Effects of Fungal Polysaccharide on Oxidative Damage and TLR4Pathway to the Central Immune Organs in CadmiumIntoxication in Chickens

Ruyue Li1,2 & Linan Zhang1,2& Zequn Tang1,2

& Tianqi Li1,2 & Guangxing Li1,2 & Ruili Zhang1,2& Ming Ge1,2

Received: 27 September 2018 /Accepted: 26 December 2018# Springer Science+Business Media, LLC, part of Springer Nature 2019

AbstractCadmium (Cd) can cause animal organism damage, but there have been few studies on the damage of cadmium to the immuneorgans of birds.Most fungal polysaccharide has antioxidant and immunomodulatory effects. The experimental study investigatedthe effects of fungal polysaccharide (Agaricus blazei Murill polysaccharide and Ganoderma luciduccharide) on the oxidativedamage of central immune organs (thymus and bursa of Fabricius) and on the Toll-like receptor 4 (TLR4) pathway in cadmium-poisoned chickens. The results showed that Agaricus blazei polysaccharide and Ganoderma lucidum polysaccharide can reducecadmium content, TLR4 expression, inflammatory factor (IL-1β, IL-6, TNF-α) content, and lipid peroxidation product MDAcontent and increase the activity of antioxidant enzymes SOD and GSH-Px in thymus and bursa of cadmium poisoning chickens.Ganoderma lucidum polysaccharide could decrease the expression of TLR4, IL-1β, and IL-6 in cadmium poisoning peripheralblood lymphocytes of chicken, and TLR4 inhibitor had the same effect. The results demonstrated the protective effects ofAgaricus blazei Murill polysaccharide and Ganoderma lucidum polysaccharides on the damage of the central immune organsof chickens caused by cadmium poisoning were closely related to the TLR4 signaling pathway and oxidative stress.

Keywords Cadmium . Fungal polysaccharide . Chicken . TLR4 signaling pathway . Antioxidants . Immune organs

Introduction

Cadmium is one of the non-essential heavy metals and is wide-ly distributed in the earth’s crust. The main natural sources ofcadmium are volcanic activity, forest fires, and the release ofmetal-rich particles from land vegetation [1]. However, artificialactivities, such as the production of nickel-cadmium batteries,stabilizers, synthetic pigments, and metal melting, help to in-crease cadmium in the environment [2]. Cadmium enters the

body through the respiratory and digestive tracts. Cadmiummetabolizes slowly in the body and is absorbed into the blood-stream. Metallothionein (MT) combines with cadmium.Cadmium in the ionic state forms Cd-MT compounds and isexcreted from the body. However, when the amount of cadmi-um contained in the organism is too great or the kidney cannotproduce enough MT, it can cause dysfunction of the body andcause a toxic reaction. Cadmium poisoning can damage thekidneys, lungs, liver, spleen, and other tissues and organs [3].Studies have shown that cadmium can promote the productionof ROS as well as reduce the activity of antioxidant enzymes,resulting in the accumulation of free radicals, causing oxidativedamage to the body [4]; cadmium can also affect the synthesisand secretion of cytokines, causing a variety of diseases [5].

Toll-like receptor 4 (TLR4) is a transmembrane receptor thatexists on the cell surface and plays an important role in innateimmunity [6]. TLR4 recognizes pathogen-associated molecularpatterns (PAMPs) and damage-associated molecular patterns(DAMPs) and transduces signals into cells through myeloiddifferentiation factor 88 (MyD88)-dependent and MyD88-independent pathways. Nuclear factor-κB (NF-κB) and inter-feron regulatory factor 3 (IRF3) are activated, causing the

Ruyue Li and Linan Zhang contributed equally to this work and should beconsidered as co-first authors.

* Ruili Zhangzhangruili@neau.edu.cn

* Ming Gegeming@neau.edu.cn

1 College of Veterinary Medicine, Northeast Agricultural University,Harbin 150030, China

2 Key Laboratory of the Provincial Education Department ofHeilongjiang for Common Animal Disease Prevention andTreatment, Northeast Agricultural University, Harbin 150030, China

Biological Trace Element Researchhttps://doi.org/10.1007/s12011-018-1627-0

release of a variety of cytokines and other effector molecules,which play an important regulatory role in the immune inflam-matory response [7]. Oblak et al. [8] showed that nickel andcobalt could activate the TLR4 signaling pathway in the humanembryonic kidney (HEK) 293 cells. Song et al. [9] found thatcadmium increases TLR4 mRNA expression in human airwayepithelial cells.

Agaricus blazei Murill polysaccharides (ABP) andGanoderma lucidum polysaccharides (GLP) were extractedfrom Agaricus blazei and Ganoderma lucidum belonging tothe Myrtaceae medicinal plant. Studies have found that ABPhave various activities, such as anti-radiation, lowering bloodsugar, fighting inflammatory reactions, and resisting oxidation[10]. GLP can enhance the body’s immune function, regulatehumoral and cellular immunity, and play a regulatory role invarious processes of the immune response [11] in addition toits anti-oxidation and other functions [12]. Experiments bySong et al. [13] showed that ABP mitigates the damage in-duced by cadmium in chicken testis by enhancing antioxidantactivity and alleviating inflammatory response. Our previoustrial also found that Agaricus blazeiMurill polysaccharide cansignificantly reduce liver damage in cadmium-poisoned chick-en [14].

As a toxic heavy metal element, cadmium can accumu-late in animals and plants for a long period of time [15].The harm of cadmium to agriculture, animal husbandry,and humans has gradually gained attention [16]. Increasedcadmium content in water and soil leads to the accumu-lation of cadmium in the body, which in turn causes dam-age to tissues and organs. The immune organs of chickensmainly include central immune organs (thymus and bursaof Fabricius, in which the thymus is the site of differen-tiation and maturation of T lymphocytes, and the bursa ofFabricius can produce B lymphocytes) and peripheral im-mune organs (spleen). At present, there is less research onthe pathological damage of the immune organs due toexcessive cadmium in poultry. Our previous experimentsproved that cadmium poisoning can cause spleen damagein chickens [17], but there are no reports on the effects ofthymus and bursa of Fabricius that belong to the centralimmune organ. Moreover, the mechanism of the influenceof fungal polysaccharide on the pathological damagecaused by cadmium is not clear. Therefore, in this exper-iment, from the perspective of innate immune pattern rec-ognition of receptors and oxidative stress, chickens werestudied in vivo, and peripheral blood lymphocytes ofchickens were studied in vitro. A preliminary study wasconducted on the effects and mechanisms of fungal poly-saccharide (ABP and GLP) on the reduction of centralimmune organs (thymus and bursa of Fabricius) causedby cadmium poisoning to provide a scientific experimen-tal basis for further study of cadmium injury and mitiga-tion of cadmium on the mechanism of body damage.

Materials and Methods

Animals and Treatments

All procedures used in the current study were approved by theInstitutional Animal Care and Use Committee of NortheastAgricultural University in China.

Seventy-two 7-day-old Hyland white chickens (Harbin,China) were randomly divided into control (C) group, cadmium(G) group, ABP treatment (TG) group, and GLP treatment (LG)group. The control group was fed with full-priced feed; the othergroups were fed with cadmium-containing feed at a dose of140 mg/kg of CdCl2 [14] (China Tianjin Guangfu TechnologyCo., Ltd). The TG groupwas supplemented with 0.2mL ofABP(30 mg/mL) (prepared by the method of water extraction andalcohol precipitation by the Department of VeterinaryMedicine, College of Veterinary Medicine, NortheastAgricultural University [14]). In the LG group, 0.2 mL of GLP(30 mg/mL) (using the enzyme-assisted ultrasound-microwavecombined extraction method prepared by the Department ofVeterinary Medicine, Faculty of Veterinary Medicine, NortheastAgricultural University) was added to each chicken. The com-position and nutritional level of basic diet shows in Tables 1 and2. Chickens were fed continuously for 60 days. The chickens ofeach group freely drank water and were fed for 20, 40, and60 days in groups. Five chickens were randomly selected fromeach group. After euthanasia, the thymus and bursa of Fabriciuswere quickly collected, then frozen in liquid nitrogen and trans-ferred to a − 80 °C freezer for later use.

Table 1 Composition of the experimental diets (%).The premixprovided the following per kg of diets: VA 12500 IU, cholecalciferol,4125 IU, VE 15 IU, VK 2 mg, thiamine 1 mg, riboflavin 8.5 mg,calcium pantothenate 50 mg, nicotinic acid 32.5 mg, pyridoxine 8 mg,VB12 5 mg, biotin 2 mg, Fe (as ferrous sulfate) 60 mg, Cu (as coppersulfate) 8 mg, Zn (as zinc sulfate) 66 mg, Mn 65 mg, Se 0.3 mg, I 1 mg

Ingredient C G TG LGContents

CdCl2 0 0.014 0.014 0.014

Corn 63.69 63.68 63.68 63.69

Soybean meal 14.35 14.35 14.35 14.35

Sunflowers meal 4.09 4.09 4.09 4.09

Corn gluten meal 4.08 4.08 4.08 4.08

Soybean oil 2.73 2.73 2.73 2.73

DL-Methionine (98%) 0.17 0.17 0.17 0.17

L-Lysine HCL (78%) 0.04 0.04 0.04 0.04

Limestone 9.0 9.0 9.0 9.0

CaHPO4 1.0 1.0 1.0 1.0

Premix 0.5 0.5 0.5 0.5

NaCl 0.3 0.3 0.3 0.3

Choline 0.05 0.05 0.05 0.05

Total 100 100 100 100

Li et al.

Cadmium Detection

The Cd level of thymus and bursa of Fabricius (0.5 g) weredetermined using inductively coupled plasma mass spectrom-etry (ICP-MS) (Agilent 7800, Agilent Technologies, Beijing,China) after pretreating in a graphite digestion system(Polytech ST60, Polytech Instrument Ltd., Beijing, China).The operating conditions are shown in Table 3.

Antioxidant Level Detection

The thymus and bursa of Fabricius of each group were added to0.1 g of 0.9 mL physiological saline, mechanically homogenizedin an icewater bath, and then centrifuged at 2500 rpm for 10min,and then the supernatant was collected. After using Coomassiebrilliant blue method to detect protein content, according to themanufacturer’s instructions (Nanjing Jiancheng BioengineeringInstitute, China), the superoxide dismutase (SOD) activity, glu-tathione peroxidase (GSH-Px) activity, and malondialdehyde(MDA) content were measured for the thymus and bursa ofFabricius in each group using a kit.

Western Blot Analysis

To each group of chicken thymuses and bursa of Fabricius, 0.1 gand 1 mL of lysate (containing 1% phenylmethylsulfonyl fluo-ride (PMSF)) were added, fully ground, and the sample wasplaced into the EP tube by pipette. After centrifugation at

12,000 r/min for 5 min, the supernatant was removed, mixedwith an equal amount of 2 × sodium dodecyl sulfate (SDS) buff-er, and boiled for 10min. The resulting protein samplewas addedto 8% SDS polyacrylamide gel electrophoresis (SDS-PAGE). Itwas then transferred to the NC membrane (15 V, 2 h) by usingTrans-Blot SD (Bio-Rad, USA). Five percent skim milk in Tris-buffered saline with Tween (TBST) was blocked at 37 °C for1.5 h, and the primary antibody was incubated at 4 °C. Rabbitanti-chicken TLR4 polyclonal antibody (1000-fold dilution [18],prepared by this laboratory) and anti-beta-actin mouse monoclo-nal antibody (1000-fold dilution, Biyuntian Biotechnology Co.,Ltd.) were added, followed by incubation with horseradishperoxidase-labeled goat anti-rabbit immunoglobulin G (IgG,1:5000, ZSGB-BIO, China) and goat anti-mouse IgG (1:5000,ZSGB-BIO, China) for 1 h at room temperature. An appropriateamount of high signal enhanced chemiluminescentWestern blot-ting substrate (ECL, Tanon, China) was added to the membranefor imaging. The ImageJ software was used to detect the inte-grated density (IntDen) of each band, and the protein expressionlevel was expressed as the ratio of IntDen of the target protein toIntDen of β-actin.

Enzyme-Linked Immunosorbent Assay Detection

The supernatants prepared from the thymus and bursa ofFabricius of chickens in each group were taken. Enzyme-linked immunosorbent assay (ELISA) kits (ElabscienceBiotech Co., Ltd., China) were used to measure the levels ofinflammatory cytokines interleukin (IL)-1β, IL-6 and tumor ne-crosis factor (TNF)-α in chicken thymus and bursa of Fabricius.

Isolation, Culture, and Treatment of Peripheral BloodLymphocytes in Chickens

The anticoagulated peripheral blood of 7-day-old healthyHyland white chickens was collected, and the cells were iso-lated according to the guidance of the lymphocyte separationmedium kit (Tianjin Marine Biological Products Co., Ltd.,China). The isolated cells were added to a 1640 culture medi-um containing 10% fetal bovine serum (FBS) and 1%

Table 2 Nutritional levels of theexperimental diets. Data ofnutrients were analyzed valuecontained except ME and TP. Thevalue of the three batches of feedis expressed as mean ± SD

Nutrient level C G TG LGContents

CP 16.52 ± 0.08 16.52 ± 0.12 16.52 ± 0.09 16.52 ± 0.51

ME (MJ/kg) 11.30 11.30 11.30 11.30

Ca 3.08 ± 0.028 3.08 ± 0.009 3.08 ± 0.005 3.09 ± 0.008

TP 0.41 0.41 0.41 0.41

Methionine 0.45 ± 0.016 0.45 ± 0.006 0.45 ± 0.015 0.45 ± 0.006

Lysine 1.03 ± 0.013 1.03 ± 0.006 1.03 ± 0.013 1.03 ± 0.011

Methionine + cysteine 0.78 ± 0.014 0.79 ± 0.008 0.78 ± 0.007 0.78 ± 0.008

Table 3 CP-MS operating conditions

Parameter Cd

Tuning Nebulizer gas flow (L min−1) 0.96

Auxiliary gas flow (L min−1) 1.4

Plasma gas flow (L min−1) 18

ICP RF power 1400

Timing Sweeps/reading 30

Readings/replicate 1

Number of replicates 3

Effects of Fungal Polysaccharide on Oxidative Damage and TLR4 Pathway to the Central Immune Organs in...

antibiotics, counted using trypan blue and their activity wasdetected to be greater than 95%. The cell density was adjustedto approximately 5 × 106 cells/mL and transferred to a six-wellcell culture plate, and 2.4 mL was added to each well. Threecomplex holes were made for each group. After culturing for24 h at 37 °C in a 5% CO2 incubator, the treatment method isshown in Table 4.

After the first step of treatment, lymphocytes were incubatedin a 37 °C 5% CO2 incubator for 30 min, followed by thesecond step, and cultured in a 37 °C 5% CO2 incubator for24 h. Each group of cells was collected in a centrifuge tubeand centrifuged at 2500 r/min, for 10 min. The supernatantwas discarded, and the cell pellet was used for RNA extraction.

RNA Extraction and Real-time FluorescenceQuantitative Polymerase Chain Reaction

Total RNA from chicken peripheral blood lymphocytes wasextracted using the RNA Rapid Extraction Kit (Bio Teke,Beijing, China), and cDNA was synthesized by reverse tran-scription. GenBank Gallus TLR4, NF-κB, IRF3, TNF-α, IL-1β, IL-6, andβ-actin gene sequences were used as references,and specific primers were designed. (See Table 5 for theprimer sequences.) The expression of the above gene wasdetected using Power SYBR real-time polymerase chain reac-tion (PCR) pre-mixed dye (Bio Teke, Beijing, China) andchicken lymphocyte cDNA as a template. The reaction wasperformed on the Line Gene 9620 Fluorescence QuantitativePCR instrument (Bori Technology Co., Ltd., Hangzhou,China) with a reaction volume of 20 μL. The reaction proce-dure was pre-denatured at 95 °C for 30 s, denatured at 95 °Cfor 5 s, and annealed at 60 °C for 34 s for a total of 40 cycles.The fluorescence signal was detected during annealing exten-sion. The PCR results were determined by β-actin as an inter-nal reference. After repeated experiments, the 22−ΔΔCt meth-od was used for calculation and analysis.

Statistics and Analysis

Multiple comparisons between groups of results were per-formed using the least significant difference (LSD) and theDuncan methods of SPSS 17.0 software. Correlation analysis

was performed, and the results were expressed as mean andstandard deviation (mean ± SD). Histograms were plottedusing GraphPad Prism 5 software.

Result

Cadmium Content in Thymus and Bursa of Fabricius

As shown in Fig. 1, compared with the control group, thecadmium content in the thymus and bursa of Fabricius ofthe cadmium-treated group was significantly higher(P < 0.01). The cadmium content in the treatment group ofAgaricus blazei Murill polysaccharide and Ganodermalucidum polysaccharide was highly significantly lower thanthat of the cadmium staining group (P < 0.01), but it washighly significantly higher than that of the control group(P < 0.01). The content of cadmium in the thymus and bursaof Fabricius of the Ganoderma lucidum polysaccharide-treated group gradually decreased with time, reaching themin-imum at 60 days. There was no significant change in cadmium

Table 4 Differentiation andtreatment of peripheral bloodlymphocytes in chicken

Group The first step of treatment (100 μL) The second step of treatment (100 μL)

C 1640 culture fluid 1640 culture fluid

G 1640 culture fluid CdCl2 (10 μmol/L)

L GLPs (160 μg/mL) 1640 culture fluid

TAK-242 TAK-242 (5 μmol/L) 1640 culture fluid

LG GLPs (160 μg/mL) CdCl2 (10 μmol/L)

TAKG TAK-242 (5 μmol/L) CdCl2 (10 μmol/L)

Table 5 Primer sequences

Names ofprimers

Sequences (5′–3′) Fragmentsizes (bp)

TLR4 TTCCAAGCACCAGATAGCAACATC 202AAGGAAGTGAGGTTGAGGAGTCG

NF-κB TCTGAACAGCAAGTCATCCATAACG 250AAGGAAGTGAGGTTGAGGAGTCG

IRF3 CTCTCTGACTCTTTCAACCTCTTCG 260TGCTGCCTGCTCCTGTGG

TNF-α CAGATGGGAAGGGAATGAAC 268AGAGCATCAACGCAAAAGGG

IL-6 ATGGTGATAAATCCCGATGAAG 153CCTCACGGTCTTCTCCATAAAC

IL-1β TTCCGCTACACCCGCTCACAGT 242CCGCTCATCACACACGACAT

IFN-β GCCCACACACTCCAAAACACTG 151TTGATGCTGAGGTGAGCGTTG

β-actin ATTGCTGCGCTCGTTGTT 173CTTTTGCTCTGGGCTTCA

Li et al.

content in the thymus and bursa of Fabricius of the chicken ofthe Agaricus blazei polysaccharide treatment group.

Antioxidant Levels in Thymus and Bursa of Fabricius

As shown in Fig. 2, on the 20th, 40th, and 60th days, theactivities of SOD and GSH-Px in the thymus and bursa ofFabricius of the cadmium group were highly significantly

lower than those in the control group (P < 0.01). SOD activityand GSH-Px activity in the polysaccharide treatment groupwere highly significantly higher than those in the cadmiumgroup (P < 0.01). Agaricus blazei polysaccharides andGanoderma lucidum polysaccharides have significant or ex-tremely significant differences in the regulation of SOD activ-ity and GSH-Px in the thymus and bursa of Fabricius ofchickens (P < 0.01 or P < 0.05). The content of MDA in the

Cadm

ium

con

tent

(μg/

kg)

1

10

100

1000

10000C

G

TG

LG

## ##

** ** **

##

** ##

**

## ##

##

** ** ##

**

##

**

20d 40d 60d

a

tnetnocmui

mdaC(μ

g/kg

)

1

10

100

1000C

G

TG

LG

## ##

** ** **

##

** **

##

** **

##

##

##

**

##

##

**

20d 40d 60d

b

Fig. 1 a The Cd content in the thymus; b the Cd content in bursa ofFabricius. Asterisk sign indicates that each group is compared with thecontrol (C) group; number sign indicates that each group is comparedwith the cadmium (G) group; the two symbols represent a significant

difference (P < 0.01), and one symbol represents a significant difference(P < 0.05); unmarked symbols indicate no significant difference (P ≥0.05)

Ac�v

ity o

f SO

D(U

/mL)

0

20

40

60

80

100C

G

TG

LG

&&

##

**

**

&&

##

**

**

&

##

**

**

##

**##

**##

**

foytivitcA

GSH

-Px

(U/m

L)

20d

0.0

0.2

0.4

0.6

0.8

1.0C

G

TG

LG

##

*

##

*

**

##

*

##

*

**

&&

##

**##

**

**

40d

f

20d 60d40d

Leve

lofM

DA(n

mol

/mL)

b

60d

0

10

20

30

40

50C

G

KG

TG

**

&

####

**

**

&

##

**##

**

**

&

##

**##

**

0

10

20

30

40

50C

G

TG

LG

**

&

##

**

##

** **

&&

##

**

##

** **

&&

##

*

##

**

c

foytivitcA

SOD

(U/m

L)

a

20d 40d 60d 20d 40d 60d

0

20

40

60

80C

G

TG

LG

&&

##

**

&&

##

**&&

##

**##

**##

**##

****

****

20d 60d40d

d

Ac�v

ity o

fGSH

-Px

(U/m

L)

0.0

0.2

0.4

0.6

0.8C

G

TG

LG

&&

##

**

##

**

** &

##

*

##

*

**

&&

##

**

##

**

**

e

20d 60d40d

foleveLM

DA(

Lm/lo

mn)

Fig. 2 a The activity of SOD inthe thymus; b the activity of SODin bursa of Fabricius; c theactivity of GSH-Px in the thymus;d the activity of GSH-Px in bursaof Fabricius; e the activity ofMDA in the thymus; f the activityof MDA in bursa of Fabricius.Asterisk sign indicates that eachgroup is compared with thecontrol (C) group; number singindicates that each group is com-pared with the cadmium (G)group; the two symbols representa significant difference (P < 0.01),and one symbol represents asignificant difference (P < 0.05);unmarked symbols indicate nosignificant difference (P ≥ 0.05)

Effects of Fungal Polysaccharide on Oxidative Damage and TLR4 Pathway to the Central Immune Organs in...

thymus and bursa of Fabricius group was highly significantlyhigher than that of the control group (P < 0.01). The content ofMDA in the polysaccharide treatment group was highly sig-nificantly lower than that of the cadmium group (P < 0.01).

TLR4 Expression in the Thymus and Bursa of Fabricius

Results of TLR4 expression in the thymus of chicken fromeach group (Fig. 3). It can be seen from the figure that thecontents of TLR4 protein in the cadmium group, the Agaricusblazei polysaccharide treatment group, and the Ganodermalucidum polysaccharide treatment group on the 20th day werehighly significantly lower than the control group (P < 0.01).The expression of TLR4 was higher in the cadmium group onthe 40th and 60th days than in the control group. The expres-sion of TLR4 in the polysaccharide treatment group was lower

than that in the cadmium group. Results of TLR4 expressionin bursa of Fabricius of chicken in each group (Fig. 2c).Figure 2c shows that the TLR4 protein content was reducedin the cadmium group, the Agaricus blazei polysaccharidetreatment group, and the Ganoderma lucidum polysaccharidetreatment group on the 20th day compared with the controlgroup. On days 40 and 60, compared with the control group,TLR4 expression in the bursa of Fabricius of the cadmiumgroup increased. With the exception of the 40th day of theAgaricus blazei polysaccharide treatment group, the TLR4expression in the other polysaccharide treatment groups waslower than that in the cadmium group.

Cytokine Content in Thymus and Bursa of Fabricius

As shown in Fig. 4, compared with the control group, thelevels of IL-1β, IL-6, and TNF-α in the thymus and bursaof Fabricius of the cadmium group were significantly higheron the 20th, 40th, and 60th days than in the control group(P < 0.01). With the exception of the 60th day of the polysac-charide treatment group, IL-1β was not significantly differentfrom that of the cadmium group (P ≥ 0.05). The contents ofIL-1β, IL-6, and TNF-α in the other polysaccharide treatmentgroups were significantly lower than those of the cadmiumgroup (P < 0.05).

The Effect of Ganoderma lucidum Polysaccharideson the mRNA Expression of TLR4 and Its SignalTransduction Pathway-Related Signal Moleculesin Chicken Peripheral Blood Lymphocytes

qRT-PCR was used to detect the expression of TLR4, NF-κB,and IRF3 mRNA in chicken peripheral blood lymphocytes.The test results are shown in Fig. 5. Compared with the cad-mium group, the expression of TLR4 mRNA in theGanoderma lucidum polysaccharide treatment group was sig-nificantly decreased (P < 0.05), but the expression of NF-κBand IRF3 mRNA was significantly increased (P < 0.05).Compared with the cadmium group, the expression of TLR4mRNA in the TLR4 inhibitor (TAK-242) + cadmium groupwas significantly decreased (P < 0.05), and the expression ofNF-κB and IRF3 mRNA was significantly or highly signifi-cantly increased (P < 0.05 or P < 0.01).

The Effect of Ganoderma lucidum Polysaccharideson the mRNA Expression of Cytokine in ChickenPeripheral Blood Lymphocytes

As shown in Fig. 6, compared with the cadmium group, theexpression of TNF-α in the Ganoderma lucidum polysaccha-ride treatment group was significantly increased (P < 0.05),and the expression of IL-1β was not significantly different(P ≥ 0.05). The expression of IL-6 mRNA was significantly

TLR4

-actin

Gra

y Va

lue

0.0

0.5

1.0

1.5C

G

TG

LG

40d 60d20d

b

TLR4

a

Gra

y Va

lue

0.0

0.5

1.0

1.5C

G

TG

LG

20d 40d 60d

β-actin

Fig. 3 a The expression of TLR4 in the thymus; b the expression ofTLR4 in the bursa. Asterisk sign indicates that each group is comparedwith the control (C) group; number sign indicates that each group iscompared with the cadmium (G) group; the two symbols represent asignificant difference (P < 0.01), and one symbol represents a significantdifference (P < 0.05); unmarked symbols indicate no significant differ-ence (P ≥ 0.05)

Li et al.

decreased (P < 0.01). Compared with the cadmium group, theexpression of TNF-αwas increased in the TLR4 inhibitor(TAK-242) + cadmium group, the expression of IL-1β wassignificantly decreased (P < 0.01), and the expression of IL-6mRNAwas significantly decreased (P < 0.01).

Discussion

Studies have shown that cadmium in the body causedmultiplesystemic and multiple organ damage, including the liver, kid-neys, bones, testis, and brain [3]. At present, there is no studyon the accumulation of cadmium in the central immune organof chickens and the resulting damage. The results of this ex-periment showed that the cadmium content in the thymus andbursa of Fabricius of the cadmium group was highly signifi-cantly higher than that of the control group. The cadmiumcontent of the Agaricus blazei polysaccharide andGanoderma lucidum polysaccharide treatment groups wassignificantly lower than that of the cadmium stained group.It is suggested that cadmium could accumulate in the central

immune organs (thymus, bursa of Fabricius) of chickens,while Agaricus blazei Murill polysaccharide andGanoderma lucidum polysaccharides have certain inhibitoryeffects on the accumulation of cadmium, among whichGanoderma lucidum polysaccharides have more significanteffects than Agaricus blazei.

Studies have shown that SOD and GPx are important anti-oxidant enzymes in living organisms, and their decreased ac-tivity may be attributed to the combination of Cd with thesulfhydryl groups of these enzymes and the changes of endog-enous redox metals, which changes the structure of these en-zymes and leads to their inhibition [19]. Studies have shownthat excessive arsenic changes the activity of antioxidant en-zymes and leads to oxidative stress [20]. In this study, theactivities of SOD and GSH-Px in the thymus and bursa ofFabricius were detected, the activities of SOD and GSH-Pxin the cadmium-treated group were significantly lower thanthose in the control group, and the MDA (a product of freeradical attack membrane unsaturated fatty acids) content wassignificantly higher than that in the control group. The activ-ities of SOD and GSH-Px in the treatment group of Agaricusblazei Murill polysaccharide and Ganoderma lucidum

0.1

1

10

100C

G

TG

LG##

**

**#

*

**

**

##

##

##

&

##

**

Conc

entr

a�on

of IL

-1β

(pg/

mL)

b

0

5

10

15

20

25C

G

TG

LG

**

#

**

**

#

**

** ** **

&&

##

&&

##

*

Conc

entr

a�on

ofTN

F-α

pg/m

L

f

noitartnecnoCof

TN

F-α

(pg/

mL)

e

0

10

20

30C

G

TG

LG ##

**

#

* ##

* ## ##

**

** ##

noitartnecnoCof

IL-1β

(pg/

mL)

a

0

50

100

150C

G

TG

LG** ##

**

**

** &&

##

*

##

*

&&

##

**

##

**

20d 40d 60d 20d 40d 60d

Conc

entr

a�on

ofIL

-6(p

g/m

L)

d

0

5

10

15

20

25C

G

TG

LG

**

#

**

**

#

**

** ** **

&&

##

&&

##

*

noitartnecnoCof

IL-6

(pg/

mL)

c

0

50

100

150C

G

TG

LG** ##

**

**

** &&

##

*

##

*

&&

##

**

##

**

20d 40d 60d 20d 40d 60d

20d 40d 60d20d 40d 60d

Fig. 4 a The concentration of IL-1β in the thymus; b theconcentration of IL-1β in bursa ofFabricius; c the concentration ofIL-6 in the thymus; d theconcentration of IL-6 in bursa ofFabricius; e the concentration ofTNF-α in the thymus; f theconcentration of TNF-α in bursaof Fabricius. Asterisk signindicates that each group iscompared with the control (C)group; number sign indicates thateach group is compared with thecadmium (G) group; the twosymbols represent a significantdifference (P < 0.01), and onesymbol represents a significantdifference (P < 0.05); unmarkedsymbols indicate no significantdifference (P ≥ 0.05)

Effects of Fungal Polysaccharide on Oxidative Damage and TLR4 Pathway to the Central Immune Organs in...

polysaccharide were significantly higher than those in thecadmium group, and the MDA content was lower than thatin the cadmium group. This shows that cadmium can inhibitthe activities of SOD and GSH-Px, increase the lipid peroxi-dation reaction, increase the MDA content, and cause oxida-tive damage to the body. Agaricus blazei polysaccharides andGanoderma lucidum polysaccharides can antagonize the de-crease of SOD and GSH-Px activity caused by cadmium, de-crease the content of MDA, and reduce the oxidative damage.Studies have shown that Agaricus blazei polysaccharide mayreduce the body’s peroxidative damage through the elimina-tion of free radicals [21].

In the inflammatory response, immune cells secrete cyto-kines, including IL-1, IL-6, and TNF-α, as messengers of theinflammatory response, which play a role in regulating thebalance of inflammation. Once this balance is broken,sustained or excessive inflammatory reactions can cause dam-age to the tissues and worsen the disease. Our in vivo exper-iments show that cadmium can increase the expression levelsof cytokines, such as IL-1β, IL-6, and TNF-α in the thymusand bursa of Fabricius of chickens. The increase in the ex-pression of Agaricus blazei polysaccharides and Ganodermalucidum polysaccharides was partially inhibited after treat-ment. In vitro, compared with the control group, the expres-sion levels of IL-1β, IL-6, and TNF-α mRNA in the periph-eral blood lymphocytes of the cadmium group were signifi-cantly or highly significantly increased. The results of

expression of IL-1β, IL-6, and TNF-α mRNAwere differentafter Ganoderma lucidum polysaccharides were used.Compared with the cadmium group, the expression ofTNF-α in the Ganoderma lucidum polysaccharide treatmentgroup was significantly increased, the expression of IL-1βwas not significantly different, and the expression of IL-6mRNA was significantly decreased. The expressions ofTNF-α, IL-1β, and IL-6 mRNA in TLR4 inhibitor (TAK-242) + cadmium group were basically consistent with thosein Ganoderma lucidum polysaccharide treatment group.Studies have shown thatGanoderma lucidum polysaccharidescan reduce atherosclerotic rat TNF-α levels [22]. There aredifferences in the effect of polysaccharides on the changes ofcytokines caused by cadmium. The possible causes are asfollows: the dose and time of action of cadmium are different;different animals have different susceptibility to cadmium;there are certain differences in the composition of differentpolysaccharides, and the administration route and dose alsohave different degrees of influence on the changes ofcytokines.

Studies have shown that cadmium can upregulate the ex-pression of TLR4 in chicken peripheral blood lymphocytes,mediate the transcription of NF-κB and IRF3 in the nucleus,and promote the synthesis and secretion of inflammatory cy-tokines IL-1β, IL-6, and TNF-α. The in vivo experiments ofthis experiment were used to detect the expression of TLR4protein in the thymus and bursa of Fabricius in chickens in

Fig. 5 The a TLR4, b NF-κB,and c IRF3 mRNA levels inchicken peripheral bloodlymphocytes were measured byreal-time PCR. Asterisk signindicates that each group iscompared with the control (C)group; number sign indicates thateach group is compared with thecadmium (G) group; the twosymbols represent a significantdifference (P < 0.01), and onesymbol represents a significantdifference (P < 0.05); unmarkedsymbols indicate no significantdifference (P ≥ 0.05)

Li et al.

each group. The results showed that the content of TLR4protein in the thymus 20 days after the addition of cadmiumwas lower in the cadmium group, the Agaricus blazei poly-saccharide treatment group, and the Ganoderma lucidumpolysaccharide treatment group than in the control group.After 20 days of cadmium feeding, the expression of TLR4was higher in the cadmium group than in the control group,and the TLR4 expression was lower in the two polysaccharidetreatment groups than in the cadmium group. With the excep-tion of 40 days after cadmium treatment, the Agaricus blazeipolysaccharide treatment group was higher than the cadmiumgroup, and the protein content of TLR4 in the bursa ofFabricius was similar to that in the thymus. In vitro, the ex-pression of TLR4, NF-κB, and IRF3 mRNAwas the lowest inthe TLR4 inhibitor (TAK-242) group. TAK-242, an inhibitorof TLR4 signaling pathway, inhibited the expression of TLR4,NF-κB, and IRF3 mRNA. Compared with cadmium group,the expression of TLR4 mRNA was decreased in theGanoderma lucidum polysaccharide treatment group. Thetrend of the TLR4 inhibitor (TAK-242) + cadmium groupwas similar to that of the Ganoderma lucidum polysaccharidetreatment group. The effect of Ganoderma lucidum polysac-charides on the peripheral blood lymphocytes of cadmium-treated chickens may be similar to the TLR4 inhibitor TAK-242. Combined with the results of in vivo experiments, it isspeculated that with the prolongation of cadmium exposure,the expression of TLR4 increases beyond the normal

physiological level, resulting in immune damage. Agaricusblazei polysaccharides and Ganoderma lucidum polysaccha-rides partially inhibited the increase of TLR4 expression in-duced by cadmium through the regulation of the TLR4 sig-naling pathway and weakened the damage caused by cadmi-um in the body. This regulation may be reflected in the regu-lation of TLR4 expression and the transcription and transla-tion of TLR4 and downstream signaling factors.

Conclusion

Agaricus blazei polysaccharides and Ganoderma lucidumpolysaccharides can reduce the damage of cadmium to thecentral immune organs of chickens by reducing the cadmiumcontent in the thymus and bursa of Fabricius, TLR4 expres-sion, cytokine (IL-1β, IL-6, TNF-α) content, and lipid perox-idation product MDA content and increasing the activities ofantioxidant enzymes SOD and GSH-Px. Cadmium may causedamage to the body through activation of the TLR4 signalingpathway. Ganoderma lucidum polysaccharides can reducecadmium-induced damage through inhibition of the TLR4signaling pathway.

Acknowledgements We thank the members of the Traditional ChineseVeterinary Medicine Laboratory at the College of Veterinary Medicine,Northeast Agricultural University.

Fig. 6 The a TNF-α, b IL-1β,and c IL-6 mRNA levels inchicken peripheral bloodlymphocytes were measured byreal-time PCR. Asterisk signindicates that each group iscompared with the control (C)group; number sign indicates thateach group is compared with thecadmium (G) group; the twosymbols represent a significantdifference (P < 0.01), and onesymbol represents a significantdifference (P < 0.05); unmarkedsymbols indicate no significantdifference (P ≥ 0.05)

Effects of Fungal Polysaccharide on Oxidative Damage and TLR4 Pathway to the Central Immune Organs in...

Funding Information This work was supported by the National ScienceFoundation of China (Grant No. 31272533).

Compliance with Ethical Standards

Ethical treatment of animals used in this study was approved by theAnimal Welfare Committee protocol (#NEAU-2013-02-0252-11) atNortheast Agricultural University (Harbin, China).

Conflict of Interest The authors declare that they have no conflict ofinterest.

Disclaimer All authors have read the manuscript and agreed to submit itin its current form for consideration for publication in the journal.

Publisher’s Note Springer Nature remains neutral with regard to jurisdic-tional claims in published maps and institutional affiliations.

References

1. Burger J (2008) Assessment and management of risk to wildlifefrom cadmium. Sci Total Environ 389(1):37–45

2. Patar A, Giri A, Boro F, Bhuyan K, Singha U, Giri S (2016)Cadmium pollution and amphibians - studies in tadpoles of Ranalimnocharis. Chemosphere 144:1043–1049

3. Huo J, Dong A, Yan J, Wang L, Ma C, Lee S (2017) Cadmiumtoxicokinetics in the freshwater turtle, Chinemys reevesii.Chemosphere 182:392–398

4. Brzóska MM, Majewska K, Moniuszkojakoniuk J (2004) Mineralstatus and mechanical properties of lumbar spine of female ratschronically exposed to various levels of cadmium. Bone 34(3):517–526

5. Marth E, Barth S, Jelovcan S (2000) Influence of cadmium on theimmune system. Description of stimulating reactions. Cent Eur JPublic Health 8(1):40–44

6. Calabrese V, Cighetti R, Peri F (2015) Molecular simplification oflipid a structure: TLR4-modulating cationic and anionic amphi-philes. Mol Immunol 63(2):153–161

7. PascuallucasM, Fernandezlizarbe S,Montesinos J, Guerri C (2014)LPS or ethanol triggers clathrin- and rafts/caveolae-dependent en-docytosis of TLR4 in cortical astrocytes. J Neurochem 129(3):448–462

8. Oblak A, Pohar J, Jerala R (2015)MD-2 determinants of nickel andcobalt-mediated activation of human TLR4. 10(3):e0120583

9. Song SY, Bae CH, Choi YS, Kim YD (2016) Cadmium inducesmucin 8 expression via Toll-like receptor 4-mediated extracellular

signal related kinase 1/2 and p38 mitogen-activated protein kinasein human airway epithelial cells. Int Forum Allergy Rhinol 6(6):638–645

10. Oshiman K, Fujimiya Y, Ebina T, Suzuki I, Noji M (2002) Orallyadministered beta-1,6-D-polyglucose extracted from Agaricusblazei results in tumor regression in tumor-bearing mice. PlantaMed 68(07):610–614

11. Liu Z, Ma X, Deng B, Huang Y, Bo R, Gao Z, Yu Y, Hu Y, Liu J,Wu Y (2015) Development of liposomal Ganoderma lucidum poly-saccharide: formulation optimization and evaluation of its immuno-logical activity. Carbohydr Polym 117:510–517

12. Shi M, Zhang Z, Yang Y (2013) Antioxidant and immunoregulato-ry activity of Ganoderma lucidum polysaccharide (GLP).Carbohydr Polym 95(1):200–206

13. Song Y, Zhang R,Wang H, Yan Y, Ming G (2017) Protective effectof Agaricus blazei polysaccharide against cadmium-induced dam-age on the testis of chicken. Biol Trace Elem Res:1–10

14. HuX, ZhangR,Xie Y,WangH,GeM (2016) The protective effectsof polysaccharides from Agaricus blazei Murill against cadmium-induced oxidant stress and inflammatory damage in chicken livers.Biol Trace Elem Res 178(1):1–10

15. Daley T, Omoregie SN, Wright V, Omoruyi FO (2013) Effects ofphytic acid and exercise on some serum analytes in rats orallyexposed to diets supplemented with cadmium. Biol Trace ElemRes 151(3):400–405

16. Satarug S, Garrett SH, Sens MA, Sens DA (2011) Cadmium, envi-ronmental exposure, and health outcomes. Environ Health Perspect16(5):182–190

17. XieW, LvA, Li R, Tang Z,MaD,HuangX, ZhangR, GeM (2017)Agaricus blazei Murill polysaccharides protect against cadmium-induced oxidative stress and inflammatory damage in chickenspleens. Biol Trace Elem Res (1):1–12

18. Zhang R, Yu Q, Shi G, Rui L, Zhang W, Xia Z, Li G, Ming G(2017) chTLR4 pathway activation by Astragalus polysaccharidein bursa of Fabricius. BMC Vet Res 13(1):119

19. Shagirtha K, ., Muthumani M, ., S M Prabu (2011) Melatoninabrogates cadmium induced oxidative stress related neurotoxicityin rats. Eur Rev Med Pharmacol Sci 15 (9):1039, 1050

20. Zhao P, Guo Y, Zhang W, Chai H, Xing H, Xing M (2017)Neurotoxicity induced by arsenic in Gallus Gallus: regulation ofoxidative stress and heat shock protein response. Chemosphere166:238–245

21. Jia S, Li F, Liu Y, Ren H, Gong G,Wang Y, Wu S (2013) Effects ofextraction methods on the antioxidant activities of polysaccharidesfrom Agaricus blazei Murrill. Int J Biol Macromol 62(11):66–69

22. Pan K, Jiang Q, Liu G, Miao X, Zhong D (2013) Optimizationextraction of Ganoderma lucidum polysaccharides and its immunityand antioxidant activities. Int J Biol Macromol 55(2):301–306

Li et al.