for 6 weeks (8 h/day).

T e s t

i s W e i g h

t ( g m

)

0 . 0 0

0 . 0 5

0 . 1 0

0 . 1 5

0 . 2 0

0 . 2 5

0 . 3 0

0 . 3 5C o n t r o l1 0 m T A C M F1 0 m T D C M F

**

w ith v it a m in C w ith o u t v i t am in C

The number of seminiferous tubules in

the histological sections of testis showed non-significant difference in all groups (Fig. 3).However the frequency of inactiveseminiferous tubules was markedly increasedin 10 mT AC or DC MF associated withmissing of spermatocytes and spermatids(Fig. 4). The activity of seminiferous tubulesshowed non-significant difference betweenthe control and exposed groups injected withvitamin C (Fig. 4).Fig. 3. Mean number of seminiferous tubules of mice

exposed to 10 mT MFs for 6 weeks (8 h/day).

M e a n

N o . o f s e m

i n e f e r o u s

t u b u l e s

0

50

10 0

15 0

20 0

25 0

30 0

C o n t r o lC o n t r o l + V i t . C1 0 m T A C M F + V i t . C1 0 m T D C M F + V i t . C1 0 m T A C M F1 0 m T D C M F

Fig. 4. The active somniferous tubules in testis of mice exposed to10 mT MFs for 6 weeks (8 h/day).

T h i c k n e s s o f g e r m

l a y e r

( µ m

)

0

10

20

30

40

50

60

70

* *

C o n t r

o l

C o n t r

o l + v

i t. C

1 0 m T A

C M F

+ v i t.

C

1 0 m T

D C M

F + v

i t. C

1 0 m T

A C M F

1 0 m T D

C M F

Parenchyma of the control testiscontains seminiferous tubules and interstitialcells. The seminiferou tubule is composed ofa complex stratified epithelium surrounded bya thick basal lamina. The seminiferousepithelium of adult mice consists of two typesof cells; Sertoli cells and spermatogenic cellline; the spermatogonia and their derivatives,primary spermatocytes, secondaryspermatocytes, spermatids, and spermatozoa(Fig. 5a).Fig. 5. Photomicrographs of testes sect ions of

different experimental groups. (a) Control (b)Control injected with vi tamin C, (c) 10 mT AC MFwith vi tamin C, (d) 10 mT DC MF with vi tamin C,(e) 10 mT AC MF, (f) 10 mT DC MF. IC.Interst i t ial cel l ; SC. Sertol i cel l ; SG.Spermatogonia; SP. Spermatids; SZ.Spermatozoa; V. vacuoles.

Testis of mice exposed to 10 mT AC orDC MF, exhibited massive degeneration ofspermatogenic cells with a marked reductionin the number of spermatozoa. Moreover,


5/12


spermatocytes in the seminiferous tubulesshowed karyolysis, pyknotic nuclei, and lossof cell cohesion. Besides, the lumina of thetubules contained abnormal residual bodies.In additions, Sertoli cells were alsodegenerated with vacuolation. The germinalepithelium of the affected tubules in the testisof 10 mT AC or DC MFs exposed miceshowed marked decrease in the number of

spermatogonia which characterized bycondensed chromatin and shrinkage ofcytoplasm, as well as the presence ofapoptotic bodies, suggesting apoptotic death(Figs 5e & f). Spermatocytes lining theseminiferous epithelium appeared to bearrested in their development, and there wasabsence of spermatids and spermatozoa. Inaddition, there is an increase in the numberdegenerated Leydig cells with karyorehexednuclei. Few cells exhibited normal nucleiappearance.

In contrast, the testis of mice injectedi.p. with vitamin C during the exposure periodshowed no histological changes in thestructure of seminiferous tubules and Leydigcells (Figs 5b-d). Thus suggesting aninvolvement of reactive oxygen species (ROS)and VEGF in spermatogenesis.Germ cells apoptosis:

To investigate if MFs exposure causeapoptosis, testis were exposed to 10 mT ACor DC MFs and at end time of exposure, cellapoptosis was investigated by anti-cleavedcaspase-3 immunohistochemisty. The resultsindicated that a dose of 10 mT AC or DC MFswith vitamin C didn't affect significantly on themean number of apoptotic germ cells in thetestis (Fig. 6). In contrast, 10 mT AC or DC

MFs exposure resulted in a significantincrease in the number of apoptotic germ cellsin the testis (Fig. 6).Fig. 6. The mean number of apoptic germ cells/semineferous

tubules in testis of mice exposed to 10 mT MFs for 6weeks (8 h/d ay) .

M e a n

n u m

b e r o f a p o p

t i c

g e r m

c e l l s / s e m

i n i f e r o u s

t u b u

l e

0

5

10

15

20

25

ControlControl + vit. C10 mT AC MF + vit. C10 mT DC MF + vit. C10 mT AC MF10 mT DC MF

* *

Phosphorylated extracellular signal-regulated protein kinase (Erk1/2):

Kinase phosphorylation was examinedto determine whether Mitogen-activatedprotein kinase (MAPK) Erk1/2 the majorstress-activated pathways, was involved inMFs induced stress. There was a significant

decrease in Erk1/2 phosphorylation in germcells of testis exposed to 10 mT AC or DCMFs as compared to control. The sectionsfrom testis of mice i.p. injected with vitamin Cduring the exposure period, PhosphorylatedErk1/2 protein showed non-significantdifference as compared to control (Fig. 7).Fig. 7. Phosphorylated Erk1/2 proteins in testis of mice

exposed to 10 mT MFs for 6 weeks (8 h/ da y) .

R e

l a t i v e

i n t e n

i s i t y o

f

E r k

1 / 2 i m m u n o f

l u o r e s c e n c e

0

5

10

15

20

25 ControlControl + vit. C10 mT AC MF + vit. C10 mT DC MF + vit. C10 mT AC MF10 mT DC MF

* *

To confirm the previous results, western

blot was used for measuring quantitatively thelevel of both p44 and p42 MAP kinases (Erk1and Erk2) in the testis. Western blot indicatedthat phosphorylated Erk1/2 proteins was lessactivated in the testis exposed to 10 m T AC orDC MFs. However, the phosphorylated Erk1/2proteins did not change in testis of miceexposed to 10 mT AC or DC MFs and injectedi.p. with vitamin C during the exposure ascompared with control (Fig. 8).Fig. 8. Western blot products for phosphorylated Erk1/2 proteins in

testis of mice exposed to 10 mT MFs for 6 weeks (8 h/day).

Expression of the VEGF in spermatogeniccells:The testis of mice exposed to 10 mT AC orDC MFs revealed a significant inhibition ofVEGF expression (Figs 9a-f) in which theseminiferous tubules appeared faintly stainedcompared to those of the control group (Figs9e & f). In contrast, the mice injected i.p. withvitamin C during the exposure to 10 mT A C orDC MFs showed no significant decrease inVEGF expression in testis (Fig. 10). Alsoquantitative analysis by RT-PCR for VEGFgene confirms the previous results (Fig. 11).From this experiment we conclude that VEGFis modulate by ROS generation from NAD(P)Hoxidase under the MFs exposure.Sperms anomalies:

The normal sperm have a hook-likehead shape, and normal orientation of thehead with the sperm body and elongated tail,characteristic of the species.

Control Control+ vit. C

10 mTAC +vit. C

10 mTDC +vit. C

10 mTAC

10 mTDC

P 44 KDa

Phospho- Erk1/2

P 42 KDa


6/12


Fig. 9. Localizat ion of VEGF in mouse test is . (a)Section through a normal test is , (b) Controlinjected with vi tamin C, (c) 10 mT AC MF withvitamin C, (d) 10 mT DC MF with vi tamin C, (e) 10mT AC MF, (f) 10 mT DC MF

Fig. 10. VEGF expression in testis of mice exposed to 10 mTMFs for 6 weeks (8 h/ da y) .

R e

l a t i v e

i n t e n

i s i t y o

f

V E G F i m m u n o

f l u o r e s c e n c e

0

10

20

30

40

50

ControlControl + vit. C10 mT AC MF +vit. C10 mT DC MF + vit. C10 mT AC MF10 mT DC MF

**

Fig. 11. RT-PCR products for VEGF gene in the test is

of mice after exposed to 10 mT MFs for 6 weeks(8 h/day).

C on

t r ol

C on

t r ol + v i t .

C

1 0 mT A

C + v i t .

C

1 0 mT D

C + v i t .

C

1 0 mT A

C

1 0 mT D

C

VEGF

ß actin

The sperms of control mice appear inthe form of typical sickle-shaped head withelongated tail (Figs 12a & b). In theexperimental group exposed to 10 mT AC orDC MFs sperms possess abnormal heads andtails (Figs 12e & f). However these significantabnormalities in sperm heads and tail wereabsent in the same groups injected daily withvitamin C during the MFs exposure period

(Figs 12c & d).

Fig. 10. Phase-contrast micrograph of micespermatozoa. (a) Control , (b) Control injectedwith vi tamin C, (c) 10 mT AC MF with vi tamin C,(d) 10 mT DC MF with vi tamin C, (e) 10 mT ACMF, (f) 10 mT DC MF.

DISCUSSION:Many people are surprised when they

become aware of the variety of magneticfields (MFs) levels found near variousappliances. The field strength does notdepend on how large, complex, powerful ornoisy the device is. Furthermore, evenbetween apparently similar devices, thestrength of the MFs may vary a lot. Thesedifferences in MFs strength are related toproduct design (Lee et al . , 2006). The presentwork present evidence that low expression ofVEGF under MFs in the testis of mice leads toinhibition of spermatogenesis and may causeinfertility.

In the present study, exposed males ofmice to MFs showed a significant decrease inthe body weight gain. Moreover, a significantdecrease in the testis weight was detectedwithout change in the number of seminiferoustubules. In addition, the testicular weight ofmice exposed to 10 mT AC or DC MFs for 6


7/12


weeks was significantly lower than that of thecontrol. In contrast, the mice that exposed to10 mT AC or DC MFs and injected withvitamin C for 6 weeks showed non-significantchange in body weight gain and weight oftestis compared with the control. The abovementioned findings agree with those of Honget al, (2003) who recorded that the exposureof mice to 6.4 mT MF caused significant

decrease in the testis weight accompaniedwith reduction in sperm amount and motility.The results of the present experiments

on apoptosis indicated that the 10 mT AC orDC MFs caused high significant increase inthe number of apoptotic cells on the level ofDNA and cells. It can be suggested that, theNAD(P)H oxidase was affected by 10 mT ACor DC MFs exposure, thus led to an increasein free radicals, which are responsible forDNA damage and apoptosis in the testis.Whereas, MFs exposure in the presence offree radical scavenger L-Ascorbic acid(vitamin C) showed no apoptotic cells.Involvement of free radicals in the biologicaleffects of MFs was proposed by severalauthors (Lin et al. , 1994; Adey, 1997; Koanaet al . , 1997; Yoshikawa et al. , 2000; Bekhite,2005).

The programmed cell death cascadecan be divided into at least three phases:signal activation, control and execution, andstructural alterations. Multiple signallingpathways lead from death-triggering extrinsicsignals to a central control and executionstage. During this stage, the activation ofcaspases occurs. Downstream, caspaseactivation leads to DNA fragmentation andmorphological changes of the cells and nuclei

that are typical for apoptosis (Gura, 1997;Kastan, 1997; Nagata, 1997; Reed, 1997).MFs have been thought to induce

genotoxicity via some secondary mechanisms,such as modulation of the signal transductionpathways, resulting in genetic instability andaneuploidy (Simko et al . , 1998). Exposure toMFs might cross-link DNA and proteins (Singhand Lai, 1998). MFs might affect theproduction of free radicals, which could thenreact with DNA, or of other agents that causechromosomal damage, instigatingtranslocation to induce DNA breaks or byformation of unnatural DNA structures (Koanaet al . , 1997, Bekhite, 2005).

The results obtained in the presentstudy agree with others previous studiesreported by many authors. De Vita et al. (1995) reported that exposure to 50 Hz and1.7 mT for 4 h caused a significant decreasein the number of elongated spermatids on day28 after treatment. Furuya et al. (1998)suggested that long-term exposure to MFs(1.0 mT) had a possible effect on theproliferation and differentiation ofspermatogonia. Al-Akhras et al. (2001)reported that exposure of adult male rats to

50 Hz MFs for 90 days had a significant effecton the fertility of the exposed males.Ramadan et al. (2002) also reported thatexposure of fractionated doses of MFs (20mT) caused a significant decrease in spermcount, motility, and daily sperm production inmice. Recently, Lee et al. (2004) reported thatcontinuous exposure to MF (60 Hz, 0.5 mT)for 8 weeks increased incidence of testicular

germ cell death and this finding resulted froman increased incidence of germ cell apoptosisin mice. The adverse effect of MF exposureon spermatogenesis and fertility observed inthe present study is consistent with theresults of above-mentioned investigators.

On the contrary, the results obtainedher did not agree with multigenerationreproductive toxicity study by Ryan et al .(1999) which found that continuous exposureof Spague-Dawley rats to 60 Hz MFs has nosignificant adverse effects on adultreproductive capacity, developing fetus, andneonatal development in rats. Lundsberg etal . (1995) reported that human sub-fertilitywas not associated with occupational 0.3 mTexposure on morphology, motility, and spermconcentration among males. Kowalczuk et al. (1995) also did not find dominant lethalmutation in the male germ cells of mice whenthey exposed to power frequency MFs at 10mT for the approximate period ofspermatogenesis. In addition, Heredia-Rojaset al. (2004) reported that 60 Hz and 2 mT MFexposure did not affect meiotic chromosomesand morphological characteristics of malegerm cells in mice. Recently, Chung et al .(2005) reported that exposure of Sprague-Dawley rats to a 60 Hz EMF at field strengthsof up to 500 mT from day 6 of gestation to day21 of lactation did not produce any detectablealterations in offspring spermatogenesis andfertility. Kim et al . , (2006) reported that,Sprague-Dawley rats were expose MFs at6.25 microT (8 h/day, 5 days/week) for 90days showed no significant toxicities. Theapparent discrepancy among the studiesmight be due to differences in animals used,exposure period and intensity, environmentalconditions.

In the present results, the quantitativeanalysis of seminiferous tubules showed asignificant decrease in spermatogenesis inthe mice exposed to MFs. Therefore, the

decrease in testis weight in the MF exposedmice observed in the present study might beassociated with an increased incidence ofgerm cell apoptosis. The above results agreewith those obtained by Lee et al . (2004). Theauthors reported a significant increase in thenumber of dead germ cells in certainseminiferous tubules of mice exposed to 0.1and 0.5 mT MF.

In the present work, the presence ofvacuoles in the cytoplasm of the Sertoli cellsof MFs exposed mice revealed the direct


8/12


damage of these cells. Russell and Griswold(1995) reported that this type of lesion is theearly morphological sign of testicular injury.Nevertheless, in the present result, this lesionwas not t he only change indicating Sertoli celldamage. Spermatogenic arrest together withother features, such as the damage inspermatocytes, spermatids and low amount ofsperms count were observed in seminiferous

tubules, suggesting that 10 mT AC or DC MFs e xhibits destructive effects on the germinalepithelium of the seminiferous tubules in thelast stages of spermatogenesis. However, theeffects of MFs on the germinal epithelium ofthe testis were completely abolished in thepresence of free radical scavenger vitamin C.

Morphologic changes in the sperm headshapes are also an indicator of damage (Raoet al . , 1991). Narra et al . (1996) reported thata dose of 1.5 T static MF for 30 minutesresulted in 15% significant reduction in thetesticular sperms count on the 16 th and 29 th days after exposure and increased the spermhead shape abnormalities.

The present investigation showed thatthe rate of sperm deformity was higher in thetestis of mice that exposed to 10 mT MFs thanthat of the control and the exposed groupsthat injected with vitamin C (groups C & D).The present results also showed decrease ofsperm number after exposure to 10 mT AC orDC MFs (groups E & F) while no change insperm number for 10 mT AC or DC MFsexposed groups and injected with vitamin C(groups C & D). These findings are consistentwith the data of Strzhizhovskii andMastriukova (1988) who examined the effectsof a 1.6 T static MF on spermatogenesis in

mice. The authors reported that thespermatogonia, spermatocytes, and spermatidcount dropped to 69.3%, 71.5%, and 54.7% ofthe control values, respectively, up to 17 daysafter a 3-hour exposure to the MF. In contrast,Withers et al. (1985) showed that nostatistically significant differences in spermhead counts between the control andexperimental group up to 56 days afterexposure to 0.3 T static MF for 66 hours.

An un ex pe ct ed fi nd in g in th e pr es en tstudy was the strong relation between theinjection of free radical scavenger (vitamin C)and abolish effects of MFs on VEGF level inthe testis. These results indicate that the

testes of mice that exposed to 10 mT AC orDC MFs exhibited significant low expressionof Erk1\2 and VEGF proteins and mRNA. Incontrast, the testes of mice that i.p. injectedwith vitamin C during exposure to the sameMFs intensity showed non significantdifference comparable with control. It can beconcluded that VEGF and Erk1/2, under MFsexposure, are involved in thespermatogenesis of mice via reactive oxygenspecies (ROS).

In the present investigation, the failureof the spermatogenesis of the testis underMFs exposure may be caused by lessactivation/expression of VEGF under activityof ROS in mice exposed to10 mT A.C or DCMFs; therefore the free radical scavengervitamin C were used to block the hazardeffect of MFs. This supports the hypothesisthat the effects of MFs are mediated by free

radicals. These results agree with severalreports which indicated that VEGF influencethe spermatogenesis (Korpelainen et al. , 1998; Marti and Risau, 1998; Young andNelson, 2000; Huminiecki et al. , 2001;LeCouter et al . , 2003).

For some time, VEGF has been knownto be present at a surprisingly highconcentration in semen, but its function therehas not been known (Shweiki, et al . , 1993;Brown et al . , 1995). Recently, Anand et al .,(2003) reported the presence of VEGF intesticular cells and high concentrations ofVEGF have been measured in semen althoughits role in male reproduction remains obscure.

Al so th ey de mo ns tr at ed th at se cr et io n ofVEGF by Leydig cells isolated from adult ratsand mice is exclusively stimulated by agonadotropin. VEGF production was mediatedby cAMP-dependent protein kinase A (PKA),signaling pathway. This pathway appears touse an Src-dependent signaling cascade thatconverges at the MEK 1/2 level, therebyproceeding through the Erk 1/2 signalingcascade to stimulate the expression of theVEGF gene and hence the protein.

The mechanisms responsible for theobserved effect are not known at this time;however, the studies of Shivers et al . (1987)

show that the blood-brain barrier is perturbedby magnetic resonance imaging procedures ina 0.15 T magnet. Given that a similar blood-barrier exists in the testis, it is possible thatperturbations in the blood testis barrier maybe responsible for the observed effects.

The histopathological features noticedin the present study suggest that MFs inducedindirect damage to mouse germinal cells andspermatogenesis through its action on theVEGF through releasing of ROS fromNAD(P)H oxidase. However, further studies inthis field are required to identify the preciseunderlying mechanisms.

It is currently believed that activation ofthe stress response occurs when extracellularsignals affect receptors in the plasmamembrane that this subsequently initiates thespecific signal transduction cascades involvedin regulating cell proliferation, differentiation,and metabolism. Each cascade is thought topass its message to the cell nucleus viaprotein kinase Erk1/2 that propagate andamplify the signal, with different moleculesactivating different pathways. The final step inactivation of gene expression requires theDNA-binding of specific transcription factors


9/12


to specific nucleotide sequences in thepromoter of the gene. Extracellular signalsthat affect transcription factor binding activityalso affect steps in this process (Waskiewiczand Cooper, 1995; Hopkin, 1997).

In conclusion, the present investigationindicated that low activation/expression ofVEGF in the testis of mice under the MFsleads to histopathological changes, downregulation of spermatogenesis and maycauses infertility through the Erk1\2 pathway

via ROS under MFs exposure. The presentresults demonstrated that testicular VEGFsynthesis is decreased after exposure to 10mT MF, while the free radical scavenger L-

As co rb ic ac id (vi ta min C) of fe rs pr ot ec t io nagainst deleterious effects of MFs toreproductive physiology. So that lowexpression of VEGF in the testis of exposedmice to MFs mice induces infertility,

suggesting a potential role for VEGF in theprocess of spermatogenesis.

REFERENCES: Abou -Zai d FA , Om ar KH , Sa lem EI , Al m- El deen AA ,

Bekhite. MM. 2006. Can man-made visible lightradiation affect the reproductive capacity ofmale mice? Egypt. J. Exp. Biol. (Zool.), 2: 81-89.

Adey WR. 19 97 . Envi ronm en ta l st re ss at th epsychophysiological and the molecular levels.

Ac ta Phys io l. Sc and. Su pp l. , 640: 176-179. Al -Akh ras MA, El be ti eha A, Hasan MK, Al -Oma ri I,

Darmani H, Albiss B. 2001. Effects of extremelylow frequency magnetic field on fertility of adultmale and female rats. Bioelectromagnetics, 22:340-4.

Al len SG , Bl ac kwel l RP , Chadwick PJ , Dr is co ll CM,Pearson H, Unsworth AJ. Whillock C. 1994.Review of occupational exposure to opticalradiation and electrical and magnetic fields withregard to the proposed CEC Physical AgentsDirective, Chilton, NRPB-R265, HMSO, London.

Anan d RJ , Pa us t HJ , Al tenpoh l K, Mukh opadhyay AK . 2003 . Regu la ti on of va sc ul ar en do thel ia lgrowth factor production by Leydig cells invitro: the role of protein kinase A and mitogen-activated protein kinase cascade. Biol. Reprod.,68(5): 1663-1673.

Bekhite MM. 2005. The induced magnetic fieldeffects on the embryonic development of mice.PhD. Thesis Zool. Dept. Tanta University.

Brown LF, Yeo KT, Berse B, Morgentaler A, DvorakHF, Rosen S. 1995. Vascular permeabilityfactor (vascular endothelial growth factor) isstrongly expressed in the normal male genitaltract and is present in substantial quantit iesin semen. Int. J. Urol., 154 (2 Pt 1): 576-579.

Chung MK. Lee SJ, Kim YB, P ark SC, Shin DH, KimSH, Kim JC. 2005. Evaluation ofspermatogenesis and fertility in F1 male ratsafter in utero and neonatal exposure toextremely low frequency electromagnetic fields.

As ia n J. Androl ., 7: 189-194.De Vita R, Cavallo D, Raganella L, Eleuteri P,

Grollino MG, Calugi A. 1995. Effects of 50 Hzmagnetic fields on mouse spermatogenesismonitored by flow cytometric analysis.Bioelectromagnetics, 16: 330-4.

Ergün S, Kiliç N, Fiedle W, Mukhopadhyay AK.1997. Vascular endothelial growth factor and itsreceptors in normal human testicular tissue.Mol. Cell. Endocrinol., 131(1): 9-20.

Ergün S, Luttmer W, Fiedler W, Holstein AF. 1998.Functional expression and localization of vascularendothelial growth factor and its receptors in thehuman epididymis. Biol. R epro d . , 58:160–168.

Ferrara N, Jakeman K, Leung D. 1992. Molecularand biological properties of the vascularendothelial growth factor family of proteins.Endocrinol. Rev., 13: 18-32.

Feychting M, Forssen U. 2006. Electromagneticfields and female breast cancer. Cancer CauseControl, 17 (4):553-558.

Furuya H, Aikawa H, Hagino T, Yoshida T, SakabeK. (1998): Flow cytometric analysis of theeffects of 50 Hz magnetic fields on mousespermatogenesis. Nippon. Eiseigaku. Zasshi.,

53: 420-425.Gura T. 1997. How TRAIL kills cancer cells, but not

normal cells. Science, 277(5327): 768.Heredia-Rojas JA, Caballero-Hernandez DE,

Rodriguez-de la Fuente AO, Ramos-Alfano G,Rodriguez-Flores LE. 2004. Lack of alterationson meiotic chromosomes and morphologicalcharacteristics of male germ cells in miceexposed to a 60 Hz and 2.0 mT magnetic field.Bioelectromagnetics, 25: 63-68.

Hong R, Liu Y, Yu YM, Hu K, Weng EQ. 2003.Effects of extremely low frequencyelectromagnetic fields on male reproduction inmice. Zhonghua Lao Dong Wei Sheng Zhi YeBing Za Zhi, 21(5):342-345.

Hopkin K. 1997. How and where might signaltransduction cascades intersect? J. NIH. Res.,9: 25–27.

Huminiecki L, Chan HY, Lui S, Poulsom R, StampG, Harris AL, Bicknell R. 2001. Vascularendothelial growth factor transgenic miceexhibit reduced male fertility and placentalrejection. Mol. Hum. Reprod., 3: 255-264.

Irgens A, Kruger K, Skorve AH. 1997. Maleproportion in offspring of parents exposed tostrong static and extremely low-frequencyelectromagnetic fields in Norway. Am. J. Ind.Med., 32: 557–561.

Kastan M. 1997. On the TRAIL from p53 toapoptosis? Nat. Genet., 17(2): 130-131.

Keck PJ, Hauser SD, Krivi G, Sanzo K, Warren T,Feder J, Connolly DT. 1989. Vascularpermeability factor, an endothelial cell mitogenrelated to PDGF. Science, 246(4935): 1309-1312.

Kheifets L, Ahdelmonem A, Afifi A, Buffler P, Zhang A, Ma tk in C. 1997 . Oc cu pati onal el ec tr ic andmagnetic field exposure and leukaemia: a m eta-analysis. Occup. Environ. Med., 39: 1074-1091.

Kim SH, Lee HJ, Choi SY, Gimm Y M, Pack JK, ChoiHD, Lee YS. 2006. Toxicity bioassay inSprague-Dawley rats exposed to 20 kHztriangular magnetic field for 90 days.Bioelectromagnetics, 27(2):105-111.


10/12


Koana T, Okada MO, Ikehata M, Nakagawa M. 1997.Increase in the mitotic recombination frequencyin Drosophila melanogaster by magnetic fieldexposure and its suppression by vitamin Esupplement. Mutat Res., 373(1): 55-60.

Korpelainen EI, Karkkainen MJ, Tenhunen A, LaksoM, Rauvala H, Vierula M, Parvinen M, Alitalo K.1998. Overexpression of VEGF in testis andepididymis causes infertility in transgenic mice:evidence for nonendothelial targets for VEGF.

J. Cell Biol., 143(6): 1705-1712.Kowalczuk CI, Robbins L, Thomas JM, Saunders

RD. 1995. Dominant lethal studies in male m iceafter exposure to a 50 Hz magnetic field. Mutat.Res., 328: 229-237.

LeCouter J, Lin R, Tejada M, Frantz G, Peale F,Hillian KJ, Ferrara N. 2003. The endocrine-gland-derived VEGF homologue Bv8 promotesangiogenesis in the testis: localization of Bv8receptors to endothelial cells. PNAS., 100:2685–2690.

Lee HJ, Kim SH, Choi SY, Gimm YM, Pack JK, ChoiHD, Lee YS 2006 Long-term exposure of SpragueDawley rats to 20 kHz triangular magnetic fields.Int. J. Radiat. Biol., 82 (4): 285-91.

Lee JS, Ahn SS, Jung KC, Kim YW, Lee SK. 2004.Effects of 60 Hz electromagnetic field exposureon testicular germ cell apoptosis in mice. AsianJ. Androl., 6: 29-34.

Lin, H.; Goodman, R. and Shirley-Henderson, A.(1994): Specific region of the c-myc promoter isresponsive to electric and magnetic fields. J.Cell Biochem., 54(3): 281-288.

Lundsberg LS, Bracken MB, Belanger K. 1995.Occupationally related magnetic field exposureand male subfertility. Fertil. Steril., 63: 384-91.

Marti H. H. and Risau W 1998 Systemic hypoxiachanges the organ-specific distribution ofvascular endothelial growth factor and itsreceptors. Proc Nat. Acad. Sci. USA, 95(26):15809-15814.

Miller AB, To T, Agnew DA, Wall C, Green LM.1996. Leukemia following occupationalexposure to 60-Hz electric and magnetic fieldsamong Ontario electric utility workers. Am. J.Epidemiol., 144: 150-160.

Narra VR, Howell RW, Goddu SM, Rao DV. 1996.Effects of a 1.5-Tesla static magnetic field onspermatogenesis and embryogenesis in mice.Invest. Radiol., 31(9): 586-590.

Nagata S. 1997. Apoptosis and diseases. NipponNaika Gakkai Zasshi, 86(9): 1579-1583.

Rao DV, Narra VR, Howell RW, Lanka VK, SastryKS. 1991. Induction of sperm headabnormalities by incorporated radionuclides:dependence on subcellular distribution, type ofradiation, dose rate, and presence ofradioprotectors. Radiat. Res., 125(1): 89-97.

Reed JC. 1997. Bcl-2 family proteins: regulators ofapoptosis and chemoresistance in hematologicmalignancies. Semin. Hematol., 34 (4 Suppl. 5):9-19.

Ramadan LA, Abd-Allah AR, Aly HA, Saad-el-Din AA . (200 2) : Test ic ul ar toxi ci ty ef fe ct s ofmagnetic field exposure and prophylactic role ofcoenzyme Q10 and L-carnitine in mice.Pharmacol. Res., 46: 363-370.

Russell L., Griswold M. 1995. Sertoli cell toxicants.The Sertoli cell. Clearwater: Cache. River.,

551-575.Ryan BM, Symanski RR, Pomeranz LE, Johnson

TR, Gauger JR, McCormick DL. 1999.Multigeneration reproductive toxicityassessment of 60-Hz magnetic fields using acontinuous breeding protocol in rats.Teratology, 59: 156-62.

Saadat M. 2005. Offspring sex ratio in men exposedto electromagnetic fields. J. Epid. Com. Health.,59: 339-342.

Shivers RR, Kavaliers M, Teskey GC, Prato FS,Pelletier R-M. 1987. Magnetic resonanceimaging temporarily alters blood-brain barrierpermeability in the rat. Neurosci Lett., 76: 25-31.

Shweiki D, Itin A, Neufeld G, Gitay-Goren H, KeshetE. 1993. Patterns of expression of vascularendothelial growth factor (VEGF) and VEGFreceptors in mice suggest a role in hormonallyregulated angiogenesis. J. Clin. Invest., 91:2235–2243.

Sienkiewicz ZJ, Saunders RD, And Kowalczuk CI.1991. Biological effects of exposure to non-ionising electromagnetic fields and radiation.Extremely low frequency electric and magneticfields, Chilton, NRPB-R239, HMSO, London.

Simko M, Kriehuber R, Weiss DG, Luben RA. 1998.Effects of 50 Hz EMF exposure on micronucleusformation and apoptosis in transformed andnontransformed human cell lines.Bioelectromagnetics, 19: 85-91.

Singh N, Lai H. 1998. 60 Hz magnetic fieldexposure induces DNA crosslinks in rat braincells. Mutat. Res., 400(1-2): 313-20.

Stavroulakis, P. 2003. Biological Effects ofElectromagnetic Fields. Springer-Verlag, Berlin,Heidlberg, Germany.

Strzhizhovskii AD, Mastriukova VM. 1988. Cellularcomposition of the spermatogenic epithelium inmice during and after exposure to permanentmagnetic fields of various durations. Izv AkadNauk SSSR Biol., 1: 91-7.

van Zijl PC, Jones CK, Ren J, Malloy CR, Sherry AD. 20 07. MRI de te ct io n of glycogen in vivo byusing chemical exchange saturation transferimaging (glycoCEST). Proc. Nat. Acad. Sci.USA, 104 (11): 4359-4364.

Wang SM, Wang DW, Peng RY. 2003. Effect ofelectromagnetic pulse irradiation on micereproduction. Zhonghua Lao Dong Wei ShengZhi Ye Bing Za Zhi., 21: 329–331.

Waskiewicz AJ, Cooper JA. 1995. Mitogen andstress response pathways: MAP kinasecascades and phosphatase regulation inmammals and yeast. Curr. Opin. Cell. Biol., 7:798-805.

Withers HR, Mason KA, Davis CA. 1985 MR effect

on murine spermatogenesis. Radiology, 156:741-742.WHO. 1987. Environmental Health Criteria 69:

Magnetic fields. Geneva.Yoshikawa T, Tanigawa M, Tanigawa T, Imai A,

Hongo H, Kondo M. 2000 Enhancement of nitricoxide generation by low frequencyelectromagnetic field. Pathophysiology, 7(2):131-135.

Young KA, Nelson RJ. 2000. Short photoperiodsreduce vascular endothelial growth factor in thetestes of Peromyscus leucopus . Am. J. Physiol.Reg. Int. Comp. Physiol., 279: 1132–1137.


11/12


Sinha P, Navin K, Ambasht, Jiweshwar P, DonatPH. 2002. Wavelength-dependent induction ofa mycosporine like amino acid in rice- fieldcyanobacterium. role of inhibitor and saltstress. Photochem. Photobiol. sci . , 2: 171-176.

Straaten H, Weber KL, Kiefer J. 1992. Proteinsynthesis in irradiated cells 1- Ultravioletradiation. Radiat. Res., 129(2): 177-183.

Tan KK, Epton HAS. 1973. Effect of l ight ongrowth and sporulation of Botrytis cinerea .Trans. Brit . Myco. Soc., 61: 146-157.

Valadon LRG. Mummery RS. 1971. Effect of l ighton nucleic acids, protein and carotenoid ofVerticil l ium agaricinum . Microbios, 4: 227-240 .

Vincent WF, Roy S. 1993. Solar ultraviolet-B radiationand aquatic primary production damage,protection, and recovery. Environ. Rev., 1: 1-12.

Yehoshua BS. 2003. Effects of postharvest heat andUV application on decay, chilling injury andresistance against pathogens of citrus and otherfruits and vegetables. Acta. Hort., 599: 159-170.

Yuridia MF, Rodriguez CH, Herrera JR, TanacaLV. 2003. Proteinases and exopeptidases fromthe Phytopathogenic fungus Ustilago maydis .Mycologia, 95(2): 327-339.

ن 10ة ر و لVEGF ع د و ر و و ،C

ح ح آ ا ن ا ا

ت ا ة ا ة ا ا ا آ ت ارةِ ل ا ار ةِ ّ تِ ا إ ا ا

ت َ ا لِ ى اا ا ُ ّ

لا و ا ن ء و اا و ط ا . ا ا رف اآن ا ة ار به ه ا ا ا

ِ ل ا ةِ ر ِت ا ا انِ ا .ا ا د و أ ت ه ار

نِ ى َآ ِ ا ا ز نِ ا ز وآ ِ ن ا ذ ل إ ّ ا ا ا

َ دل( 10 ه ل8ة) ا 6ِت أد ا اِ ة ت زد آ و

ن ا اا ا ا آن ذ وا ات ا و د لو سةأ و ؤ ر

ذ ة ذ.ا ات اِل و حود ة ه ت ا ا زد ا ا

ل ا ن .ا ا ض ا ا

و آ د ا ط ا

VEGF) vascular endothelial growth)ا اfactorضِ إ را ّ ل ا ا

ا ا ا.ا آ ا

ط ا (RT-PCR) ا ة ا VEGF.ن 100حآ أ ت ا اµm ض ء ةِ ا ّ َأ

تَ را ا ال ا اد ا ةِ ر ت ا ا ة ا ا ن ه ا أ

VEGF.ل ا ا ا ا ا ط ه ن VEGF ا ا ل

نِ حل ا ا ِ ا ا أى ت إ ا ا ا ا د ا

ح ا ات ا ا و .ا

: ح نح ا..أ ن ح ة أ ا ا

د أ ز ..أ ا ا ا


12/12


effect of 10 mt magnetic fields exposure on testicular germ cells,

Documents