5194

Effects of acute heat stress on gene expression of brain–gut neuropeptides in broiler chickens1

L. Lei,*2 L. Hepeng,*2 L. Xianlei,* J. Hongchao,* L. Hai,* A. Sheikhahmadi,† W. Yufeng,‡ and S. Zhigang*3

*Department of Animal Science and Technology, Shandong Agricultural University, Taian, Shandong 271018, China; †Department of Animal Science, Faculty of Agriculture, University of Kurdistan, Sanandaj 66177-15175, Iran; and ‡Division

Livestock–Nutrition–Quality, Department of Biosystems, KU Leuven, Kasteelpark Arenberg 30, 3001 Leuven, Belgium

ABSTRACT: Heat stress–induced reduction in feed intake is an annoyance of the poultry industry. Feed intake is regulated by complex mechanisms in which brain–gut neuropeptides are involved, but the changes in such neuropeptides in broiler chickens during heat expo-sure remain unclear. In this study, we investigated the effects of acute heat stress (35°C, 6 h, and 65% relative humidity) on the gene expression of appetite-regulating peptides in the hypothalamus and gastrointestinal tract of broiler chickens at 42 d of age. The hypothalamic mRNA levels of neuropeptide Y, agouti-related peptide, pro-opiomelanocortin, cocaine- and amphetamine-regu-lated transcript, corticotropin-releasing hormone, mela-nocortin 4 receptor, melanin-concentrating hormone,

prepro-orexin, cholecystokinin (CCK), and ghrelin did not significantly change (P > 0.05) in the heat-exposed broiler chickens. However, the mRNA levels of ghrelin in the glandular stomach, duodenum, and jejunum sig-nificantly increased and the mRNA level of CCK in the duodenum significantly decreased. The results indicate that acute heat stress had no effect on the gene expres-sion of central appetite-regulating peptides under cur-rent experimental conditions; however, some gastroin-testinal tract peptides (e.g., ghrelin and CCK) might play a role in the regulation of appetite in acute heat–exposed broiler chickens. Furthermore, ghrelin in the glandular stomach, duodenum, and jejunum might be the main regulative target of acute heat stress induced anorexia.

Key words: acute heat stress, brain–gut neuropeptides, broiler chicken, feed intake

© 2013 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2013.91:5194–5201 doi:10.2527/jas2013-6538

INTRODUCTION

Heat stress results in reductions in feed intake, growth rate, feed efficiency, and carcass quality in broiler chickens (Temim et al., 2000), which lead to severely detrimental effects on poultry production. The adverse effects of heat stress on the growth rate of broiler chickens are partly caused by the direct effects of heat-induced decrease in feed intake as well as the associated metabolic and endocrine responses (Lin et al., 2004). The control and regulation of voluntary food intake in avian species are very complex, involving the

brain–gut axis as well as hormonal and nonhormonal factors acting through integration by the hypothalamus. The net result of feed (energy) intake and energy ex-penditure establishes the energy balance in animals.

Maintaining energy homeostasis is crucial for broiler survival (Kuenzel et al., 1999). The intrinsic crosstalk between the hypothalamus and the gastro-intestinal tract of broiler chickens ensures that energy balance is maintained by neuropeptides. Two primary populations of neurons integrating peripheral signals of nutritional status and influencing appetite through the release of signaling molecules exist in the hypo-thalamus of avian species: orexigenic neuropeptides [e.g., neuropeptide Y (NPY) and agouti-related pep-tide (AgRP)] (Takeuchi et al., 2000; Ando et al., 2001) and anorexigenic neuropeptides [e.g., pro-opiomelano-cortin (POMC), cocaine- and amphetamine-regulated transcript (CART), corticotropin-releasing hormone

1This work was supported by National Natural Science Foundation of China (31172226 and 31072045).

2These authors contributed the same to this work.3Corresponding author: zhigangs@sdau.edu.cnReceived April 2, 2013.Accepted July 29, 2013.

Published November 24, 2014

Acute heat stress and brain–gut neuropeptides 5195

(CRH), cholecystokinin (CCK), and ghrelin] (Richards, 2003; Furuse et al., 1997). Ghrelin and CCK are widely distributed in the gastrointestinal tract and are essential to feed intake regulation in broilers and layers (Richards, 2003; Kaiya et al., 2009).

We previously found that long-term heat exposure altered the gene expression of brain–gut neuropeptides in laying hens (Song et al., 2012). In broiler production, especially in summer or winter, to maintain the constant indoor temperature is very difficult and remains a big challenge to modern intensive raising system. Fluc-tuations in temperature, which warrant further research, generally trigger sudden (acute) heat stress.

Information on the neuroendocrine mechanism un-derlying the effects of acute heat stress on feed intake regulatory peptides in broiler chickens remains scarce. Six-week-old broiler chickens were used in the present experiment, which are vulnerable to exotic challenges including heat stress. The objective of this study was to investigate the effects of acute heat exposure on the gene expression of feed intake regulatory neuropeptides in the hypothalamus and gastrointestinal tract of broiler chickens.

MATERIALS AND METHODS

The study was approved by the Shandong Agri-cultural University (Taian, Shandong, China) and performed in accordance with the “Guidelines for Ex-perimental Animals” of the Ministry of Science and Technology (Beijing, China).

Animals, Experimental Protocol, and Sample Col-lection

One-day-old male Arbor Acres broiler chickens (Gallus gallus domesticus) were obtained from a lo-cal hatchery (35-wk-old broiler breeder) and reared in an environmentally controlled room. The brood-ing temperature was maintained at 35°C (65% rela-tive humidity) for the first 2 d, decreased gradually to 21°C (45% relative humidity) until day 28, and there-after maintained at such temperature until the begin-ning of the experiment (day 42). A 23-h light/1-h dark photoperiod was observed. All chickens received a starter diet composed of 21.5% crude protein and 12.37 MJ/kg metabolizable energy until day 21, after which they received a grower diet containing 19.5% crude protein and 12.90 MJ/kg metabolizable energy (Zhao et al., 2009). All birds had free access to feed and water during the rearing period. At 42 d of age, 32 broiler chickens with similar body weights (2.27 ± 0.20 kg) were selected and evenly distributed in 8 pens with 4 birds. Four pens were exposed to high

ambient temperature (35 ± 1.5°C for 6 h) and the oth-er 4 pens were exposed to normal temperature (20 ± 2°C for 6 h). Feed intake was calculated (n = 4 pens per treatment).

Two chickens were selected from each pen (n = 8 per treatment) at the end of the experiment. Blood samples were drawn from their wing vein using a hep-arinized syringe within 30 s and placed in iced tubes. Plasma was obtained after centrifugation at 400 × g for 10 min at 4°C and stored at –20°C for further analysis of glucose, triiodothyronine (T3), triglycer-ide (TG), and uric acid (UA) levels. Immediately af-ter the blood samples were obtained, the birds were sacrificed according to Close et al. (1997) and tis-sue samples of the hypothalamus, glandular stomach, duodenum, jejunum, and ileum were collected. After snap freezing in liquid nitrogen, the tissue samples were stored at –80°C for RNA extraction. The hypo-thalamus was dissected from the ventral surface of the brain. The hypothalamus was dissected from the ventral surface of the brain. Two transverse cuts were made at the apex of the optic chiasm and the rostral margin of the mammillary bodies. Next, 2-mm bilat-eral cuts were made on either side of the midline and the whole hypothalamus was removed according to the chicken brain atlas (Puelles et al., 2007) and Yuan et al. (2009). The cut was 4 to 5 mm deep parallel to the base of the brain (Higgins et al., 2010). Samples of the whole intestinal tract were removed after con-tents of the gut flushed and removed with saline, and about 0.5 cm segments were taken from the midpoint of the glandular stomach, the midpoint of the duode-num (duodenum), the midpoint between the bile duct entry and Meckel’s diverticulum (jejunum), and the midpoint between Meckel’s diverticulum and the il-eocecal junction (ileum; Awad et al., 2006).

Plasma Metabolites and Hormone Levels

Plasma concentrations of glucose (F006; intra-assay coefficient of variation = 2.3%), UA (C012; intra-assay coefficient of variation = 3%), TG (F001-1; intra-assay coefficient of variation = 2.9%), and T3 (GS-E60005; intra-assay coefficient of variation = 2.9%) were measured spectrophotometrically using commercial diagnostic kits (Jiancheng Bioengineer-ing Institute, Nanjing, China).

Ribonucleic Acid Isolation and Analysis

Expression of genes in the hypothalamus was quantified using quantitative real-time PCR with SYBR Green I labeling. Total RNA was isolated by the guanidinium isothiocyanate method with Trizol

Lei et al.5196

reagent (Invitrogen, San Diego, CA). The quality of RNA after deoxyribonuclease treatment was tested by electrophoresis on agarose gel, and the quantity of RNA was determined using a biophotometer (Eppen-dorf, Germany).

Reverse transcription reactions (10 μL) consisted of 500 ng of total RNA, 5 mmol/L MgCl2, 1 μL of RT buffer, 1 mmol/L deoxyribonucleoside triphosphate, 2.5 U of avian myeloblastosis virus, 0.7 nmol/L oligo d(T), and 10 U of ribonuclease inhibitors (TaKaRa Biotechnology, Co., Ltd., Dalian, China). Real-time PCR analysis was conducted using Applied Biosys-tems 7500 Real-time PCR System (Applied Biosys-tems, Foster, CA). Each RT reaction served as a tem-plate in a 20-μL PCR containing 0.2 μmol/L concen-tration of each primer and SYBR Green Master Mix (Takara Biotechnology, Co., Ltd.). The primer set sequences are listed in Table 1. Real-time PCRs were performed at 95°C for 10 s followed by 40 cycles at 95°C for 5 s and 60°C for 40 s. Synergy brands green fluorescence was detected at the end of each cycle to monitor the amount of PCR products. A stan-dard curve was plotted to determine the fold dilutions when calculating the efficiency of real-time quantita-tive PCR primers.

The relative amount of mRNA of a gene was cal-culated according to the method described by Livak and Schmittgen (2001). The mRNA levels of the genes were normalized to glyceraldehyde 3-phosphate de-hydrogenase (GAPDH) levels (ΔCT). The ΔCT was calibrated against an average of the control chickens. The linear amount of target molecules relative to the calibrator was calculated by 2–ΔΔCT. Therefore, all gene transcription results were reported as the n-fold difference relative to the calibrator. The specificity of the amplification products was verified.

Statistical Analysis

The experiment was conducted using a completely randomized design with 2 treatments, 4 replicates per treatment, and 4 chickens per replicate. Data were ex-pressed as mean ± SEM. Homogeneity of variances among the treatments was confirmed using Bartlett’s test. All data were subjected to one-way ANOVA to test the main effect of the treatment. For feed intake analysis, n = 4 per treatment, for plasma parameter analysis, n = 8 per treatment, and for peptide mRNA analysis, n = 8 per treatment. Duncan’s multiple-range analysis was used to compare differences be-tween significant means. Differences were considered significant if P < 0.05.

RESULTS

Performance, Plasma Metabolites, and Hormone LevelsAcute heat exposure significantly increased plas-

ma glucose (P < 0.05) but had no significant effect on plasma T3, UA, and TG (P > 0.05; Fig. 1A and 1B). It significantly decreased feed intake (P < 0.05; Fig. 1C).

Expression of Feed Intake Regulatory Peptides in the Hypothalamus

Acute heat stress showed no significant effect on the gene expressions of NPY, AgRP, POMC, CART, ghrelin, CCK, CRH, melanocortin 4 receptor (MC4R), melanin-concentrating hormone (MCH), and orexin in the hypothalamus of broiler chickens (P > 0.05; Fig. 2).

Expression of Feed Intake Regulatory Peptides in the Gastrointestinal Tract

Acute high ambient temperature significantly in-creased the mRNA levels of ghrelin in the glandular stomach (1.7-fold of control), duodenum (2-fold of con-trol), and jejunum (1.9-fold of control; P < 0.05; Fig. 3A,

Table 1. Gene-specific primers used for gene expres-sion analysis Gene1

GenBank accession no.

Primer sequences (5′-3′)

Product size (bp)

GAPDH NM_204305 F: ACATGGCATCCAAGGAGTGAGR: GGGGAGACAGAAGGGAACAGA

266

NPY M87294 F: TGCTGACTTTCGCCTTGTCGR: GTGATGAGGTTGATGTAGTGCC

148

AgRP NM_001031457 F: GGAACCGCAGGCATTGTCR: GTAGCAGAAGGCGTTGAAGAA

163

CRH NM_001123031 F: CTCCCTGGACCTGACTTTCCR: TGTTGCTGTGGGCTTGCT

86

Ghrelin AB075215 F: CCTTGGGACAGAAACTGCTCR: CACCAATTTCAAAAGGAACG

203

POMC NM_001031098 F: CGCTACGGCGGCTTCAR: TCTTGTAGGCGCTTTTGACGAT

88

CART BI394769 F: CCGCACTACGAGAAGAAGR: AGGCACTTGAGAAGAAAGG

146

CCK NM_001001741 F: CAGCAGAGCCTGACAGAACCR: AGAGAACCTCCCAGTGGAACC

121

MCR4 NM_001031514 F: ACACTCCAGCCTCTCCATTTCTR: TGTTCATAGCAGCCTCCCGA

101

MCH NM_001195795 F: AAGAGAGGAGCGATGCCTTR: TTTCTGCCCACACTGATTGG

146

Prepro- orexin

AB056748 F: AGGAGCACGCTGAGAAGGAR: TGCGGGCTACCGTTTATTGT

183

1AgRP = agouti-related peptide; CART = cocaine- and amphetamine-regulated transcript; CCK = cholecystokinin; CRH = corticotropin-releasing hormone; GAPDH = glyceraldehyde 3-phosphate dehydrogenase; MCH = melanin-concentrating hormone; MCR4 = melanocortin 4 receptor; NPY = neuropeptide Y; POMC = pro-opiomelanocortin.

Acute heat stress and brain–gut neuropeptides 5197

3B, and 3C) but significantly decreased the mRNA level of CCK in the duodenum (0.7-fold of control; P < 0.05; Fig. 3B). Ghrelin in the ileum as well as CCK in the jeju-num (Fig. 3C) and ileum (Fig. 3D) was not significantly affected by the stress (P > 0.05).

DISCUSSION

Effects of Acute Heat Stress on Feed Intake and Plasma Parameters of Broiler Chickens

Research has demonstrated that heat stress suppress-es the feeding behavior of broiler chickens (May et al., 1986). Reduced feed intake in broiler chickens has been accepted as a classic marker of heat stress. In the pres-ent study, exposing broiler chickens to 35°C reduced their feed intake. Research has also suggested that feed intake suppression triggers an instant physiological response, namely flight or fight, during an acute stress period (Hicks

et al., 1998). However, chronic stress typically results in a craving for and consumption of energy-dense foods and not suppressed feeding behavior (Oliver et al., 2000).

Short-term exposure of broiler chickens to extreme temperatures triggers a rapid and extensive response. The increased plasma glucose in the current study was not consistent with our previous studies (Lin et al., 2004; Song et al., 2012) showing that heat treatment did not significantly change its concentrations. The duration and severity of heat stress programs should be considered to account for the apparent discrepancies between these studies.

At high ambient temperature conditions, birds need to reduce their internal heat production to maintain their body temperature by decreasing their basal metabolic rate. Thyroid hormones play a key role in the regula-tion of metabolic rate in birds (Renden et al., 1994). In this study, no significant change was observed in the level of plasma T3 (the active form of the thyroid hor-mones; Fig. 1B). One study reported that chronic heat

Figure 1. Effects of acute heat stress treatment on feed intake as well as plasma concentrations of glucose (10 mmol/L) and triglyceride (TG; 1 mmol/L) (A), plasma concentrations of uric acid (UA; 100 mg/L) and triiodothyronine (T3; 10 pmol/L) (B), and feed intake (1 g/bird) (C) in broiler chickens. Values indicate mean ± SEM (for feed intake analysis, n = 4 per treatment; for plasma parameter analysis, n = 8 per treatment). Different superscripts indicate significant differences (P < 0.05) in the means as determined by ANOVA.

Lei et al.5198

stress markedly depressed the activity of the thyrotro-phic axis in layers as reflected by reduced plasma T3 concentration (Decuypere and Kuhn, 1988). Howev-er, other studies have reported that acute exposure of growing chickens to elevated temperature (35–41°C) did not consistently appear to affect serum T3 and tet-raiodothyronine (T4) concentrations (May et al., 1986; Bowen and Washburn, 1985).

Effects of Acute Heat Stress on Gene Expression of Neuropeptides in the Hypothalamus of Broiler Chickens

Stress can induce a series of physiological responses related to the mobilization of energy stores and redistri-bution toward inhibitory functions, such as growth, in favor of the maintenance of homeostasis and survival (Lin et al., 2006). Research has demonstrated that the

Figure 2. Effects of heat stress treatment on the mRNA levels of neuropeptide Y (NPY) and agouti-related peptide (AgRP) (A), melanin-concentrating hormone (MCH) and prepro-orexin (B), pro-opiomelanocortin (POMC) and cocaine- and amphetamine-regulated transcript (CART) (C), and ghrelin and chole-cystokinin (CCK) (D) as well as corticotropin-releasing hormone (CRH) and melanocortin 4 receptor (MCR4) (E) in the hypothalamus of broiler chickens. alues indicate mean ± SEM (n = 8 per treatment). Different superscripts indicate significant differences (P < 0.05) in the means as determined by ANOVA.

Acute heat stress and brain–gut neuropeptides 5199

balance between feed intake and energy expenditure in birds is regulated by the central nervous system. The hy-pothalamus is a portion of the central nervous system that was first determined to be involved in the control of feed intake and energy homeostasis more than 50 yr ago. Recent research has shown that specific neuronal circuits within different regions of the hypothalamus are involved in the control of feed intake and energy homeo-stasis in poultry through the release of neuropeptides, such as NPY, AgRP, POMC, CART, CRH, ghrelin, CCK, and MCH (Richards and Proszkowiec-Weglarz, 2007).

This study investigated for the first time the effects of exposing broiler chickens to acute heat stress on the gene expression of hypothalamic neuropeptides. The re-sults showed that acute heat stress could not alter the gene expression of feed intake regulatory peptides andMC4R in the hypothalamus (Fig. 2). In our previous study on laying hens, long-term heat exposure (7 d) increased the mRNA levels of the hypothalamic ghrelin and CART

and decreased that of CCK (Song et al., 2012). The de-creased feed intake and the unchanged gene expression of appetite regulation neuropeptides seemed confusing in the current research. However, this did not mean there was no significant change on protein levels of the neuro-peptides, which were the active form of the correspond-ing molecular. Restraint stress induced food suppres-sion in rats was accompanied with an elevation of NPY levels in the paraventricular nucleus but no difference in hypothalamic NPY mRNA expression (Rybkin et al., 1997). For technical limitation, the central concentra-tion of these peptides was not determined in the present research. In other words, the current results indicated that the central appetite regulation of acute heat stress might be on the posttranscriptional levels rather than the transcriptional levels, which needs further investigation. Another possibility was that under acute heat exposure the chickens spent more time on fighting against the heat increment than feeding, which led to the reduced feed

Figure 3. Effects of acute heat stress treatment on the mRNA levels of ghrelin and cholecystokinin (CCK) in the glandular stomach (A), duodenum (B), jejunum (C), and ileum (D) of broiler chickens. Values indicate mean ± SEM (n = 8 per treatment). Different superscripts indicate significant differences (P < 0.05) in the means as determined by ANOVA.

Lei et al.5200

intake with unchanged gene expression of the appetite regulation neuropeptides in the hypothalamus. Again, this hypothesis needs more behavior data to be verified.

Effects of Acute Heat Stress on Gene Expression of Neuropeptides in the Gastrointestinal Tract of Broiler Chickens

Research has demonstrated that signals mediated by CCK and ghrelin secretion in the gastrointestinal tract transmit to the hypothalamus, leading to reduced feed intake in poultry (Richards, 2003). Furthermore, admin-istration of exogenous CCK both peripherally (Savory and Gentle, 1980) and centrally (Denbow and Myers, 1982) has been reported to reduce the feed intake of chickens. In the present study, the decreased mRNA lev-el of CCK by heat in the duodenum was in accordance with previous studies in mice and laying hens (Song et al., 2012; Cao et al., 2005). Secretion of CCK by the duodenal mucosa is stimulated by fat- or protein-rich chyme; hence, downregulation of intestinal CCK gene expression in acute heat-exposed broiler chickens might be due to retarded stimulation of the chymus caused by the reduction in feed intake. Therefore, peripheral CCK might be responsible for the anorexia of broiler chickens induced by acute heat stress.

Our results showed that the mRNA levels of ghrelin increased rapidly in the glandular stomach, duodenum, and jejunum of broiler chickens after acute heat stress (Fig. 3). Many studies have revealed that the newly pu-rified peptide ghrelin (Kojima et al., 1999) stimulates feeding in rats (Wren et al., 2000). However, Furuse et al. (2001) reported that ghrelin strongly inhibited the feed intake of chickens. Saito et al. (2005) found that the effect of ghrelin on the feed intake of neonatal chicks is inhibitory when injected intracerebroventricularly. In addition, peripheral injection of ghrelin in birds has an anorexigenic impact on feed intake (Kaiya et al., 2009). Research has suggested that ghrelin is involved in the regulation of short-term feeding behavior (Kaiya et al., 2011). The proventriculus (glandular stomach) has been reported to be the major site of ghrelin biosynthesis and secretion in chickens (Richards et al., 2006). Further-more, numerous studies have shown that the gastroin-testinal tract is influenced by stress (Mayer, 2000). The present results of increased ghrelin expression were well consistent with our previous findings in laying hens (Song et al., 2012). The anorexigenic effects of acute high ambient temperature (short term and long term) in chickens are seemingly mediated by the activation of peripheral ghrelin secretion.

In summary, this study explored the possible effects of short-term heat stress exposure on feed intake regulatory peptides in the hypothalamus and gastrointestinal tract of

broiler chickens. The results indicate that some gastroin-testinal tract peptides (e.g., ghrelin and CCK) might play a role in the regulation of appetite in acute heat-exposed broiler chickens and that, notably, ghrelin in the glandular stomach, duodenum, and jejunum might be the main regu-lative target of acute heat stress induced anorexia.

LITERATURE CITEDAndo, R., S. I. Kawakami, T. Bungo, A. Ohgushi, T. Takagi, D. M.

Denbow, and M. Furuse. 2001. Feeding responses for several neuropeptide Y receptor agonists in the neonatal chick. Eur. J. Pharmacol. 427:53–59.

Awad, W. A., J. Böhm, E. Razzazi-Fazeli, K. Ghareeb, and J. Zentek. 2006. Effect of addition of a probiotic microorganism to broiler diets contaminated with deoxynivalenolon performance and histological alterations of histological alterations of intestinal villi of broiler chickens. Poult. Sci. 85:974–979.

Bowen, S. J., and K. W. Washburn. 1985. Thyroid and adrenal re-sponse to heat stress in chickens and quail differing in heat tol-erance. Poult. Sci. 64:149–154.

Cao, S. G., W. C. Wu, Z. Han, and M. Y. Wang. 2005. Effects of psy-chological stress on small intestinal motility and expression of cholecystokinin and vasoactive intestinal polypeptide in plasma and small intestine in mice. World J. Gastroenterol. 11:737–740.

Close, B., K. Banister, V. Baumans, E. M. Bernoth, N. Bromage, J. Bunyan, W. Erhardt, P. Flecknell, N. Gregory, H. Hackbarth, D. Morton, and C. Warwick. 1997. Recommendations for eutha-nasia of experimental animals: Part 2. DGXT of the European Commission. Lab. Anim. 31:1–32.

Decuypere, E., and E. R. Kuhn. 1988. Thyroid hormone physiology in Galli formes: Age and strain related changes in physiological control. Am. Zool. 28:401–415.

Denbow, D. M., and R. D. Myers. 1982. Eating, drinking and tem-perature responses to intracerebroventricular cholecystokinin in the chick. Peptides 3:739–743.

Furuse, M., M. Matsumoto, N. Saito, K. Sugahara, and S. Hasegawa. 1997. The central corticotropin-releasing factor and glucagon-like peptide-1 in food intake of the neonatal chick. Eur. J. Phar-macol. 339:211–213.

Furuse, M., T. Tachibana, A. Ohgushi, R. Ando, T. Yoshimatsu, and D. M. Denbow. 2001. Intracerebroventricular injection of ghre-lin and growth hormone releasing factor inhibits food intake in neonatal chicks. Neurosci. Lett. 301:123–126.

Hicks, T. A., J. J. McGlone, C. S. Whisnant, H. G. Kattesh, and R. L. Norman. 1998. Behavioral, endocrine, immune, and perfor-mance measures for pigs exposed to acute stress. J. Anim. Sci. 76:474–483.

Higgins, E. S., L. E. Ellestad, N. Trakooljul, F. McCarthy, J. Saliba, L. A. Cogburn, and T. E. Porter. 2010. Transcriptional and path-way analysis in the hypothalamus of newly hatched chicks dur-ing fasting and delayed feeding. BMC Genomics 11:162.

Kaiya, H., M. Furuse, M. Miyazato, and K. Kangawa. 2009. Current knowledge of the roles of ghrelin in regulating food intake and energy balance in birds. Gen. Comp. Endocrinol. 163:33–38.

Kaiya, H., M. Miyazato, and K. Kangawa. 2011. Recent advances in the phylogenetic study of ghrelin. Peptides 32:2155–2174.

Kojima, M., H. Hosoda, Y. Date, M. Nakazato, H. Matsuo, and K. Kangawa. 1999. Ghrelin is a growth-hormone-releasing acyl-ated peptide from stomach. Nature 402:656–660.

Kuenzel, W. J., M. M. Beck, and R. Teruyama. 1999. Neuralsites and pathways regulating food intake in birds: A comparative analysis is to mammalian systems. J. Exp. Zool. 283:348–364.

Acute heat stress and brain–gut neuropeptides 5201

Lin, H., E. Decuypere, and J. Buyse. 2004. Oxidative stress induced by corticosterone administration in broiler chickens (Gallus gallus domesticus). 1. Chronic exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 139:737–744.

Lin, H., S. J. Sui, H. C. Jiao, J. Buyse, and E. Decuypere. 2006. Im-paired development of broiler chickens by stress mimicked by corticosterone exposure. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 143:400–405.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene ex-pression data using real-time quantitative PCR and the 2 (–Delta Delta C (T)) method. Methods 25:402–408.

May, J. D., J. W. Deaton, F. N. Reece, and S. L. Branton. 1986. Effect of acclimation and heat stress on thyroid hormone concentration. Poult. Sci. 65:1211–1213.

Mayer, E. A. 2000. The neurobiology of stress and gastrointestinal dis-ease. Gut 47:861–869.

Oliver, G., J. Wardle, and L. Gibson. 2000. Stress and food choice: A laboratory study. Psychosom. Med. 62:853–865.

Puelles, L. M. M. Torre, G. Paxinos, C. Watson, and S. Martinez. 2007. The chick brain in stereotaxic coordinates: An atlas based on neu-romeres. 1st ed. Academic Press. Amsterdam. Elsevier, NV.

Renden, J. A., R. J. Lien, S. S. Oates, and S. F. Bilgili. 1994. Plasma concentrations of corticosterone and thyroid hormones in broilers provided various lighting schedules. Poult. Sci. 73:186–193.

Richards, M. P. 2003. Genetic regulation of feed intake and energy balance in poultry. Poult. Sci. 82:907–916.

Richards, M. P., S. M. Poch, and J. P. McMurty. 2006. Characterization of turkey and chicken ghrelin genes and regulation of ghrelin and ghrelin receptor mRNA levels in broiler chickens. Gen. Comp. Endocrinol. 145:298–310.

Richards, M. P., and M. Proszkowiec-Weglarz. 2007. Mechanisms regulating feed intake, energy expenditure, and body weight in poultry. Poult. Sci. 86:1478–1490.

Rybkin, I. I., Y. Zhou, J. Volaufova, G. N. Smagin, D. H. Ryan, and R. B. Harris. 1997. Effect of restraint stress on food intake

and body weight is determined by time of day. Am. J. Physiol. 273:R1612–R1622.

Saito, E. S., H. Kaiya, T. Tachibanat, S. Tomonaga, D. M. Denbow, K. Kangawa, and M. Furuse. 2005. Inhibitory effect of ghrelin on food intake is mediated by the corticotropin-releasing factor system in neonatal chicks. Regul. Pept. 125:201–208.

Savory, C. J., and M. J. Gentle. 1980. Intravenous injections of cho-lecystokinin and caerulein suppress food intake in domestic fowls. Experientia 36:1191–1192.

Song, Z., L. Liu, A. Sheikhahmadi, H. Jiao, and H. Lin. 2012. Effect of heat exposure on gene expression of feed intake regulatory peptides in laying hens. J. Biomed. Biotechnol. 2012:484869.

Takeuchi, S., K. Teshigawara, and S. Takahashi. 2000. Widespread expression of Agouti-related protein (AGRP) in the chick-en: A possible involvement of AgRP in regulating peripheral melanocortin systems in the chicken. Biochim. Biophys. Acta 1496:261–269.

Temim, S., A. M. Chagneau, R. Peresson, and S. Tesseraud. 2000. Chronic heat exposure alters protein turnover of three differ-ent skeletal muscles in finishing broiler chickens fed 20 or 25% protein diets. J. Nutr. 130:813–819.

Wren, A. M., C. J. Small, H. L. Ward, K. G. Murphy, C. L. Dakin, S. Taheri, A. R. Kennedy, G. H. Roberts, D. G. Morgan, M. A. Ghatei, and S. R. Bloom. 2000. The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141:4325–4328.

Yuan, L., Y. Ni, S. Barth, Y. Wang, R. Grossmann, and R. Zhao. 2009. Layer and broiler chicks exhibit similar hypothalamic expression of orexigenic neuropeptides but distinct expression of genes related to energy homeostasis and obesity. Brain Res. 1273:18–28.

Zhao, J. P., H. Lin, H. C. Jiao, and Z. G. Song. 2009. Corticosterone suppresses insulin- and NO-stimulated muscle glucose uptake in broiler chickens (Gallus gallus domesticus). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 149:448–454.