enhanced wine-making efficiency through fool-proof ... · successfully to generate improved strains...

130
Enhanced Wine-Making Efficiency Through Fool-Proof Malolactic Fermentation: Evolution of Superior Lactic Acid Bacteria Alice Livingston Betteridge A thesis submitted for the degree of Doctor of Philosophy School of Agriculture, Food and Wine Faculty of Sciences The University of Adelaide January 2015

Upload: others

Post on 25-Mar-2020

4 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Enhanced Wine-Making Efficiency

Through Fool-Proof Malolactic

Fermentation: Evolution of Superior

Lactic Acid Bacteria

Alice Livingston Betteridge

A thesis submitted for the degree of Doctor of Philosophy

School of Agriculture, Food and Wine

Faculty of Sciences

The University of Adelaide

January 2015

Page 2: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table of Contents

i

Table of Contents

Summary ................................................................................................................................ iv

Declaration of authorship ....................................................................................................... vi

Acknowledgements .............................................................................................................. vii

List of Figures ........................................................................................................................ ix

List of Tables .......................................................................................................................... x

Abbreviations and Symbols ................................................................................................... xi

Chapter 1. Strategies to improve the stress tolerance of Oenococcus oeni to enable

highly efficient malolactic fermentation ........................................................... 1

1.1 Abstract .................................................................................................................... 1

1.2 Introduction .............................................................................................................. 1

1.3 Lactic acid bacteria and O. oeni ............................................................................... 2

1.4 Malolactic fermentation ........................................................................................... 3

1.5 The benefits and current limitations of MLF ........................................................... 5

1.5.1 Ethanol and temperature ................................................................................... 8

1.5.2 pH ...................................................................................................................... 9

1.5.3 Sulfur dioxide .................................................................................................. 10

1.5.4 Other stressors ................................................................................................. 10

1.6 Problems caused by stuck fermentation ................................................................. 11

1.7 Strategies to improve O. oeni for better tolerance to the harsh physiochemical

properties of wine ................................................................................................... 12

1.7.1 Molecular genetics .......................................................................................... 14

1.7.2 Classical strain selection ................................................................................. 16

1.7.3 Mutagenesis .................................................................................................... 18

1.7.4 Directed evolution ........................................................................................... 19

1.7.5 Genome shuffling ............................................................................................ 22

1.8 Conclusion .............................................................................................................. 25

1.9 Aims and objectives of the project ......................................................................... 26

Chapter 2. Directed evolution of Oenococcus oeni .......................................................... 28

2.1 Introduction ............................................................................................................ 28

2.2 Materials and methods ........................................................................................... 30

2.2.1 Bacterial strains and maintenance ................................................................... 30

2.2.2 Mismatch repair identification ........................................................................ 31

2.2.3 L-Malic acid determination ............................................................................. 34

2.2.4 Directed evolution using continuous culture .................................................. 35

Page 3: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table of Contents

ii

2.2.5 Screening of the evolving population ............................................................. 35

2.3 Results and Discussion ........................................................................................... 36

2.3.1 Bacterial strain selection ................................................................................. 36

2.3.2 Confirming lack of MMR in SB3 ................................................................... 38

2.3.3 Establishing initial culture conditions ............................................................. 42

2.3.4 Screening of the evolving culture ................................................................... 44

2.3.5 An ethanol tolerant phenotype is observed ..................................................... 46

2.4 Conclusion .............................................................................................................. 47

Chapter 3. Isolation and characterisation of an ethanol tolerant strain of Oenococcus

oeni from a mixed DE culture ......................................................................... 48

3.1 Introduction ............................................................................................................ 48

3.2 Methods .................................................................................................................. 50

3.2.1 Primary screening via micro-scale MLF ......................................................... 50

3.2.2 Secondary screening via small scale MLF ...................................................... 52

3.2.3 Characterisation of ethanol tolerance of evolved isolates ............................... 52

3.2.4 Determination of survival from exposure to high ethanol .............................. 53

3.2.5 MLF performance of evolved cultures in wine ............................................... 53

3.3 Results and discussion ............................................................................................ 54

3.3.1 Primary screening of 180 DE isolates ............................................................. 54

3.3.1 Secondary screening of 27 DE isoaltes ........................................................... 55

3.3.2 Influence of ethanol concentration and temperature on MLF performance

of four selected DE isolates ............................................................................ 58

3.3.3 Investigation of the ethanol tolerance of strain 90 .......................................... 63

3.3.4 MLF performance of the evolved culture in wine .......................................... 65

3.4 Conclusion .............................................................................................................. 67

Chapter 4. Comparative genomics of SB3 with strain 89 and strain 90 ........................... 68

4.1 Introduction ............................................................................................................ 68

4.2 Methods .................................................................................................................. 72

4.2.1 Genomic DNA extraction ............................................................................... 72

4.2.2 Sequencing ...................................................................................................... 72

4.2.3 Sequence assembly and variant discovery ...................................................... 72

4.2.4 SNP analysis and gene ontology (GO) terms ................................................. 73

4.3 Results and discussion ............................................................................................ 73

4.3.1 Mutations in both strain 89 and 90 compared with parent (SB3) ................... 76

4.3.2 Mutations only in strain 90 ............................................................................. 82

4.3.3 Mutations only in strain 89 ............................................................................. 86

Page 4: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table of Contents

iii

4.3.4 Transposable element ...................................................................................... 95

4.4 Summary ................................................................................................................ 98

Chapter 5. Thesis summary and future directions .......................................................... 101

5.1 Conclusion ............................................................................................................ 102

Bibliography ....................................................................................................................... 103

Page 5: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Thesis summary

iv

Summary

Malolactic fermentation (MLF), also known as the secondary fermentation in

winemaking, involves the enzymatic decarboxylation of L-malic to L-lactic acid, by

lactic acid bacteria, usually Oenococcus oeni. This conversion improves the

organoleptic properties of wine and also decreases the risk of microbial spoilage. O.

oeni is a notoriously fastidious microbe prone to slow growth, especially in the harsh

physiochemical environment of wine: high ethanol, presence of sulfur dioxide, low

pH and low temperature. Each of these factors influences the growth rate and

metabolism, including MLF, of this organism.

This study aimed to generate an improved strain of O. oeni with the ability to

withstand the environmental pressures of wine, particularly high ethanol, using

directed evolution (DE). Directed evolution is a non-recombinant method of

generating improved strains. The process involves an organism mutating and

potentially adapting to a high stress environment, in this case a high ethanol

environment, over several hundred generations. This method has been used

successfully to generate improved strains of other lactic acid bacteria and its efficacy

as a method for the production of bacterial strains for the wine industry is detailed

here.

A continuous culture of O. oeni was established in MRS supplemented with 20 %

(v/v) apple juice medium at 30 °C and 5 % (v/v) ethanol. Over the next 290 days and

approximately 260 generations the ethanol concentration in the medium was gradually

increased to 15 % (v/v) ethanol. A sample of this culture was screened for malic acid

consumption (MLF) compared to the original parent.

With proof of concept achieved, individual isolates from the DE culture were

obtained in order to identify clones that demonstrated the ethanol tolerant phenotype to

the greatest degree. An individual isolate, strain 90, was selected and its fermentation

Page 6: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Thesis summary

v

performance was characterised under a range of different ethanol (13, 15, 17 and 19 %

(v/v)) concentrations and temperatures (15, 22 and 30 °C). This strain also retained

viability for 48 hours in a medium supplemented with 22 % (v/v) ethanol, a condition

that lead to an almost total loss of viability in the parent strain after only one hour.

Finally the parent and two evolved strains (90 and 89) were sequenced using

whole genome sequencing. 32 single nucleotide polymorphisms (SNPs) were

discovered in the evolved strains compared to the parent. Twenty of these are non-

synonymous mutations located in nineteen different genes; five of these are located in

both strains. None of the mutations appear in known O. oeni ethanol stress response

genes. GO analysis, BLAST and current literature were used to analyse these changes

and propose possible reasons for the new phenotype.

This study is the first known use of DE for O. oeni strain improvement and results

have confirmed DE can be successfully used as a technique for developing new strains.

Furthermore these findings form the basis of exciting new studies further exploring the

genetic basis for tolerance to ethanol stress.

Page 7: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Declaration of authorship

vi

Declaration of authorship

I certify that this work contains no material which has been accepted for the award

of any other degree or diploma in any university or other tertiary institution and, to the

best of my knowledge and belief, contains no material previously published or written

by another person, except where due reference has been made in the text.

In addition, I certify that no part of this work will, in the future, be used in a

submission for any other degree or diploma in any university or other tertiary

institution without the prior approval of the University of Adelaide and where

applicable, any partner institution responsible for the joint-award of this degree. I give

consent to this copy of my thesis, when deposited in the University Library, being

made available for loan and photocopying, subject to the provisions of the Copyright

Act 1968.

I also give permission for the digital version of my thesis to be made available on

the web, via the University’s digital research repository, the Library catalogue and also

through web search engines, unless permission has been granted by the University to

restrict access for a period of time.

………………………………………. ………………………..

Alice Betteridge Date

Page 8: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Acknowledgements

vii

Acknowledgements

It is said it takes a village to raise a child and the same could be said of a thesis.

This work would certainly not have been possible without a group of people who have

helped and supported me along the way. This PhD experience has been incredible fun

and thank you to everyone who made it so.

I am grateful for the financial assistance provided to me and my project by both

Australian Grape Wine Authority (formerly Grape Wine Research and Development

Corporation) and the University of Adelaide.

Bacterial strains were kindly donated by Erbslögh, Lallemand and Laffort and Dr.

Jelle Lahnstein kindly loaned his recirculating water bath for the duration of the

project. I would also like to express my appreciation to Dr John Toubia for assistance

with genome assembly and Dr Miguel Roncoroni for his efforts assembling and

annotating my genomes.

Thank you to my supervisors Professor Vladimir Jiranek and Associate Professor

Paul Grbin for giving me this amazing opportunity and for all your support and

guidance along the way. Especially thank you for assembling the A-Team of staff and

students in the Wine Microbiology and Microbial Biotechnology Lab. There have

been too many to list individually but I would like to acknowledge in particular Dr

Joanna Sundstrom, Dr Krista Sumby and Dr Jennie Gardener for both technical

support and your epic efforts in reading this thesis as well as my desk buddy Dr. Jin

Zhang, whose cheerful presence makes it a joy to come to work.

My wonderful family; my parents who have always offered steadfast support in

anything I choose to do, Margaret, who has advised me to use the word “thus”

(apparently it makes you sound smarter) and in exchange asked I name my strain for

her and Tom who has solved all my computer problems. Thank you to my

Page 9: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Acknowledgements

viii

Grandmother for her constant support and to my Grandad, I hope he would have been

proud of me.

Finally to my best friends Les and Kate, who have helped, commiserated and

celebrated every step of the way.

Onwards now to the next great adventure.

Page 10: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

List of figures

ix

List of Figures

Figure 1.1. MLF ..................................................................................................................... 4

Figure 1.2. Genome shuffling by recursive protoplast fusion. ............................................ 24

Figure 2.1. Nucleotide sequence alignment of mutS ............................................................ 40

Figure 2.2. Gel image of mutS PCR amplification in O. oeni ............................................. 41

Figure 2.3. L-malic acid consumption of the parent ............................................................ 46

Figure 3.1.A. Configuration of a 96 well micro-titre plate used for micro fermentation .... 51

Figure 3.1.B. Method for high-throuhput screening ............................................................ 51

Figure 3.2. Malic acid consumption of 27 individual isolates from the DE population, ..... 57

Figure 3.3. L-Malic acid consumption of four promising DE isolates ................................ 59

Figure 3.4. L-malic acid metabolism of several novel single isolates ................................. 61

Figure 3.5. Fermentation performance of strain 90 in MRSAJ ........................................... 62

Figure 3.6. The impact of exposure to ethanol, for up to 48 hours, on cell culture

viability of strain 90 and SB3. .............................................................................................. 64

Figure 3.7. Fermentation performance of strain 90 and Parent in Pinot Noir ..................... 66

Figure 3.8. Fermentation performance of strain 90 and LAB in Pinot Noir ........................ 66

Figure 4.1. Two-component system ..................................................................................... 76

Figure 4.2. Oxidative phosphorylation pathway in bacteria. ............................................... 80

Figure 4.3. OEOE_0183 ...................................................................................................... 84

Figure 4.4. Simplified version of the pathway for carbon metabolism ............................... 87

Figure 4.5. Simplified version of the pathway for the biosynthesis of amino acids ............ 88

Figure 4.6. Bacterial RNA polymerase ................................................................................ 91

Figure 4.7. Simplified pathway for pyrimidine metabolism ................................................ 92

Figure 4.8. Mannose metabolism ......................................................................................... 93

Figure 4.9. Transposase from IGV viewer ........................................................................... 96

Figure 4.10.A. OEOE_1495 location in O. oeni PSU-1 ...................................................... 97

Figure 4.10.B. OEOE_t1213 and t1214 in O. oeni PSU-1 .................................................. 97

Page 11: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

List of tables

x

List of Tables

Table 1.1. Key inhibitors in wine of malolactic fermentation and their mechanisms of

inhibition. ................................................................................................................................ 7

Table 1.2. Methods of strain manipulation for use with O. oeni and their advantages

and disadvantages ................................................................................................................. 13

Table 2.1. Bacterial strains used in this study. ................................................................... 30

Table 2.2. PCR cycling conditions ...................................................................................... 32

Table 2.3. List of PCR primers used in this study ............................................................... 33

Table 2.4. Oenococcus oeni starter cultures commercially available in Australia .............. 37

Table 2.5. Influence of incubation temperature on maximum specific growth rate (µ)

for O. oeni in MRSAJ. .......................................................................................................... 42

Table 3.1. Oenococcus oeni commercially available in Australia ....................................... 54

Table 4.1. Genes and their predicted function that may have an effect on the high

ethanol tolerance phenotype of the evolved strain. ............................................................... 71

Table 4.2. Non-synonymous SNPs identified in strains 89 and 90 ...................................... 75

Page 12: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Abbreviations and symbols

xi

Abbreviations and Symbols

# number

% percent

× times

°C degrees Celsius

α alpha

β beta

Δ change

Δp proton motive force

µ maximum specific growth rate

µL microlitre

µM micro molar

3' three prime, of nucleic acid sequence

5' five prime, of nucleic acid sequence

A absorbance

ABC ATP binding cassette

ATP adenosine triphosphate

BC Before Christ

BLAST Basic local alignment search tool

bp base pair

Cat. catalogue

CDD Conserved domain database

(Marchler-Bauer et al., 2013)

CCR carbon catabolite repression

CFA cyclopropane fatty acid

CFU colony forming unit

CTP cytidine triphosphate

DAVID Database for annotation, visualization and integrated discovery

(Huang et al., 2008; 2009)

DE directed evolution

DNA deoxyribonucleic acid

dNTP deoxynucleotide triphosphate

EDTA ethylenediaminetetraacetic acid

EMS ethyl methanesulfonate

g gram

gDNA genomic DNA

Page 13: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Abbreviations and symbols

xii

GMOs Genetically modified organisms

GO gene ontology

GOT glutamate-oxaloacetate transaminase

GTP guanosine triphosphate

H+ hydrogen ion

HCl hydrochloric acid

HGT horizontal gene transfer

hrs hours

HSP heat shock protein

IS insertion sequence

kb kilobase

KEGG Kyoto encyclopedia of genes and genomes

(Kanehisa and Goto, 2000; Kanehisa et al., 2014)

L litre

LAB lactic acid bacteria

LB lysogeny broth

L-MDH L-malate dehydrogenase

M molar

max maximum

MDR multidrug resistance

mg milligram

min minimum

mL millilitre

MLF malolactic fermentation

MMR methylated mismatch repair

Mn2+

manganese ion

MQ sterile ultra-pure water

MRS de Man, Rogosa and Sharpe

MRSA MRS agar

MRSAJ MRS supplemented with 20% apple juice

N/A not applicable

NAD+ nicotinamide adenine dinucleotide, oxidised

NADH nicotinamide adenine dinucleotide, reduced

NADP+ nicotinamide adenine dinucleotide phosphate, oxidised

NADPH nicotinamide adenine dinucleotide phosphate, reduced

NCBI National Center for Biotechnology Information

ng nanogram

Page 14: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Abbreviations and symbols

xiii

nm nanometres

NSW New South Wales

NTG N-methyl-N'-nitro-N-nitrosoguanidine

OD600 optical density measured at 600 nm

PBS phosphate buffered saline

pHi intracellular pH

PCR polymerase chain reaction

PEG polyethylene glycol

PRPP phosphoribosylpyrophosphate synthetase

RNA ribonucleic acid

rpm revolutions per minute

SA South Australia

SAM S-adenosyl methionine

SNP single nucleotide polymorphism

SO2 sulfur dioxide

TAE tris-acetate EDTA

tRNA transfer RNA

U unit

USA United States of America

USD USA dollars

UTP uridine triphospahte

UV ultra violet

v/v volume per volume

VIC Victoria

WMMBT Wine Microbiology and Microbial Biotechnology Laboratory

Page 15: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

1

Chapter 1. Strategies to improve the stress

tolerance of Oenococcus oeni to enable highly

efficient malolactic fermentation

1.1 Abstract

Oenococcus oeni is an important micro-organism for the wine industry; the

stabilisation, deacidification and organoleptic changes that it facilitates in wine

through malolactic fermentation (MLF) are an integral part of the production of many

wines. Wine is typically a nutritionally poor environment and has physiochemical

properties that can hinder the growth of O. oeni: low temperature, low pH, high

ethanol content and the presence of sulfur dioxide. The bacterium is notoriously

fastidious in its growth and metabolic requirements, and therefore its management can

add significant cost to wine production both through loss of wine quality due to

spoilage, and added direct costs related to the use and maintenance of cultures. The

optimisation of O. oeni is therefore a priority for addressing inefficiencies in processes

using this organism. A range of optimisation strategies, including recombinant and

non-recombinant, are reviewed with a focus on biotechnological methods of gene

recombination, classical strain selection, mutagenesis, directed evolution and genome

shuffling.

1.2 Introduction

Malolactic fermentation is a critical step in the production of most red, many

sparkling and some styles of white wines. The efficiency of the lactic acid bacterium

responsible for this fermentation, O. oeni, is therefore of great importance to the wine

industry. This review discusses the current limitations of MLF, particularly those

caused by the presence of physiochemical inhibitors of O. oeni in wine, specifically

low temperature, high ethanol, low pH and sulfur dioxide. Strategies for manipulating

Page 16: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

2

this bacterium to overcome these stresses are presented. Where wine-related

information is not available the review draws on examples from other food-related

lactic acid bacteria (LAB).

1.3 Lactic acid bacteria and O. oeni

Lactic acid bacteria are Gram positive, microaerophilic and characterised by the

formation of lactic acid as a primary metabolite of sugar. The genera that have been

isolated from wine are Lactobacillus, Pediococcus, Leuconostoc and Oenococcus

(Dicks and Endo, 2009; Fugelsang and Edwards, 2007).

Oenococcus contains two species, the originally described species O. oeni (Dicks

et al., 1995) and O. kitaharae, which was isolated from composting distilled shochu

residue (Endo and Okada, 2006). Oenococcus is named from the Greek oinos,

meaning wine. Oenococcus oeni can be identified as Gram positive, non-motile,

asporogenous, ellipsoidal to spherical in shape and usually arranged in pairs or short

chains (Garvie, 1975; Lonvaud-Funel, 2000). Optimal growth occurs between 20 °C

and 30 °C and at a pH between 4.8 and 5.5 (Garvie, 1975). However, even under these

conditions it is a nutritionally fastidious microbe prone to slow growth and poor malic

acid conversion (Kunkee, 1968; 1984; Lonvaud-Funel, 2000).

The main bacterial species found on grape skin belong to the Lactobacillus

genus. However, the only species typically found in wine at the completion of MLF is

O. oeni, with the population increasing throughout alcoholic fermentation and

proliferating throughout MLF (Renouf et al., 2008). For these reasons, as well as its

acid tolerance and desirable flavour effects, O. oeni is the preferred species to carry out

the MLF (Henick-Kling, 1993; Kunkee et al., 1964; Kunkee, 1984; Lafon-Lafourcade

et al., 1983).

Page 17: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

3

1.4 Malolactic fermentation

Malolactic fermentation is not technically a fermentation, but the enzymatic

decarboxylation of the dicarboxylic L-malic acid to the monocarboxylic L-lactic acid

by LAB. There are no free intermediates but the reaction requires NAD+ and Mn

2+ as

co-factors (Caspritz and Radler, 1983; Naouri et al., 1990; Spettoli et al., 1984). The

three genes responsible for this fermentation have been isolated and sequenced. They

are present in a single cluster with mleA (malolactic enzyme) and mleP (malate

permease, responsible for the active transport of malate into the cell) on the same

operon and mleR, the regulatory protein transcribed in the opposite direction (Figure

1.1) (Bartowsky, 2005). Optimal conditions for the enzyme activity of mleA are

pH 5.0 and 37 °C, though there is a non-competitive inhibition by ethanol (Naouri et

al., 1990) therefore conditions for this enzyme in wine are not optimal.

Whilst MLF increases the pH of the wine, this increase does not stimulate the

growth of O. oeni (Pilone and Kunkee, 1976). Instead the increase in the intracellular

pH (pHi) by MLF confers an energy advantage to the cell. The resulting increase in

the proton motive force (Δp) across the cell membrane combined with specific

ATPases facilitates the production of ATP (Cox and Henick-Kling, 1989; 1990, 1995).

Low pH inhibits sugar metabolism (Henick-Kling, 1993) and malolactic fermentation

has possibly evolved as an energy-producing mechanism for LAB, particularly as this

may be the only means available to the cell to generate ATP at a low pH (Bartowsky,

2005).

Page 18: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

4

Figure 1.1. MLF involves the active transport of L-malic acid into the cell by malate permease

(mleP; red). Decarboxylation of L-malic acid is facilitated by the malolactic enzyme (mleA)

and requires NAD+ and Mn

2+ as co-factors before lactate is finally transported out of the cell

(green). This process is regulated by a regulatory protein MleR. The increase in the

intracellular pH by MLF confers an energy advantage to the cell. The resulting increase in the

proton motive force across the cell membrane combined with specific ATPases (yellow)

facilitates the production of ATP. Adapted from Bartowsky (2005).

Page 19: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

5

1.5 The benefits and current limitations of MLF

The removal of L-malic acid, one of the major carbon sources in wine, during

MLF leads to a reduced risk of spoilage from the growth of undesirable

microorganisms. In addition, the process ameliorates acidity and further contributes to

highly desirable sensory outcomes, resulting in an increased complexity of wine aroma

and flavour. Several compounds are formed during MLF which can lead to changes in

wine aroma and flavour profiles. Most well described is the buttery flavour compound

diacetyl; however, the production of esters, alcohols and other carbonyl compounds

results in buttery, spicy, vanilla and smoky notes, as well as a softer, fuller mouthfeel

(Malherbe et al., 2012; Sumby et al., 2010; Swiegers et al., 2005). Different strains,

both in nature and available commercially, show different properties in terms of

sensory compounds formed (Malherbe et al., 2012). Oenococcus oeni generally

occurs naturally in wines and thus spontaneous MLF during or after alcoholic

fermentation is common. Many wineries also inoculate with commercial starter

cultures of bacteria after alcoholic fermentation is complete, in order to help ensure an

efficient and timely MLF; however, even with starter cultures, the growth of LAB is

often inhibited and thus MLF stalled. As explained, MLF and the growth of O. oeni

are clearly inhibited by a number of physiochemical properties of wine. The four key

wine parameters inducing stress and affecting MLF are ethanol (can exceed 16 %

(v/v)), low pH (typically less than 3.5), sulfur dioxide (SO2) (over 10 mg/L) and low

temperature (can be below 12 °C) (Henick-Kling, 1993). Table 1.1 highlights the

characteristics of these stressors in the wine environment that lead to inhibition of

growth and MLF and can ultimately lead to cell death. In addition these stressors can

affect enzyme activity of the cell leading to a loss of MLF. In combination the effect

of these stressors is more severe. An almost total loss of cell viability was found after

only 30 minutes of exposure to a wine-like environment, in analysing the combined

effects of an acid (pH 5.5 to pH 3.5), ethanol

Page 20: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

6

(0 -10 % (v/v)) and cold shock (30 °C to 14 °C) on membrane fluidity (Chu-Ky et al.,

2005). For these reasons improved stress tolerance would appear to be beneficial in

increasing efficiency of MLF, and in fact there is evidence that O. oeni strains

performing a faster MLF also show an increased relative expression of several stress

response genes (Olguín et al., 2010). Similarly an increased expression of mleA

(malolactic enzyme) was found in the better performing strains. However, only the

initial malolactic enzyme activity was shown to determine MLF velocity, as in the

middle and at the end of MLF the slower performing strains had higher transcriptional

levels of this enzyme. This finding suggests that the increase in mleA at the onset of

MLF was responsible for the increased performance. This work could be further

examined by purifying and quantifying the enzyme in order to investigate a potential

link between its adaptation to wine and an affinity for malic acid.

Page 21: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table 1.1. Key inhibitors in wine of malolactic fermentation and their mechanisms of inhibition.

Inhibitors Comments Optimal condition Typical wine

conditions

Inhibitory mechanism References

Ethanol Produced during alcoholic

fermentation

5 % is considered

stimulatory to growth

12 – 15 % (v/v) Disrupts cell membrane

structure and fluidity

(da Silveira et al., 2002; 2003)

Low pH Acidity from grape berries

and winemaker intervention

4.8 – 5.5 3.0 – 4.0 Reduces growth and

malolactic activity

(Henick-Kling, 1993)

Low temperature Wineries often rely on

ambient temperature for MLF

25 °C 12 oC – 20

oC Affects growth rate and

increases lag phase

(Henick-Kling, 1993)

Sulfur dioxide Produced by yeasts and added

to prevent spoilage during

processing

0 mg/L 10 – 70+ mg/L Reduces ATPase activity,

decreases cell viability

(Carreté et al., 2002)

Page 22: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

8

1.5.1 Ethanol and temperature

Ethanol tolerance is important for bacterial growth in wine (da Silveira et al.,

2002). The tolerable concentration of ethanol varies depending on a number of factors

including pH and temperature. Ethanol disrupts cell membrane structure and increases

its fluidity, affecting membrane-associated processes such as stress-resistance and

malolactic activity (da Silveira et al., 2002; 2003(Silveira et al., 2004)). Ethanol alters

the physiochemical properties of the plasma membrane and affects the interactions

between its proteins and phospholipids with the ratio of phospholipids to proteins

within the plasma membrane decreasing in response to ethanol stress (Garbay and

Lonvaud-Funel, 1996). The bacterial cell responds to ethanol shock by increasing its

cyclopropane fatty acid (CFA) content, which counteracts the effect of ethanol on

membrane fluidity ((Couto et al., 1996)Grandvalet et al., 2008). Tolerance to this

stressor is achieved via several mechanisms. Heat shock proteins (HSP) can be

important in the stress tolerance of the cell. The over-expression of three small HSPs

in Lb. plantarum resulted in a clearly improved tolerance, with an increased viability

in 12 % (v/v) ethanol (Fiocco et al., 2007). Interestingly, O. oeni has been reported to

grow faster, and have increased metabolic activity, at 5 % (v/v) ethanol compared to

0 % (v/v) (Lonvaud-Funel, 2000); however, at concentrations above 5 % (v/v) ethanol

is inhibitory.

G-Alegría and colleagues (2004) clearly showed the growth inhibitory effects

of ethanol and temperature on O. oeni in wine-like conditions (18 °C and 13 % (v/v)

ethanol) where the culture took an extra 96 hours to reach the same density as the

control (growing at 30 °C without ethanol). Unfortunately this study did not measure

L-malic consumption, and so it is not possible to determine the effects that this growth

rate had on MLF. In addition, the cultures were inoculated at a density of

approximately 108 CFU (colony forming units) /mL, whereas it is considered that MLF

Page 23: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

9

is able to take place once cell densities reach 106 CFU/mL (Lonvaud-Funel, 1999). It

is therefore possible that, although the culture grew much slower than the control, it

still may have been undergoing MLF.

The effect of ethanol concentration on O. oeni is inversely related to

temperature. An increase in ethanol concentration decreases the optimal temperature

for growth, and high temperatures decrease ethanol tolerance (Asmundson and Kelly,

1990). This is partly due to membrane rigidification of cold-shocked O. oeni cells,

combined with the fluidising effect seen in ethanol-shocked cells. Cells undergoing

the combined shock (of cold and ethanol) retain a higher viability than cells with

ethanol shock alone (Chu-Ky et al., 2005). Given the average ethanol concentration of

wine (12 – 14 % (v/v)), the optimal temperature for the growth of O. oeni is between

20 °C and 30 °C. Temperatures below this increase the lag phase of O. oeni and

decrease the growth rate. Since wines undergoing MLF are often below 20 °C,

delayed and slow growth of O. oeni is not an unexpected problem in the wine industry.

At 10 °C growth of O. oeni ceases almost completely (G-Alegrı́a et al., 2004).

1.5.2 pH

The pH of wine preferred by many winemakers is between 3.2 and 3.5 for red

wine and in the order of 2.8 to 3.4 for white wines, greatly dependent upon style. Acid

shock exerts a rigidification effect on the cell membrane (Chu-Ky et al., 2005).

Oenococcus oeni has a greater ability to grow at pH values below 3.4 than other wine

LAB genera (Davis et al., 1988). This is because O. oeni is able to maintain a higher

pHi value at a low external pH, unlike other LAB in which intracellular systems that

rely on proton motive force fail (Henick-Kling, 1993). The pH of wine can also affect

the tolerance of O. oeni to SO2 because the proportion of anti-microbial forms of SO2

in solution changes with a fluctuating pH.

Page 24: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

10

1.5.3 Sulfur dioxide

Sulfur dioxide can be generated by yeast or is added to wine as a preservative.

At low pH values, as found in wine, the proportion of molecular sulfur dioxide; the

form that diffuses freely into the cell, increases. Once inside the cell, sulfur dioxide

takes the form of the bisulfite ion and can react with proteins and nucleic acids, and

inhibit enzymes, leading to cell death. Sulfur dioxide also inhibits MLF by reducing

ATPase activity and decreasing cell viability (Carrete et al., 2002). Oenococcus oeni

are less susceptible to SO2 lethality after being inoculated into a medium supplemented

with sulfite if they are first preconditioned in a medium of pH 3.5 (wine-like) with 15

mg/L SO2, possibly because adaptation to sub-lethal levels of SO2 helps the cells to

maintain a constant intracellular pH (between 5.8 – 6.3) (Guzzo et al., 1998). This

process could decrease the concentration of free SO2 within the cell, and consequently

increase cell viability (Guzzo et al., 1998). This finding implies not only a direct

negative combined effect of SO2 and decreased pH on cell viability, but also a possible

link between resistance to these combined stressors.

1.5.4 Other stressors

A number of other stressors may also influence MLF, and recent research has

investigated some of the lesser-known inhibitors of this process. The strain of yeast

chosen for alcoholic fermentation can directly affect the growth of O. oeni and the

rapidity of the resulting MLF (e.g. Patynowski et al., 2002). This effect is hypothesised

to be caused by yeast-derived inhibitors of MLF. For example cryotolerant strains of

yeast produce succinic acid and β-phenylethanol, which is known to inhibit growth of

LAB (Caridi and Corte, 1997). Other putative yeast-derived inhibitors include fatty

acids, peptides, phenolic compounds and, as discussed, SO2, which can all lead to a

decrease in viability (Carrete et al., 2002; Osborne and Edwards, 2006; 2007)(Campos

et al., 2009). Fatty acids have also been shown to decrease the malolactic activity of

Page 25: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

11

the cell (Capucho and San Romão, 1994). Additionally, as yet unknown inhibitors are

likely to be present during the wine-making process. In a study comparing the growth

and malolactic activity of O. oeni in different wines, an unknown toxic compound was

found to exist in the Chardonnay wine which decreased the viability of the bacterial

cell and also seemed to directly affect the malolactic activity (Gockowiak and

Henschke, 2003). For a further review of physiochemical properties affecting MLF,

see Bauer and Dicks (2004).

1.6 Problems caused by stuck fermentation

As shown, a number of factors can inhibit MLF. Such inhibition can result in a

fermentation process that is protracted, in some cases for months, or may require

repeated and often costly re-inoculations. In attempting to encourage MLF the

addition of SO2 may be delayed thus increasing the risk of spoilage or the production

of undesirable by-products (Lonvaud-Funel, 1995). In addition the wine must often be

warmed, increasing the environmental impact of the winemaking process. If not borne

by the producer, the costs associated with this extended and inefficient process are

passed on to the consumer. Clearly, strategies are required to improve this bacterium

and options for carrying this out are discussed below.

Page 26: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

12

1.7 Strategies to improve O. oeni for better tolerance to the

harsh physiochemical properties of wine

Methods for strain improvement can be divided into two main approaches,

recombinant and non-recombinant, with each having its own advantages and

disadvantages (Table 1.2). Recombinant techniques are highly specialised and

controlled but are often focused on the addition or deletion of specific genes. This

requires an intricate knowledge of gene identity as well as the understanding of

functions and interactions, prior to manipulation. Non-recombinant approaches

require little prior knowledge of the genetic basis of a trait, but making changes can be

time consuming and often random and with pleiotropic effects. In evaluating these

approaches it is important to consider uses of LAB beyond the wine industry. LAB are

widely used in the production of fermented foods and constitute a majority of the

volume and value of starter cultures (Hansen, 2002). The range of commercial LAB

exploited for food and beverage production is diverse and makes a substantial

contribution to the global economy. Globally fermented fresh dairy products represent

a total economic value of USD54.2 billion annually, whilst turnover for cheese alone

in 2007 was estimated at USD74.2 billion (Mills et al., 2010). Hence a majority of the

research on LAB is contributed from the perspective of the dairy industry. This review

draws on examples from this research in addition to the work available for wine, in

order to suggest possible solutions to improving the stress tolerance of O. oeni.

Page 27: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table 1.2. Methods of strain manipulation for use with O. oeni and their advantages and disadvantages.

Method Approach Advantages Disadvantages

Molecular genetics Recombinant Highly specific for the intended improvements Requires in-depth knowledge of the relevant genetics. May need to

contend with views on the use of genetically modified organisms in

the food and beverage industries

Classical strain

development

Non-recombinant Strain selection based on desirable traits Likely to be limited by extent of natural phenotypes

Mutagenesis Non-recombinant Increases genetic diversity. Potential for

multiple gene changes

Selection can be time consuming. Requires a stringent screening

method. Induces non-specific changes

Directed evolution Non-recombinant Potential for highly specific improvements i.e.

selection and screening occur simultaneously

Process can be time consuming. Difficulties in defining appropriate

selective conditions for desired phenotype. Possible loss of desirable

attributes

Genome shuffling Non-recombinant Potential for multiple gene changes.

The fastest non-recombinant method

Requires a stringent and specific screening process

Page 28: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

14

1.7.1 Molecular genetics

Over-expression of native genes or expression of foreign genes in O. oeni may

be achieved via introduction of plasmid DNA, as is used widely in other microbes.

The first example of genetic exchange was actually demonstrated in LAB when

Pneumococcus was transformed in 1928 (Renault, 2002). Transformation requires

either the chemical formation of competent cells or the forced transfer of DNA via

electroporation. Transformation is difficult in O. oeni, unlike other LAB. Although

electroporation was used successfully to transform the plasmid pGK13 into O. oeni

strains PSU-1, ML-34 and 19CI (Dicks, 1994), this transformation has not been

confirmed in other laboratories. More recently, a new electroporation protocol using

ethanol as a membrane-fluidizing agent led to the successful introduction of a foreign

vector encoding a truncated form of the ClpL2 protein into O. oeni ATCC BAA-1163

(Assad-García et al., 2008). This work has not yet led to an increase in published

accounts of molecular transformations of this bacterium, possibly due to the low copy

numbers of this particular plasmid (pGID052) (Beltramo et al., 2004). Plasmid copy

number is important in gene replication as an increased number increases gene dosage

and therefore product yield (Spath et al., 2012). A new plasmid, pCB42, was isolated

and found to be capable of replicating successfully within O. oeni; however, the

transformation frequency was low (Eom et al., 2010). Oenococcus oeni contains

several native plasmids (Shareck et al., 2004) which are able to replicate themselves

within O. oeni and some of which may have higher copy numbers. Using the origin of

replication from these native plasmids, modification and the inclusion of genes of

interest and markers into existing plasmids may generate a plasmid more effective for

over-expression.

Another method of expression of foreign genes in O. oeni is transduction,

which is the process by which bacteriophages carry bacterial genes from one cell to

Page 29: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

15

another. This is theoretically possible in O. oeni as bacteriophages can be one of the

causes of a failed MLF (Davis et al., 1985); however, the mechanisms of infection

have not yet been fully elucidated and this method needs further research before being

applied to this bacterium.

The final method of genetic manipulation, conjugation, is the direct horizontal

transfer of genetic material between two cells, usually on a plasmid or other mobile

genetic element. Conjugative transposons are mobile genetic elements capable of

independent replication and insertion of a copy within the genome. An example is the

conjugative transposon Tn6098, which encodes the capacity to utilise α-galactosides in

L. lactis isolated from plants (Machielsen et al., 2011). It was characterised and

transferred into a strain of L. lactis derived from milk, enabling the recipient strain to

grow well in soy milk (a substrate rich in α-galactosides) but retaining the flavour-

forming capabilities important in dairy L. lactis (Machielsen et al., 2011). Oenococcus

oeni PSU-1 contains 14 transposons (Mills et al., 2005); however, problematically the

current methods of conjugation for O. oeni do not allow for gene replacement, as the

transfer frequency is lower than the recombination frequency (Beltramo et al., 2004;

Zúñiga et al., 2003).

It is difficult to apply any of these techniques to O. oeni, as they are most

beneficial when allowing the removal or addition of genes, and therefore the individual

genes associated with optimisation of stress resistance would first need to be

identified. Stress resistance, the primary focus of this review, generally involves

multiple genes at multiple loci. In the yeast Saccharomyces cerevisiae, the important

oenological traits such as fermentative vigour, ethanol yield and temperature tolerance

are determined by a multitude of genetic loci, which are broadly distributed throughout

the genome (Giudici et al., 2005). This is likely to also be the case in O. oeni making

targeted genetic manipulation highly complex. The main stresses affecting MLF (high

Page 30: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

16

ethanol, low pH, low temperature and SO2) interact at a physical level, and potentially

also at a genetic level. Improving tolerance for an individual stress may thus adversely

affect the organisms’ ability to survive a different stress.

Whilst the technical problems associated with molecular genetic manipulation

of O. oeni are numerous, another important issue relates to the purported opposition

and legislative blocks to the use of genetically modified organisms (GMOs) in food

and beverage production. In order to genetically modify organisms for use within the

food industry, certain strictures must be applied. Selection markers need to be food

grade and not based on antibiotics (Renault, 2002), and the genetic elements

introduced should be derived from plasmids or genes of the same bacterial species in

order to constitute a “self-cloning” system (Coffey et al., 1994). However, due to

pressure from some consumer groups as well as government regulations, GMOs can be

difficult to apply industrially, even when they are food grade (Pedersen et al., 2005).

Alternative methods of genetic engineering, which take advantage of the diversity of

existing microflora and improve strains by non-recombinant methods are therefore

more practical, at the present time, for industrial applications.

1.7.2 Classical strain selection

The oldest and simplest method of identifying superior strains is to take

advantage of natural diversity; isolate strains from nature and screen them for desired

traits. There are records of fermented food/drinks dating back as far as 1500 BC

(Abdelgadir et al., 1998) and these fermentations were typically optimised through

inoculation via a small quantity of a previously performed, successful fermentation.

These successive inoculations have created populations of LAB that are suited

specifically to the particular fermentative environment. O. oeni is a prime example of

a LAB evolved to occupy a very specific ecological niche, with its relative tolerance,

compared with other LAB strains, to the fluctuating environment of alcoholic

Page 31: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

17

fermentation and the harsh physiochemical conditions it must survive. Intraspecific

diversity amongst different strains isolated in wineries worldwide has been observed in

several different phylogenetic studies (Bridier et al., 2010; de las Rivas et al., 2004;

Kelly et al., 1993; Sato et al., 2001; Zavaleta et al., 1997), implying a diversity

amongst the specific tolerances to different stressors facing these strains.

With the advent of the ‘omics’ era, whole genome sequencing has flourished

and the amount of genomic information available has increased. Bolotin et al (2001)

published the first fully sequenced LAB genome. The strain, L. lactis ssp lactis, is

now one of the most well-researched of the Gram positive bacteria, surpassed only by

Bacillus subtilis (Kok et al., 2005). At the time of this review, over 237 different LAB

genomes have been fully sequenced and are available for public access. This

increasing library of LAB genomes has allowed accurate representations of

evolutionary pathways of the LAB, as well as comparative and functional genomics

(Makarova et al., 2006). In turn, this wealth of knowledge has allowed a modern twist

on this age old method of classical strain selection. Strains are sequenced and the

genetic traits shown to be beneficial for specific fermentations can be identified and

strains chosen for fermentation based on this (Mills et al., 2010). Bioinformatic tools

for sequence analysis can identify specific sequences, such as genes encoding for

enzymes required for the biosynthesis of amino acids. Strains can then be selected

based on their ability to form certain amino acids, which are the precursors for

desirable volatile aroma compounds (Liu et al., 2008; van Kranenburg et al., 2002).

Oenococcus oeni AWRIB429 has consistently been shown to impart more fruit-driven

characters to wines, and its sequence shows novel genes, which are potential

glycosidases. This finding could lead to strain selection based on specific desired

flavours and aromas (Bartowsky and Borneman, 2011). In addition, specific genes

may be linked to high performance, with O. oeni that exhibited faster MLF screened in

order to isolate genes that correlate with this phenomenon. Although no definitive

Page 32: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

18

trends were found, there was some statistical evidence that changes in a specific

portion of the genome may possibly be responsible (Bon et al., 2009). Whilst these

signs are positive, it is unlikely that the technological traits sought will be found only

by relying on the natural diversity in different phenotypes. Considering the difficulties

still encountered with MLF, it would seem that the commonly used strains are often

not optimal; however, they do provide a basis on which to apply genetic improvement

programs.

1.7.3 Mutagenesis

A simple method to improve the existing genetic diversity is through the use of

mutagens. Mutagenesis is relatively simple and requires no specific genomic

knowledge, just an effective screening process (Parekh et al., 2000). Mutagens include

a variety of chemical or physical agents and modify strains through damage to DNA.

The most common methods of chemical mutagenesis involve the use of compounds

such as ethyl methanesulfonate (EMS) or N-methyl-N'-nitro-N-nitrosoguanidine

(NTG). Resulting mutations are caused by DNA deletions, frameshifts, base

substitutions or rearrangements. The use of mutagens greatly increases the frequency

of mutations and thereby diversity in a population, and is a robust and widely-used

method of strain development. Mutagenesis has the potential to disrupt genes

responsible for undesirable characteristics, flavour properties and stress response

(Parekh et al., 2000). Lactococcus lactis subsp. lactis biovar diacetylactis CNRZ 483

was subjected to mutagenesis by NTG, producing a mutant that was ldh (lactate

dehydrogenase) deficient (Boumerdassi et al., 1997). Lactate dehydrogenase is

responsible for the conversion of pyruvate into lactic acid. This deficiency causes

pyruvate to be converted into substrates other than lactate, increasing the production of

acetoin and diacetyl (Boumerdassi et al., 1997). Further mutagenesis by NTG

produced strains deficient in α acetolactate decarboxylase, increasing the production of

Page 33: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

19

α acetolactate, another important buttery aroma compound (Monnet et al., 2000).

There is currently no published report of this method being applied to generate

superior strains of O. oeni. Mutagenesis involves the random mutation of a genome;

this can therefore also lead to the possible loss of desirable properties. Mutagenesis is

also hampered by its need for an extensive screening of a large population after a

mutagen has been applied. A more efficient way to improve strains is to combine

these steps. Strains can be screened and selected simultaneously via the method of

directed evolution.

1.7.4 Directed evolution

Directed evolution (DE) is also known as adaptive evolution, stationary phase

mutation, directed mutation or stress response mutation (Rosenberg and Hastings,

2003). The best known example is the on-going long-term experimental evolution of

E. coli for more than 55,000 generations (Kawecki et al., 2012). The process involves

an organism mutating spontaneously, and potentially adapting to a high stress

environment. The mutations allow the organism to prosper and proliferate under the

specific stress (Foster, 1999). The process by which organisms adapt is not yet fully

understood. Three possible models of adaptation are presented in the literature (Foster,

1999; Rosenberg, 2001): The first is the adaptive mutation model, in which mutations

might target specific genes to relieve the stress factors. The second is the

hypermutation model, in which mutation rates increase genome wide so that both

adaptive and non-adaptive mutations are stimulated. The final model is the cryptic-

growth model, which suggests that mutation rates do not increase at all, but that extra

DNA replications simply let the normal rate of mutation acting on multiple DNA

copies give the appearance of an enhanced mutation rate. Directed evolution has been

used successfully to change organism function. Lactobacillus plantarum growth on

glycerol under anaerobic conditions is too slow to be accurately measured; however,

Page 34: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

20

after approximately 500 generations under continuous selection using glycerol as a

limiting factor, growth rate had improved by more than an order of magnitude

(Teusink et al., 2009). Another example is the replication of the natural adaptation of

L. lactis from a plant niche to growth in milk in 1,000 generations under laboratory

conditions (Bachmann et al., 2012).

Directed evolution is based upon nature’s evolutionary principle and therefore

lacks many of the deleterious side effects of modern recombinant techniques (Sauer,

2001) provided the culture is adapted within its primary niche. These deleterious side

effects can be summarised as secondary responses or side effects of traditional

metabolic engineering, which can lead to an unusable or unstable microorganism as

changes within a gene or organism may affect the viability and productivity of that

organism in unforseen ways.

Within a DE population the organism must stay viable and functional

throughout the process or it will simply disappear from the population. Deleterious

side effects can still arise within a DE population. In fact mutations that cause

deleterious effects on fitness arise more often than advantageous mutants (Perfeito et

al., 2007). Deleterious mutations accumulate over time within a population due to

genome erosion, in which genes that are not necessary for a specific environment are

lost. Thus a population remains viable within its specific environment, but the

accumulation of deleterious mutants becomes sufficient that the strain is effectively

crippled for growth in any other environment and is therefore highly specialised

(Muller, 1964). This outcome is more damaging in the case of non-recombinant

organisms, as without sexual reproduction they are unable to contain fewer mutations

than their predecessor (Muller, 1964).

A common way of monitoring an evolving population is to monitor insertion

sequences. Insertion sequences are generally small mobile genetic elements.

Page 35: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

21

Monitoring of insertion elements in a batch culture of L. lactis with the ldh gene

deleted, found that a transposition of the insertion sequence IS981 activated a second

lactate dehydrogenase gene (ldhB) to restore lactic acid production under anaerobic

conditions (Bongers et al., 2003). These insertion sequences and other mobile genetic

elements found during sequencing demonstrate a high plasticity within the genome,

which contributes to the ongoing gene decay process, allowing easier external

manipulation of the genome (Kaleta et al., 2010).

The genome of O. oeni PSU-1 has been sequenced (Mills et al., 2005), which

led to the observation of the lack of the genes mutS and mutL, which encode two key

enzymes in the methylated mismatch repair (MMR) pathway (Makarova et al., 2006;

Makarova and Koonin, 2007). The MMR pathway is an excision-repair system, which

corrects nucleotide base pair mismatches, and the presence of mutS and mutL

homologs is required for it to function (Miller, 1996; Oliver et al., 2002). The

correction of mismatches by MutS and MutL decreases the spontaneous mutation rate

of a species, therefore a defect in the MMR system leads to an increase in the mutation

frequency (Miller, 1996). A recent study comparing spontaneous mutation rates of O.

oeni to those of its closely related LAB species Leuconostoc mesenteroides and

Pediococcus pentosaceus, which do contain the relevant encoding genes, showed a

100-fold increase in the rate of spontaneous mutations in response to rifampin and

erythromycin (Marcobal et al., 2008). One possible reason for the loss of MMR was

that a high mutation rate generated beneficial mutations during adaptation to a

restrictive environment such as wine (Marcobal et al., 2008). During adaption an

increased mutation rate leads to an increase of beneficial mutations within a

population; however, once an organism has adapted to that environment, the increased

mutations lead to an increased load of deleterious mutations within that population,

causing a loss of fitness (Taddei et al., 1997). Oenococcus oeni has been shown to be a

rapidly evolving organism (Yang and Woese, 1989) and this, combined with the

Page 36: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

22

inhibitory properties of wine, may in fact make it a perfect candidate for this method of

optimisation.

There is currently no evidence of the generation of de novo functions via

directed evolution (Sauer, 2001); however, the functionality of a pseudogene was

restored in L. lactis during a DE experiment (Bachmann et al., 2012). Additionally

Bergthorsson et al. (2007) do suggest a possible method for the generation of new

genes. If specific genes have, prior to duplication, trace side-activity in addition to the

original gene function, introduction into an ecological niche that favours that minor

innovation will allow natural selection to select for that gene until amplification of the

minor function occurs. This gene is then no longer constrained to maintain its original

function.

1.7.5 Genome shuffling

A potential method to remove neutral or deleterious mutations whilst

preserving useful mutations is genome shuffling. Genome shuffling allows for

changes throughout an entire genome without needing genome sequence information

or any knowledge of the genetic basis of desired traits (Petri and Schmidt-Dannert,

2004). It thus allows for the improvement of poorly understood and/or complex

phenotypes and is a major improvement in techniques for strain improvement and

metabolic engineering (Stephanopoulos, 2002). Parental strains that exhibit subtle

phenotypic improvements are identified and using protoplast fusion, the genomes of

the parents are shuffled. This results in new hybrid strains that exhibit the specific

improvement to a greater degree (Patnaik et al., 2002; Stephanopoulos, 2002; Zhang et

al., 2002) (Figure 1.2). Protoplasts are usually obtained via chemical treatment

(polyethylene glycol (PEG)) (Cocconcelli et al., 1986; Hopwood and Wright, 1978;

Morelli et al., 1987) but can be generated electrically (Assani et al., 2005). Protoplast

formation involves the removal of the cell wall, leaving a fatty membranous sac

Page 37: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

23

containing all the genetic material of the cell. These sacs are then combined or fused

together allowing genetic material from multiple cells to combine. More recently,

femtosecond laser and optical tweezers (Gong et al., 2008) have been applied to more

efficiently pair cells. A microfluidic device has been newly patented which can be

used to trap and pair fusions (Skelley et al., 2009). The strains are then allowed to

naturally regenerate, with the newly recombined cell containing genetic material from

more than one cell. After one round of genome shuffling, 10 % of the cells are pair-

wise recombinants (contain genetic material from two parents), and after two rounds at

least 2 % of the cells have genetic information from any four parental strains (del

Cardayré, 2005). Because the strains undergo a natural homologous recombination,

they are not considered to be genetically modified (Zhang et al., 2002). Whole

genome shuffling has been successfully applied to Lactobacillus spp.. Lactobacillus

delbrueckii was successfully fused with Bacillus amyloliquefaciens in order to

generate a strain that produced greater amounts of L-lactic acid from starchy wastes

(John et al., 2008). Three rounds of genome shuffling in Lactobacillus produced a

strain that could grow to a 70 % higher density at pH 3.8 and generate 40 % more

lactic acid than the wild type (Patnaik et al., 2002). After a third round of genome

shuffling in Lb. rhamnosus a strain was produced that could grow at pH 3.8, compared

to pH 4.4 for the wild type, as well as produce up to 26 % more lactic acid at this pH

(Wang et al., 2007). Additionally, two rounds of genome shuffling were able to

produce strains yielding up to 71.4 % more lactate than the parent (Yu et al., 2008).

Two rounds of genome shuffling can achieve results that previously required 20

rounds of classical strain improvement techniques (Zhang et al., 2002). That is the

difference between 20 years of mutagenesis and selection on the one hand and one

year of selection and genome shuffling on the other. Genome shuffling requires the

screening of millions of individual cells. A stringent screening process is therefore

Page 38: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

24

required making it more difficult to select strains based on performance to multiple

different stresses.

Figure 1.2. Genome shuffling by recursive protoplast fusion. 1. Protoplasts are prepared, cell

walls are removed in a process encouraged by PEG. The DNA is situated within a fatty

membranous sac. 2. Cells are fused together. 3. Recombination of the genetic components

occurs. 4. Cells regenerate their walls and are screened for the desired phenotypes. 5. The

process can then be repeated. Adapted from del Cardayré (2005)

Page 39: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

25

1.8 Conclusion

Malolactic fermentation remains an important step in the production of wine, and

O. oeni, the bacterium responsible for it, is a fastidious and recalcitrant micro-

organism. Methods that are currently applied to other lactic acid bacteria to optimise

performance should also be applicable to this bacterium. The options vary in

feasibility and specificity. Molecular methods of recombination are complex as they

require an in-depth knowledge of the genes responsible for the property of interest and

also an organism amenable to transformation, which O. oeni is currently not. Methods

for transformation or gene knockouts in O. oeni are far from being as reliable and

efficient as seen for other organisms thus this approach is difficult. Even if it were

more readily achievable, the current restrictions on the use of genetically modified

organisms in food and beverage production, means that genetically modified O. oeni

are unable to be used by some industries even if they can improve the quality and

efficiency of the product. Non-recombinant techniques such as strain selection and

mutagenesis are possibilities for the selection of improved strains. Even though they

have been useful until know they can be time-consuming and impractical due to

extended screening time and the possibility that the desired strain cannot be produced

this way. The technique of genome shuffling is a more recent and convenient method

of genetically modifying whole genomes but requires an accurate and stringent

screening process. Directed evolution is a process based on Darwin’s theory of natural

selection (Darwin, 2008). This, like genome shuffling, is a genome wide method of

manipulation without the necessity for gene network knowledge, whilst being a simple

method of diversifying a population.

Strategies of bacterial improvement need not be used in isolation. Molecular

methods, whilst not applicable industrially, are able to identify specific genes and

functions, that can then be manipulated using non-recombinant methods. The

Page 40: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

26

isolation of improved strains from nature coupled with mutagenesis can increase

diversity. The diverse populations can then be fed into further improvement programs

using genome shuffling or directed evolution which, again, coupled together are a

more powerful tool of microbe manipulation than any individual strategy alone.

The primary fermentation step in wine performed predominantly by S. cerevisiae

has been well studied and methods to improve its performance have been applied, with

strains generated via mutagenesis commercially available (Schuller and Casal, 2005).

Directed evolution has generated robust new strains (McBryde et al., 2006), genome

shuffling combined with mutagenesis has produced an alcohol tolerant strain (Hou,

2009), and recombinant strains exist and only await consensus from the consumer

before they are applied industrially (Chambers and Pretorius, 2010; Husnik et al.,

2006). In stark contrast, methods of optimising O. oeni are more limited. The

techniques analysed above could be used in combination to improve the tolerance of

O. oeni for improved environmental tolerances, resulting in an industry ready, efficient

bacterium, imperative for development of the wine industry into the future.

1.9 Aims and objectives of the project

In this review, the importance of MLF in winemaking and the unreliability of the

bacterium responsible for it have been discussed. A range of methods for

improvement of O. oeni have been analysed and of these, DE has been selected as the

most promising method for the production of industrial strains of O. oeni for wine

fermentation.

This PhD project will focus on DE and its efficacy as a method for the

generation of strains of O. oeni, with a particular focus on high ethanol fermentations

in order to ascertain the suitability of DE as a method for the improvement of O. oeni.

A chosen strain will be grown in continuous culture with a stressor being applied until

Page 41: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 1: Literature review

27

an appropriate mutation(s) arises and is fixed within the population, facilitating

robustness under the specific conditions.

Once an improved strain(s) has been generated, whole genome sequencing of this

strain will be performed in order to analyse the genetic basis for the improved

phenotype. The genome characterisation will also lead to advancements in the

knowledge of the genetic basis of stress and stress resistance of O. oeni by determining

which genes/regulons are related to survival in the presence of inhibitors in wine.

Page 42: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

28

Chapter 2. Directed evolution of Oenococcus oeni

2.1 Introduction

Oenococcus oeni is an important micro-organism of the wine industry. The

stabilisation, deacidification and organoleptic changes that it facilitates through MLF

are an integral part of the wine-making process. This bacterium is well known to be

fastidious, a fact especially relevant within an oenological context. Wine is a complex

matrix, possessing physiochemical properties that inhibit the growth and malolactic

activity of O. oeni, consequently MLF is often slow and/or fails. Common inhibitors

in wine include, high ethanol content, low pH, low temperature, low nutrient

availability and the presence of SO2, inhibitory phenolic compounds and acetic acid

(Bauer and Dicks, 2004). To alleviate these stresses a number of strain improvement

methods are available that encompass both recombinant and non-recombinant

protocols. To produce strains practicable for use in the wine industry it is important to

focus on non-recombinant methods since recombinant methods are not favoured by

some consumers. Furthermore the acquisition of stress tolerance is more than likely

dependent on multiple genes thus requiring multiple manipulations at multiple loci.

Directed evolution is a process based on Darwin’s theory of natural selection (Darwin,

2008), thus it is a simple genome wide method of diversifying a population therefore

of the non-recombinant methods, DE is the most promising for the development of

stress tolerant, industry-ready O. oeni strains.

Directed evolution experiments can be performed by either sequential batch or

continuous culture (Sauer, 2001). The batch culture method is also known as a serial

transfer where a small percentage of the population is used to inoculate fresh medium.

This method is limited since only a small portion of cells, and therefore genetic

material, is transferred between batches whilst the majority are removed. In addition,

the multiple phases of growth mean that time is spent on lag phase limiting the number

Page 43: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

29

of generations per batch. However, an advantage for some processes, including wine-

making, is that a batch approach ensures that the culture is exposed to all phases of the

fermentation. On the other hand, a continuous culture is grown in a chemostat and the

population is maintained in a constant environment at a constant growth rate. This

allows for a greater number of generations over time as the culture is continuously

diluted therefore introducing more possibilities for mutations to arise. Given the

likelihood of a desired strain being evolved quicker via continuous culture, this

approach was selected as the preferred method for the directed evolution of O. oeni in

this study.

The alcohol content in wines has been rising in recent decades, with mean

alcohol content increasing from 12.4 % to 14.4 % between 1984 and 2008 in

Australian red wines (Godden and Muhlack, 2010). It is speculated that factors

contributing to these rising levels of alcohol include a warmer climate, vines grown

with more access to nutrition and grapes picked at later stages of maturity. Malolactic

fermentation in wines with a high ethanol content are known to commonly stall

(Zapparoli et al., 2009), consequently ethanol was selected as the focus for this DE

study.

The choice of strain is a critical first step in an experiment of this kind. For

instance, as described in Chapter 1, the O. oeni strains sequenced to date (PSU-1 and

ATCC BAA-1163) lack the MMR pathway. This excision repair system requires the

MutS and MutL endonucleases to correct base pair mismatches (Miller, 1996; Oliver

et al., 2002) . The correction of mismatches by MutS and MutL decreases the

spontaneous mutation rate of a species, thus a defect in the MMR system leads to an

increase in the mutation frequency as well as to an increase in the horizontal gene

transfer among strains (Miller, 1996). Such hypermutability could improve the

diversity of the population in a DE experiment and increase the rate of evolution.

Page 44: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

30

The work described in this chapter focuses on investigating the suitability of DE

as a method for the generation of industrially improved bacteria, specifically O. oeni.

2.2 Materials and methods

2.2.1 Bacterial strains and maintenance

The strains used in this study are listed in Table 2.1. Oenococcus oeni and Lb.

plantarum strains were isolated from commercial packets, rehydrated in sterile ultra-

pure water (MQ) and then cultured on MRS (de Man, Rogosa and Sharpe) agar

(MRSA) plates. Lactobacillus delbrueckii and P. pentosaceus were obtained from the

Wine Microbiology and Microbial Biotechnology Laboratory (WMMBT) culture

collection (University of Adelaide, Waite Campus, Urrbrae, SA) and were cultured on

MRSA plates. An individual colony was selected and inoculated into MRS

supplemented with 20 % Apple Juice (MRSAJ) and incubated at 30 °C for five days

(except V22 which was incubated overnight). Strains were stored at -80 °C as glycerol

stocks (culture grown for five days in MRSAJ and then supplemented with glycerol;

final concentration 25 % (v/v)). Escherichia coli were cultured in lysogeny broth (LB)

overnight at 37 °C.

Table 2.1. Bacterial strains used in this study.

Name Species Brand name Company

SB3 O. oeni Lactoenos SB3 Instant® Laffort, Woodville North, SA

VP41 O. oeni Lalvin VP41® Lallemand, Edwardstown, SA

SK3 O. oeni BioStart® Bianco SK3

® Erbslöh, Altona, VIC

CH16 O. oeni Viniflora® CH16 CHR Hansen, Bayswater, VIC

Oenos O. oeni Viniflora® Oenos CHR Hansen, Bayswater, VIC

V22 Lb. plantarum V22™ Lactobacillus plantarum Lallemand, Edwardstown, SA

LAC37Z Lb. delbrueckii WMMBT Culture collection

PED42X P. pentosaceus WMMBT Culture collection

DH5α E. coli WMMBT Culture collection

Page 45: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

31

2.2.2 Mismatch repair identification

2.2.2.1 Buffers and solutions

Phosphate Buffered Saline (PBS)

In 1 L of dH2O was dissolved 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4

and 0.24 g of KH2PO4. pH was adjusted to 7.4 with HCl and the solution autoclaved at

121 °C for 20 minutes to sterilise.

Tris-acetate EDTA (ethylenediaminetetraacetic acid) (TAE)

To make one litre of 50 × stock solution of TAE 242 g of Tris Base was

dissolved with 57.1 mL glacial acetic acid and 100 mL 0.5 M EDTA in one litre of

MQ. For a 1× working 20 mL of solution was diluted in 980 mL water.

2.2.2.2 Isolation of genomic DNA

Genomic DNA was isolated from bacteria using the UltraClean® Microbial

DNA Isolation Kit (Cat. # 12224-50, MoBio Laboratories Inc., Carlsbad, USA). A

10 mL culture of bacteria was pelleted, washed twice in PBS, resuspended in 1.8 mL

of PBS and subsequently used according to the manufacturer’s instructions.

2.2.2.3 Polymerase chain reaction (PCR)

PCR amplification was performed in 12.5 µL reaction volumes typically

containing 1 U/µL Velocity polymerase (Cat. # BIO-21098, Bioline, Alexandria,

NSW), 5 × Hi-Fi Reaction Buffer, 200 µM dNTPs, 0.4 µM of each primer (Table 2.3),

50 ng genomic DNA. Cycling parameters are listed in Table 2.2. Cycling reactions

were conducted using a BioRad S1000 Thermal Cycler (BioRad, Hercules, USA).

Page 46: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

32

2.2.2.4 Gel purification

PCR products were visualised via electrophoresis on a 2 % agarose gel in 1 ×

TAE buffer. The desired product was excised from the resulting gel and purified using

the Wizard® SV Gel and PCR Clean-Up System (Cat. # A9282, Promega, Madison,

USA). Purity and concentration of the resulting PCR product was determined by

measuring 2 µL of sample on a Nanodrop instrument (ND-1000 spectrophotometer,

NanoDrop, Thermo Scientific, Wilmington, USA). The sample was then sequenced

commercially (Australian Genome Research Facility, Urrbrae, SA).

Table 2.2. PCR cycling conditions.

Temperature (°C) Time (seconds) Repeat

Initial denaturation 98 120 1

Denaturation 98 30

35 × Annealing 62 ± 6 30

Extension 72 15

Final Extension 72 240 1

Page 47: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table 2.3. List of PCR primers used in this study.

Primer Name Sequence (5’-3’) Comment Reference

MutS2Fwd ACMGGYCCVAAYATGKSHGG mutS degenerate primer This study

MutS2Rev GTDCCVCGBCCRAYYTCRTC

e.coliGSTFwd CTTTGCCGTTAACCCTAAGGG E. coli reference gene Pfaffl, 2001

e.coliGSTRev GCTGCAATGTGCTCTAACC

e.coliYjaFwd TGAAGTGTCAGGAGACGCTG E. coli reference gene Clermont et al., 2000

e.coliYjaRev ATGGAGAATGCGTTCCTCAAC

Ld1.Fwd ACATGAATCGCATGATTCAAG Lb. delbrueckii reference gene Furet et al., 2004

Ld2.Rev AACTCGGCTACGCATCATTG

Ppe.Fwd CTTTGTGCCCGGTGGATCCT P. pentosaceus reference gene Cho et al., 2009

PPe.Rev AAAGGCTGCAATGTAGTTGATGCTA

ldhD Fwd GCCGCAGTAAAGAACTTGATG O. oeni reference gene Desroche et al., 2005

ldhD Rev TGCCGACAACACCAACTGTTT

Page 48: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

34

2.2.3 L-Malic acid determination

L-Malic acid concentration was determined using a modified version of the

Boehringer-Mannheim UV method (Boehringer-Mannheim, 1995). This assay is

based on two reactions:

L-MDH

1. L-malic + NAD+ ↔ oxaloacetate + NADH + H

+

GOT

2. oxaloacetate + L-glutamate ↔ L-aspartate + 2-oxoglutarate

L-malic acid is oxidised to oxaloacetate in the presence of L-malate dehydrogenase

(L-MDH). Removal of oxaloacetate by conversion to L-aspartate occurs in a reaction

catalysed by glutamate-oxaloacetate transaminase (GOT). The removal of

oxaloacetate then causes the equilibrium to favour the production of oxaloacetate and

NADH. The NADH formed is stoichiometric to the amount of L-malic and is

measured by absorbance at 340 nm.

Each well of a 96 well micro-titre plate was filled with 150 µL of Solution 1 (0.1

M glycylglycine, 0.1 M L-glutamate (adjusted to pH 10.0 with 5 M NaOH)) and 30 µL

of Solution 2 (0.0164 g/mL NAD+) using a liquid handling robot (Corbett Robotics

CAS3800). The undiluted sample (4 µL) was then pipetted into each well except for

the final column which contained eight standards of L-malic acid solutions ranging

from 0 to 3.5 g/L in 0.5 g/L increments. The plate was inserted into a plate reader

(Infinite 200 PRO, Tecan, Männedorf, Switzerland) and 10 µL GOT solution (0.0269

U/µL), added to each well of the plate using the injectors. The plate was shaken for 3

minutes before measurement at 340 nm (A0). Finally 10 µL of the enzyme L-MDH

(0.0261 U/µL) were added to each well. The plate was shaken for 25 minutes and then

read again at 340 nm (A1). The change in absorbance (ΔA) was calculated (A1 – A0)

Page 49: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

35

and ΔA for each of the standards and a standard curve generated for each individual

plate. This equation was then applied to the ΔA for each of the samples within the

plate to calculate L-malic acid concentration.

2.2.4 Directed evolution using continuous culture

A continuous culture was conducted in a Biostat A plus bioreactor (Sartorius

BBI System GmbH, Goettingen, Germany) and controlled using the MFCS/DA A plus

2.1 software (Sartorius BBI System GmbH). The empty chemostat was autoclaved at

121 °C for 30 minutes and filled with 1,100 mL of MRSAJ at 5 % (v/v) ethanol and

inoculated with a 10 mL culture of SB3 (2.2.1). The volume in the chemostat

remained stable via a level sensor, feed/effluent pumps and control software. The feed

medium was MRSAJ and the feed rate slowly decreased over the course of the

experiment as the maximum specific growth rate (µ) of the population slowed.

Ethanol was added separately to the culture, at a constant rate, throughout the course of

the experiment. The culture was kept at 30 °C and stirred constantly at 100 rpm. The

culture was fed continuously for 332 days (7959 hours) with a gradual increase in

ethanol concentration to 15 %. The culture was sampled weekly and OD600 was

determined along with plating on to MRSA to determine viability. Once the culture

feed had surpassed 13 % (v/v) ethanol the O. oeni population was sampled and

screened for improvement in L-malic acid consumption compared to the original

parent strain.

2.2.5 Screening of the evolving population

Screening was performed in quadruplicate in 200 µL of MRSAJ with 15 % (v/v)

ethanol in 96 well micro-titre plates (Cat. # 3596, Corning Incorporated, New York,

USA). Eight identical plates were generated from an individual source plate in order

to enable sacrificial sampling over an 8 – 10 day period. This allowed a fresh plate to

be analysed at each time-point for monitoring of the depletion of L-malic acid, without

Page 50: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

36

influencing the fermentation performance of the small volume. Each plate was sealed

with a membrane (Cat. # 100-SEAL-PLT, Excel Scientific, Victorville, USA) and

incubated statically at 30 °C in an anaerobic vessel (Cat. # 260671, 260001, BD

Diagnostic Systems, North Ryde, NSW). At each time point the L-malic acid

concentration was determined using the enzymatic method described in 2.2.3.

2.3 Results and Discussion

2.3.1 Bacterial strain selection

All commercially available strains of O. oeni available in Australia at the

commencement of this study were considered for inclusion (Table 2.4). A strain that

appeared to be the most average, was selected based on manufacturer commentary

about its tolerance to the major physiochemical stressors found in wine. As discussed

in Chapter 1, inhibition of O. oeni by stressors is generally concomitant as is the

tolerance or resistance to these stresses. Therefore selecting a strain that performs

poorly to most stressors may suggest that it lacks the genes/SNPs necessary for further

improvement of stress resistance, whereas a strain that is already highly stress tolerant

may already be highly evolved to its specific niche and may not be able to be improved

using DE. The Laffort SB3 strain of O. oeni was selected as the most suited for this

DE experiment as it displayed the most average stress tolerance and was therefore

thought to be a good candidate for DE.

Page 51: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

37

Table 2.4. Oenococcus oeni starter cultures commercially available in Australia, including

manufacturer commentary about their tolerance to the major physiochemical stressors found in

wine. The strain in bold was selected as the parent for the evolution experiment. Other

highlighted strains (*) were selected for screening in Section 3.2.5.

Company Strain name pH

(min)

Temperature

°C (min)

Ethanol %

(v/v) (max)

SO2 mg/L

(max)

CHR Hansen Viniflora® CH35 3.1 15 14 45

CHR Hansen Viniflora® CiNe 3.2 17 14 30

CHR Hansen Viniflora® CH11 3.0 14 15 35

CHR Hansen Viniflora® Oenos* 3.2 17 14 40

CHR Hansen Viniflora® CH16* 3.4 17 16 40

Lallemand Enoferm Alpha® 3.2 14 15.5 50

Lallemand Enoferm Beta® 3.2 14 15 60

Lallemand Lalvin 31® 3.1 13 14 45

Lallemand Lalvin Elios 1® 3.4 18 15.5 50

Lallemand Lalvin VP41®* 3.1 16 16 60

Lallemand Lalvin Elios Blanc 3.3 16 14.5 45

Lallemand PN4™ MBR 3.0 16 15.5 60

Laffort Lactoenos 450 PreAc® 3.6 16 17 80

Laffort Lactoenos 350 PreAc® 2.9 15 16 80

Laffort Lactoenos B28 PreAc® 3.1 16 16 80

Laffort Lactoenos SB3 Instant®* 3.3 16 15 50

Laffort Lactoenos B16 Standard® 3.1 16 16 60

Erbslöh BioStart® Vitale SK11

® 3.0 16 15.5 50

Erbslöh BioStart® Bianco SK3

®* 3.0 13 13.5 45

Erbslöh BioStart® Forte SK2

® 3.0 14 14.5 45

Average 3.2 15.5 15.1 53

Page 52: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

38

2.3.2 Confirming lack of MMR system in SB3

After selecting SB3 as the candidate for evolution, based on its oenological

properties, it was important to confirm that it too lacked the MMR system. This would

ensure the selected strain had an increased rate of hypermutability (Marcobal et al.,

2008) and would improve the efficiency and likelihood of success in a DE experiment.

Because of the role of MMR in repairing DNA damage, elimination of the MMR

system in B. subtilis has revealed to increase stationary-phase mutagenesis indicating

that the absence of MMR is also an important factor in the mutagenesis of non-

growing cells. (Pedraza-Reyes and Yasbin, 2004).

A PCR approach was designed with the hypothesis that the mutS gene would

be absent and thus unable to be amplified in O. oeni. The key mismatch repair gene

mutS has been shown to be highly conserved across all prokaryotes (Jiricny, 2006).

The mutS genes in bacteria have been well characterised and several of these from

different species were selected as candidates to design degenerate primers to. These

included both Gram positive and Gram negative bacteria in order to have the widest

range of mutS gene sequences to help ensure primer specificity. The bacteria were

Pseudomonas aeruginosa (Oliver et al., 2002), Azotobacter vinelandii (Le et al.,

1993), Staphylococcus aureus (O’Neill and Chopra, 2002; Prunier and Leclercq,

2005), B. subtilis (Ginetti et al., 1996), Salmonella typhimurium (Haber and Walker,

1991; Pang et al., 1985) and E. coli (Li et al., 2003). A degenerate primer pair

(MutS2; Table 2.3) was designed to a highly conserved region within these

characterised mutS genes (Figure 2.1).

This primer pair was tested for specificity in E. coli and then used to

successfully amplify mutS from two different lactic acid bacteria closely related to O.

oeni; Lb delbrueckii and P. pentosaceus (Figure 2.2). These primers were

subsequently tested on three different strains of O. oeni (VP41, SK3 and SB3) and

Page 53: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

39

mutS was unable to be amplified suggesting it is lacking in these three strains,

including SB3 (Figure 2.2). Included were also a reference gene for O. oeni

(ldhD)(Figure 2.2, D) and a reference strain, Lb. delbrueckii (Figure 2.2, F and G).

The products that were amplified by the degenerate primers in O. oeni were the correct

size for mutS (Figure 2.2, A and B); however, BLAST results did not show a

similarity. The possibility of designing primers based on nearby genes was

considered. However whilst the MMR system is highly conserved across bacterial

species, its location on the chromosome varies greatly even amongst closely related

LAB, therefore genes located near the MMR locus cannot be used to help prove its

existence or absence. The possibility that the designed primers do not work in O. oeni

despite successful amplifying mutS in other LAB was deemed too remote to be

considered further.

Page 54: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Figure 2.1. Nucleotide sequence alignment of mutS in P. aeruginosa, A. vinelandii, S. aureus, B. subtilis, S. typhimurium and E. coli.

Location of a degenerate primer pair to amplify mutS across bacterial species is shown.

.

Page 55: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

41

Figure 2.2. Gel image of mutS PCR amplification in O. oeni (SB3) and Lb. delbrueckii.

Annealing temperatures used were: 1, 56°C; 2, 56.8°C; 3, 58.4°C; 4, 60.7 °C; 5, 63.6°C; 6,

66°C; 7, 67.3 °C and 8, 68°C. SB3 ldhD is an O. oeni reference gene. Lb. delbrueckii mutS is

used as a control strain for mutS primers and Ldel as a reference. The products that were

sequenced are boxed in red (A-G). D, F and G are the expected reference products. A and B

are the correct size for mutS in O. oeni; however, BLAST results did not show similarity.

Page 56: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

42

2.3.3 Establishing initial culture conditions

Before commencing a long-term DE experiment it is necessary to establish the

optimal conditions for the production of the desired phenotype. In order to maximise

the number of generations, a nutritional MRSAJ medium rather than wine was used in

the chemostat. Ethanol was applied and progressively increased as a stress upon the

growing culture (Section 2.2.4). If a beneficial mutation confers a 10 % selective

advantage it would take approximately 250 generations to become fixed in the

majority of the population. For this reason experiments of this type aim to culture for

at least 300 generations (Lenski, 2010). Even under highly optimal conditions, to

achieve 300 generations would take at least 111 days (Table 2.5).

Table 2.5. Influence of incubation temperature on maximum specific growth rate (µ) for O.

oeni in MRSAJ.

Temperature (°C) µ (h-1

) Doubling time

(hours)

Days to reach 300

generations

21 0.025 27.84 348.0

25 0.042 16.46 205.8

30 0.054 12.77 159.6

35 0.078 8.96 111.9

40 Did not grow N/A N/A

Temperature is well known to affect ethanol toxicity (Section 1.5.1), thus for

this experiment it was important to find a suitable temperature at which to perform the

experiment in order to efficiently drive the appearance of mutations. Optimal growth

temperature was also sought to encourage maximum growth rate so as to keep the total

experimental time to a minimum. Optimal growth of O. oeni has been reported to be

between 20 and 30 °C (Garvie, 1967); however, in this experiment growth rate was

fastest at 35 °C (Table 2.5).

Page 57: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

43

No growth was observed at 30 °C once ethanol was introduced to the medium,

indicated by no change in OD600 and no viable cells observed from plating after seven

days. Presumably this was because toxicity of ethanol is enhanced at 35 °C

(Asmundson and Kelly, 1990), thus the working temperature was lowered to 30 °C.

Initially 5 % (v/v) ethanol was added to the growing culture, which resulted in a

maximum specific growth rate (µ) of 0.052 and a doubling time of 13.43 hours. Once

the maximum specific growth rate was achieved ethanol was immediately increased to

6% (v/v). Considering SB3 is known to grow at 15 % (v/v) (Laffort Oenologie, 2010)

this implied cells were not highly stressed at only 6 % (v/v) ethanol; however, this

previously reported growth was in a low temperature wine fermentation, and as

mentioned, with temperature increase ethanol toxicity becomes more severe (Chapter

1).

The culture was fed continuously for 332 days with a gradual increase in

ethanol concentration to 15 %, which in turn increased the generation time to 31.8

hours, at which point the cultivation was terminated. Between 250 and 589

generations were calculated to have occurred based on the original and final generation

times respectively.

The nature of a chemostat experiment involves the ability of the cell to remain

viable and continue to divide under the selective pressure. It is necessary to constantly

stir the population to help ensure uniformity of culture and medium and to minimise

the advantage experienced by subsets of the population that may evolve mechanisms to

remain within the vessel i.e. by developing an ability to attach to the surface of the

vessel (Dykhuizen and Hartl, 1983). Instead it was anticipated, in this case, that

selection will result in an ability to tolerate increased concentrations of ethanol. The

culture was stirred continuously at 100 rpm. Since the growth of O. oeni is favoured

by anaerobic conditions (Lonvaud-Funel, 1999) so it is possible that the use of inert

Page 58: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

44

gas cover (e.g. N2) could further improve the growth rate of the organism; something

to be considered for future DE experiments.

2.3.4 Screening of the evolving culture

An efficient screening process was vital to confirm the presence of a superior

phenotype. Three separate commercial isolates VP41, SB3 and SK3 were chosen to

determine if a difference in ethanol tolerance could be established in the evolving

culture. VP41 is a highly ethanol tolerant strain reportedly able to conduct MLF in

wine with up to 16 % (v/v) ethanol (Lallemand, 2010). Conversely, SK3 is reported to

have a lower ethanol tolerance (c.a. 13.5 % (v/v) (Erbslöh, 2010)). It was reasoned

that a strain that exhibits a high tolerance to ethanol would grow better under high

ethanol conditions and would also be undertaking MLF efficiently in these conditions.

For this reason, a convenient assay that measured growth under different ethanol

conditions was established. Initially gradient plates were considered since they have

proven to be a successful and simple method of screening lactic acid bacteria (Patnaik

et al., 2002). A gradient plate has a gradient of stressor from one end of the plate to

the other (i.e. concentration of ethanol from low to high). In this case, uniform growth

was observed in an ethanol gradient (data not shown). Presumably this occurred since

during the time required to grow O. oeni (approximately seven days) the ethanol

gradient across the plate had dissipated. Individual agar plates with fixed ethanol

concentrations (e.g. 5 % – 15 %) were therefore trialled. Again, no significant

differences were noted in the relevant ethanol tolerances of the three test strains with a

majority of the population not viable at an ethanol concentration of 9 % (v/v) and

above at 30 °C. This assay was not able to differentiate strain ethanol tolerance.

Presumably assays such as these on solid media are not translatable to what occurs in

liquid culture (such as the chemostat), where cells in a liquid culture are immersed in

high ethanol whereas on a solid medium the exposure (and therefore tolerance) is

Page 59: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

45

possibly different. Small scale liquid fermentations in 96 well micro-titre plates were

therefore investigated and the growth of the bacteria measured over time. Preliminary

results showed no correlation between biomass formation and L-malic acid

consumption (data not shown).

MLF occurs when the cell density reaches approximately 106 cells/mL (Lonvaud-

Funel, 1999) and since removal of malic acid is the most important function of O. oeni

it was concluded that the best method of monitoring the evolving population was

simply by screening L-malic acid consumption under high ethanol conditions rather

than analysing cell growth.

Page 60: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

46

2.3.5 An ethanol tolerant phenotype is observed

Once the culture feed had surpassed 13 % (v/v) ethanol the O. oeni population

was sampled and screened for improvement in L-malic acid consumption compared to

the original parent strain. Malolactic fermentations were performed on the evolving

population at 6961 hours (290 days) as described (2.2.4). The fermentation profile of

the parent (SB3) and the evolved population were very similar when no ethanol was

added to the growth medium (Figure 2.3). However, in the presence of ethanol (15%

(v/v)) the evolved population consumed all the L-malic acid at least 69 hours sooner

than the parent (89.5 hours vs 158.5 hours) showing an apparent phenotype of

improved ethanol tolerance.

Figure 2.3. L-malic acid consumption of the parent (SB3, circles) and the evolved population

(squares) at 0 (closed symbols) and 15% (open symbols) (v/v) ethanol, respectively in

triplicate cultures in MRSAJ at 30 °C. The evolved culture consumed available L-malic acid

69 hours prior to the parent.

0 50 100 150 2000

1

2

3

Time (hrs)

L-M

ali

c (g

/L)

Page 61: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 2: Directed evolution

47

2.4 Conclusion

Directed evolution was performed on O. oeni SB3 and preliminary

characterisation of the mixed population (grown for 290 days, reaching 13 % ethanol),

revealed a culture that fermented L-malic more rapidly than the parent in MRSAJ

supplemented with 15 % (v/v) ethanol. This is the first study targeting this O. oeni and

ethanol tolerance and shows that DE can be successful in the generation of a

population with improved MLF performance.

After generating the population that displayed superior MLF under elevated

ethanol concentrations, I next sought to identify individual clones, from the evolving

population, that exhibited this phenotype, to the greatest extent and to characterise

them in order to understand their fermentative performances.

Page 62: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

48

Chapter 3. Isolation and characterisation of an

ethanol tolerant strain of Oenococcus oeni from a

mixed DE culture

3.1 Introduction

In Chapter 2, the isolation of an evolved population from a culture of the

bacterium O. oeni SB3 was described. This mixed culture was able to complete MLF

in MRSAJ media in a shorter duration than the parent strain. This chapter will

describe the isolation and characterisation of individual clones from the evolved O.

oeni mixed population with enhanced ethanol tolerance. In an asexually reproducing

micro-organism the progeny will always contain more mutations than the parent as

there is no option of sexual reproduction to introduce fresh genetic material (Bachtrog

and Gordo, 2004). Another method of introducing genetic diversity can be through

horizontal gene transfer from other bacteria; however, in an enclosed population such

as a chemostat there is not the avenue for this as there is in nature (van Reenen and

Dicks, 2011). This reduction in opportunity for genetic diversity does not mean there

are limited opportunities for random mutations. Whilst ethanol was chosen as the

main stressor, In a chemostatic culture such as this what limits the diversification of

the population is in fact its capacity to remain within the vessel and reproduce (Sauer,

2001). This could include mutations that increase vessel wall “stickiness” or the

ability to grow nearer the surface and partially minimise exposure to the stress.

Nonetheless it is most likely that individuals within the population arise with different

mutations and thus mechanisms of surviving within the stressful environment. It is

important therefore to screen a proportion of the population, in order to establish which

individuals have the high-ethanol tolerant phenotype and what proportion of the

population they represent and to isolate the specific individuals within the population

that have this phenotype to the greatest extent. As such this chapter will describe the

Page 63: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

49

isolation and characterisation of individual strains of O. oeni from the mixed evolved

culture with enhanced ethanol tolerance.

Initially 180 isolates from the mixed population were selected and screened in

micro-fermentations. From these, 27 isolates were then selected as their performance

was significantly improved. These were reassessed in larger 10 mL and 50 mL

fermentations. Finally four were selected based on their ability grow and conduct

MLF the fastest. These four were characterised under a range of different ethanol

concentrations and temperatures with one isolate, strain 90, found to be the most

efficient. Strain 90 was then compared to the parent in order to determine the limits of

its tolerance to ethanol.

Page 64: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

50

3.2 Methods

3.2.1 Primary screening via micro-scale MLF

A sacrificial 96 well micro-titre plate experiment was designed to measure

growth and L-malic acid consumption of evolved isolates in MRSAJ at 15 % (v/v)

ethanol supplemented with 1 g/L L-malic acid (Figure 3.1.B). Each isolate was

analysed in quadruplicate. A sample of the DE mixed culture taken at 332 days (15 %

(v/v) ethanol) was plated onto MRSA plates and 180 individual colonies were selected

and inoculated into individual wells of two deep-well plates each containing 1 mL of

MRSAJ. Deep-well plates were sealed with a breathable membrane (Cat. # AXY BF-

400, Adelab, Thebarton, SA) and incubated statically at 30 °C for three days. Strains

were stored at -80 °C as glycerol stocks (final concentration of glycerol 25 % (v/v)).

The remaining sample was diluted 1:5 in MRSAJ containing 15 % (v/v) ethanol and 10

different source plates were generated (Figure 3.1.A). The samples on the source plate

were arranged in quadrants so that, for each quadruplicate fermentation, the influence

of the position of the sample in the plate was minimised. Finally 10 μL of diluted

inoculum from each source plate was transferred to a 96-well plate (each well

containing 190 μL of sterile MRSAJ with 15 % (v/v) ethanol), using a liquid-handling

robot (Corbett Robotics, Model # CAS3800). Six identical plates from each source

plate were created and these plates were incubated statically and anaerobically, in

anaerobic jars, at 30 °C. A fresh plate was then sampled at each of the six time points.

The plates were sampled regularly and monitored by determining L-malic acid

consumption. The concentration of L-malic acid was calculated for each time point

using the enzymatic method described in Section 2.2.3.

Page 65: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

A

B

Figure 3.1. A. Configuration of a 96 well micro-titre plate

used for micro fermentation screening of individual

isolates from an evolved population. Each plate contained

a sample of the mixed DE culture, the parent (SB3) and 18

different isolates. B. Flow diagram representing the

method for isolating 180 clones.

Page 66: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

52

3.2.2 Secondary screening via small scale MLF

A subset of isolates, selected from the micro fermentation plate-based

screening exercise, were evaluated in small-scale laboratory fermentations.

Fermentations (10 mL and 50 mL) were performed in triplicate in MRSAJ with 15 %

(v/v) ethanol at 22 °C or 13 % (v/v) ethanol at 30 °C, respectively. Strains were grown

in MRSAJ for seven days to an OD600 > 1.0 and then inoculated to fresh MRSAJ, with

either 13 or 15 % (v/v) ethanol, at a dilution of 1 in 50. Samples were taken regularly

and L-malic acid concentration was determined enzymatically as described in 2.2.3.

3.2.3 Characterisation of ethanol tolerance of evolved isolates

Four strains were selected from the trials described in 3.2.2, based on their

increased L-malic acid consumption in two conditions. These four strains were

characterised for their tolerance to ethanol at different fermentation temperatures. The

parent (SB3) was used as a reference along with the mixed population from the

original DE culture used for isolation of individuals and a mixed population of a

natural LAB isolate from a Grenache wine MLF at 17 % (v/v) ethanol (Yalumba Wine

Company, Barossa Valley – strain GJ) (Jin et al., 2013).

Strain GJ is part of a project undertaken by another PhD student monitoring

lactic acid bacterial populations of uninoculated wine fermentations. Samples of

fermenting Grenache were plated out and individual colonies picked and made into

glycerol stocks for further analysis. For this work next 10 randomly selected glycerols

were grown in 10 mL MRSAJ at 30 °C until an OD600 > 1.0 was obtained. After

strains were visualised microscopically and confirmed as O. oeni, 1 mL of each strain

was mixed together to form a mixed population referred to as strain GJ. Strain GJ was

stored at -80 °C as a glycerol stock (final concentration of glycerol 25 % (v/v)).

Page 67: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

53

Promising single isolates from this study, mixed population GJ, parent SB3 and

the DE mixed population used to obtain single isolates in this study, were grown in

MRSAJ to an OD600 > 1.0 and inoculated in triplicate into MRSAJ at either 13, 15, 17

or 19 % (v/v) ethanol. These fermentations were incubated at 15, 22 or 30 °C. The

fermentations were sampled regularly and analysed for L-malic acid consumption

(according to 2.2.3) and plated onto MRSA medium to confirm viability.

3.2.4 Determination of survival from exposure to high ethanol

The most promising isolate obtained from this study and the parent of the DE

(SB3) were grown in MRSAJ to an OD600 > 1.0. An aliquot (200 µL) of each was then

inoculated into 10 mL of MRSAJ with 0, 20, 21, 22, 23 or 24 % (v/v) ethanol. These

fermentations were then sampled at 1, 12, 24, 36 and 48 hours after inoculation. A

dilution series of 100, 10

-1, 10

-2, 10

-3, 10

-4 and 10

-5 was carried out and 2 µL samples

were spotted onto MRSAJ agar. Plates were incubated in anaerobic jars at 30 °C for

seven days prior to visualisation.

3.2.5 MLF performance of evolved cultures in wine

The fermentation performance of the most promising single isolate and its

parent (SB3) were evaluated in a red wine fermentation to confirm that the isolates

high ethanol tolerance was not restricted to MRSAJ fermentations. This strain was

also compared with a number of commercially available isolates in order to evaluate

its performance.

The most promising single isolate, the parent SB3 and a number of commercial

isolates (Table 3.1) were grown, in MRSA, to an OD600 > 1.0 and inoculated into

10 mL of 0.22 µm filtered Pinot Noir wine (Tasmania, 13 % (v/v) ethanol). In

addition, the most promising single isolate and SB3 were also inoculated into the same

Pinot Noir wine supplemented with ethanol to 15 % (v/v). Samples (200 µL) were

Page 68: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

54

taken regularly and analysed for L-malic acid consumption according to the methods

described in 2.2.3.

Table 3.1. Oenococcus oeni starter cultures commercially available in Australia selected for

this study, including manufacturer commentary about their tolerance to the major

physiochemical stressors found in wine.

Company Name pH

(min)

Temperature

°C (min)

Ethanol %

(v/v) (max)

SO2

mg/L

(max)

CHR Hansen Viniflora® Oenos 3.2 17 14 40

CHR Hansen Viniflora® CH16 3.4 17 16 40

Lallemand Lalvin VP41® 3.1 16 16 60

Erbslöh BioStart

® Bianco

SK3®

3.0 13 13.5 45

Lallemand V22™ Lb. plantarum 3.5 17 15.5 50

3.3 Results and discussion

3.3.1 Primary screening of 180 DE isolates

Directed evolution was performed with O. oeni SB3 and preliminary

characterisation of the mixed population revealed a culture that fermented L-malic

more rapidly than the parent in MRSAJ supplemented with ethanol (see Figure 2.3).

DE populations are typically mixed cultures of clones, with varying phenotypes,

therefore screening of clonal isolates was undertaken in order to purify and identify an

individual clone of the population that displayed the highest ethanol tolerance. To this

end, 180 single isolates were selected for screening. In order to facilitate the screening

of this large number of isolates a high through-put method was developed and

implemented. Similar studies in yeast have shown that a comparable determination

can be made between the performance of a larger volume fermentation to a screen in a

micro-scale (Liccioli et al., 2011). Therefore a micro-titre sacrificial sampling

Page 69: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

55

experiment was designed in order to screen 180 isolates from the DE culture, in

quadruplicate fermentations at six time points according to section 3.2.1. There was

varied fermentation performance amongst these strains and they were chosen based on

their ability to consume L-malic acid in shortest time in 15 % (v/v) ethanol MRSAJ at

30 °C (data not shown).

A drawback of such micro-scale screening can be variations amongst samples.

Oenococcus oeni forms chains and pairs in liquid cultures so sampling of the

population can be less representative than organisms that exist in a singular

arrangement. When an inoculum is then divided into quadruplicate from this organism

and then replicated multiple times it is possible to get some variability in total cell

numbers in replicate wells due to cell aggregation which would influence the results.

Additionally, in a large screen, it is difficult to inoculate all cultures at an identical cell

number and therefore some isolates that grew faster initially may have a higher

inoculum than others.

Twenty seven isolates of the initial 180 were selected based upon their ability

to consume L-malic acid fastest. Twenty seven was decided upon as that allowed for

triplicate culture samples to be analysed in a 96 well micro-titre plate format.

3.3.2 Secondary screening

Twenty seven isolates from the mixed DE population were highlighted for

screening in larger fermentations in order to isolate the most ethanol tolerant strain.

The 27 isolates were cultured in 10 mL fermentations using the same conditions as the

primary screening (anaerobically in 15 % (v/v) ethanol at 30 °C); however, these

conditions led to immediate loss of viability of the culture. It is likely that due to the

small volume of the micro-titre fermentations, combined with the breathable

membrane seals, ethanol could have evaporated during the experiment, resulting in

Page 70: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

56

screening actually being performed at a lower ethanol concentration. Therefore, when

repeating the secondary screening of the 27 isolates in 10 mL cultures, the conditions

were made less stringent by the temperature being reduced to 22 °C. In addition, the

ethanol concentration of fermentations conducted at 30 °C was reduced to 13 % (v/v)

and the volume was increased to 50 mL. This still resulted in highly toxic conditions

with most of the selected isolates struggling to perform (Figure 3.2). In the 15 % (v/v)

ethanol fermentations that were incubated at 22 °C, the majority (22) of the 27 strains

were able to complete this fermentation and excitingly most had a superior

performance compared with the parent (SB3).

The mixed DE strain also struggled to perform under these conditions. As this

is a mixed population its performance varies amongst assays probably dependant on

how ethanol tolerant the predominating members of it are in any specific inoculum.

From the combined results strains 2, 76, 89 and 90 (shown in blue; Figure 3.2) were

chosen as the best examples of the high-ethanol tolerant phenotype and were

stringently examined under a range of different temperatures and ethanol

concentrations in subsequent work.

Page 71: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Figure 3.2. Malic acid utilisation of 27 clonal isolates from the mixed DE population, the mixed DE population and the parent (SB3). All samples were screened in

either 50 mL MRSAJ at 30 °C or 10 mL MRSAJ at 22 °C supplemented with 13 % or 15 % (v/v) ethanol, respectively. Values are the averages of three biological

replicates and error bars indicate the standard deviation. Four isolates, strains 2, 76, 89 and 90 (blue) were selected for further characterisation.

0 50 100 150 200 2500

1

2

3

4

50 mL 30 C 13 % (v/v) ethanol

Time (hrs)

L-M

ali

c (g

/L)

10 mL 22 C 15% (v/v) ethanol

Time (hrs)

L-M

ali

c (g

/L)

0 50 100 150 200 2500

1

2

3

4

DE Mix population

Parent (SB3)

Strain 176

Strain 160

Strain 136

Strain 135

Strain 124

Strain 114

Strain 90

Strain 89

Strain 76

Strain 72

Strain 58

Strain 57

Strain 53

Strain 50

Strain 38

Strain 41

Strain 37

Strain 34

Strain 29

Strain 25

Strain 17

Strain 12

Strain 15

Strain 6

Strain 5

Strain 3

Strain 2

Page 72: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

58

3.3.3 Influence of ethanol concentration and temperature on MLF

performance of four selected DE isolates

The four best performing strains, 2, 76, 89 and 90, were compared and

characterised at different ethanol concentrations and temperatures according to Section

3.2.3. The ethanol concentrations tested were 13, 15, 17 and 19 % (v/v) and were

examined in combination with varying temperatures; 15, 22 and 30 °C, and these

fermentations were monitored for five weeks (828 hours). None of the strains grew at

any of the ethanol concentrations at 30 °C (data not shown) highlighting the

recalcitrant, fastidious nature of this bacterium (Chapter 1). At 22 °C, strain 90

showed a clear fermentation advantage, compared to the parent, mixed population and

other single isolates, for all ethanol concentrations (Figure 3.3). The parent (SB3) was

generally the poorest performing strain.

At 13 % (v/v) strain 90 completed fermentation in 65 % of the time of the next

fastest strain, 89, and 15 days faster than the slowest isolate, strain 2. At 16 % (v/v)

ethanol only strains 90 and GJ were able to complete fermentation in 348 and 588

hours, respectively. Strains 89 and the DE mixed population were the next fastest but

stalled after consuming 75 % of the available L-malic acid. At 17 % (v/v) ethanol

strain 90’s only competitor was again strain GJ, with 89 and DE consuming 1 g/L of

the available L-malic acid before becoming stuck. At 19 % (v/v) strain 90 had

consumed all but 15 % of the available L-malic acid before halting. This was a

significant improvement on the other isolates (with the exception of GJ) which were

unable to consume any L-malic acid at this ethanol concentration.

Page 73: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

59

Figure 3.3. L-Malic acid consumption of four promising DE isolates strains 2 ( ), 76 ( ), 89 ( )

and 90 ( ) compared to the parent strain (SB3, ), a mixed DE population sample (control, ) and

a mixed population of a wine isolated ethanol tolerant strain (GJ, ). Fermentations were performed

in MRSAJ supplemented with ethanol and incubated at 22 °C. Values are the averages of three

biological replicates and error bars indicate the standard deviation

.

13 % (v/v) ethanol

Time (hrs)

L-M

ali

c (g

/L)

0 200 400 600 800 10000

1

2

3

4

15 % (v/v) ethanol

Time (hrs)

L-M

ali

c (g

/L)

0 200 400 600 800 10000

1

2

3

4

17 % (v/v) ethanol

Time (hrs)

L-M

ali

c (g

/L)

0 200 400 600 800 10000

1

2

3

4

19 % (v/v) ethanol

Time (hrs)

L-M

alic

(g

/L)

0 200 400 600 800 10000

1

2

3

4

Page 74: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

60

At a lower temperature,15 °C, strain 90 was still able to complete MLF in the

shortest duration in 13 % (v/v) ethanol, at almost 400 hours sooner than any other

strain, with the next fastest strain still not finished after 828 hours (Figure 3.4). Strains

89 and GJ were the other closest to completing fermentation in the five week period.

This phenomenon bears further investigation as low temperature tolerant strains would

be of great value to the wine industry. The need for low temperature tolerant strains is

highlighted by no strains completed fermentation under any of the other ethanol

concentrations tested but did retain similar but slower fermentation profiles (data not

shown).

The strain GJ included in this work was a mixed population of O. oeni isolated

from the Yalumba winery from a 17% (v/v) Grenache fermentation. The grapes for

this fermentation were from old bush Grenache vines, typically grapes from these

vines are left to ripen longer in order to develop more flavoursome characteristics. As

these would typically lead to higher ethanol fermentation, this may have allowed for

the possibility of environmental selection, if not evolution of a LAB to niche higher

ethanol fermentations. It would be interesting to compare this strain GJ to strain 90

genetically to see if they have followed similar evolutionary pathways, to adapt to high

ethanol fermentations.

Page 75: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

61

Figure 3.4. L-malic acid metabolism of several novel single isolates (strains 2 ( ), 76 ( ),

89 ( ) and 90 ( ), the parent (SB3, ), a mixed population from the evolved culture

(control, ) and a mixed population of a wine isolated ethanol tolerant strain (GJ, ).

Fermentations were conducted in MRSAJ (13 % (v/v) ethanol) incubated at 15 °C. Values are

the averages of three biological replicates and error bars indicate the standard deviation.

15C 13% (v/v) ethanol

Time (hrs)

L-M

ali

c (g

/L)

0 200 400 600 800 10000

1

2

3

4

Page 76: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

62

3.3.3.1 Fermentation performance of strain 90

From the most promising four single isolates from the DE of parent SB3, it was

clear that strain 90 was the most efficient in catabolising L-malic acid in the presence

of relatively high concentrations of ethanol. The performance of strain 90 under all

available conditions is presented in Figure 3.5. Interestingly the time strain 90 took to

consume half the L-malic acid at 19 % (v/v) at both 15 °C and 22 °C was similar,

perhaps suggesting that MLF capacity of the strain is not changed.

Figure 3.5. Fermentation performance of strain 90 in MRSAJ supplemented with either 13 % (

), 15 % ( ), 17 % ( ) or 19 % ( ) (v/v) ethanol and incubated at either 15 °C (blue)

or 22°C (black). Values are the averages of three biological replicates and error bars

indicate the standard deviation.

0 200 400 600 800 10000

1

2

3

4

Time (hrs)

L-M

ali

c (g

/L)

Page 77: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

63

3.3.4 Investigation of the ethanol tolerance of strain 90

The level of tolerance of strain 90 and the parent (SB3) to ethanol was

investigated by analysing growth in the presence of increasing concentrations of

ethanol (according to 3.2.4). An aliquot of each strain was inoculated into MRSAJ at

ethanol concentrations of 0, 20, 21, 22, 23 or 24 % (v/v) ethanol. These cultures were

then sampled at 1, 12, 24, 36 and 48 hours after inoculation. For both strains

increasing exposure concentration and time to ethanol reduced viability, but to a much

larger extent for the parent (SB3) compared to strain 90. The highest ethanol

concentration (24 % (v/v) ethanol) was, as expected, most inhibitory, such that

incubation times of only 1 hour resulted in no detectable CFUs from the parent culture

whilst strain 90 retained some residual viability with only one or two colonies in the

undiluted sample (data not shown). At 23 % (v/v) ethanol strain 90 had some growth

in the 10-2

dilution after one hour but no growth at any other time points and no visible

growth from the parent at any time point (data not shown). At a reduced ethanol

concentration of 22 % (v/v) ethanol, strain 90 retained viability even after 48 hours,

whilst SB3 had only residual viability after one hour (Figure 3.6, panel C), visually

similar to strain 90 at 24 % (v/v) ethanol. At further reduced ethanol concentrations

(20 % and 21 % (v/v)) similar trends were seen but with higher survival rates (Figure

3.6 – panels A and B, respectively). At 21 % (v/v) the parent (SB3) had minimal

viability of the undiluted culture after 48 hours whereas strain 90 still had growth in

the 10-2

dilution spot. As a control, both strains were incubated in MRSAJ without

ethanol and sampled at each time-point for the duration of the experiment. No

difference in viability between SB3 and strain 90 was observed at any of these time

points.

Page 78: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

64

Parent (SB3) Strain 90

A

B

C

Time (hrs)

Con 1 12 24 36 48 Con 1 12 24 36 48

Figure 3.6. The impact of exposure to ethanol, for up to 48 hours, on cell culture viability of

strain 90 and SB3. Strain 90 and the parent were exposed to 20 (A) 21 (B) 22 (C) % (v/v)

ethanol and sampled after 1, 12, 24, 36 and 48 hours. A dilution series of 100, 10

-1, 10

-2, 10

-3,

10-4

and 10-5

was prepared and 2 µL samples were spotted onto MRSA. Each panel is a

composite of the MRSAJ agar plates at the completion of each period of ethanol exposure as a

10-fold dilution series with the top sample an undiluted 2 µL aliquot. Only the image from

one hour is shown as the control (Con).

Page 79: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

65

3.3.5 MLF performance of the evolved culture in wine

MRSAJ is a highly nutritious medium especially when compared to wine.

There is a possibility that as the population was evolved to a niche environment, in this

case MRSAJ medium, the ability to conduct MLF in wine had been lost or reduced.

To test this, the MLF performance of strain 90 was monitored in Pinot Noir wine

alongside the parent (SB3) and other commercial strains as described in 3.2.4. The

parent and strain 90 were inoculated into Pinot Noir wine with an ethanol

concentration of 13 % (v/v) as well as the same wine with ethanol supplementation to

15 % (v/v). At 13 % (v/v) ethanol strain 90 completed fermentation of the wine in

75 % of the time required by the parent (Figure 3.7). This difference was more

pronounced at 15 % (v/v) ethanol with strain 90 finishing in 40% of the time of the

parent (Figure 3.7). The same Pinot Noir wine was also inoculated with commercially

available strains of O. oeni. In addition, a strain of Lb. plantarum V22 reported to be

an ethanol tolerant strain of lactic acid bacteria (Lallemand) was included but was not

as efficient at MLF as hypothesised. Strain 90 was able to consume all the L-malic

acid in less than 100 hours, approximately 60 % of the time of the most efficient

commercially available strain tested, Oenos (Figure 3.8). Strain 90 therefore,

consistently demonstrates superior performance to its parent (SB3) as well as several

commercially available MLF under all conditions tested.

Page 80: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

66

Figure 3.7. Utilisation of L-malic acid by strain 90 and Parent (SB3) in Pinot Noir at either

13 % or 15 % (v/v) ethanol, incubated at 22 °C. Values are the averages of three

biological replicates and error bars indicate the standard deviation.

Figure 3.8. Utilisation of L-malic acid by strain 90 and LAB commercial isolates in Pinot

Noir at 13 % (v/v) ethanol, incubated at 22 °C. Values are the averages of three

biological replicates and error bars indicate the standard deviation.

Time (hrs)

L-M

ali

c (

g/L

)

0 100 200 300 400 5000.0

0.5

1.0

1.5

2.0Strain 90 13 %

Parent (SB3) 13 %

Strain 90 15 %

Parent (SB3) 15 %

Time (hrs)

L-M

ali

c (

g/L

)

0 100 200 3000.0

0.5

1.0

1.5

2.0 SB3

SK3

VP41

CH16

Oenos

Lb. Plantarum (V22)

Strain 90

Page 81: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 3: Isolation and characterisation

67

3.4 Conclusion

One of the aims of this work was to generate an O. oeni strain that could be used

industrially to improve MLF performance compared to other commercially available

strains. In this chapter, the individual isolate, strain 90, was described. Strain 90

clearly outperformed industry leading strains in terms of tolerance to high ethanol and

MLF performance. This isolate could survive in up to 23 % (v/v) ethanol and could

conduct MLF in MRSAJ at 17 % (v/v) ethanol at 22 °C. This strain was also able to

perform MLF faster at 15 °C an additional improvement of the strain that is desirable

to industry. Strain 90 also completed MLF sooner in Pinot Noir wine at 13 and 15 %

(v/v) ethanol compared to its parent. Further in 13 % (v/v) Pinot Noir was able to

complete malolactic fermentation sooner than five other commercially available

strains.

The next chapter describes whole genome sequencing of strain 90 and its parent

SB3 in an effort to determine what genomic differences existing between the strains

may be responsible for the improved MLF performance of strain 90 in high ethanol

conditions.

Page 82: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

68

Chapter 4. Comparative genomics of SB3 with

strain 89 and strain 90

4.1 Introduction

The preceding chapters describe the generation, selection and phenotypic

assessment of O. oeni strains with a high ethanol tolerant phenotype. This chapter

describes the analysis of genomic changes within these strains and the possible

mutations responsible for this phenotype. The parent (SB3) and two different isolates:

strains 89 and 90 were sequenced using whole genome sequencing and the resulting

genomes were aligned and analysed for changes including single nucleotide

polymorphisms (SNPs), deletions, substitutions and transposons. In order to

hypothesise which genetic changes were responsible for the improved phenotype these

mutations were compared to previously described LAB genes and systems using

NCBI, BLAST and KEGG. This approach was used as the systems and genetic

interactions of other LAB strains have been more intensively studied (see Chapter 1).

Stress response in lactic acid bacteria is the responsibility of a range of genes

that alter different cellular processes. The physiological response of LAB to ethanol

stress has been well studied (Guzzo, 2011; Wen-Ying and Zhen-Kui, 2013). It is

known that ethanol perturbs the bacterial cell membrane leading to leakage of

intracellular proteins. This affects the proton gradient and then influences cellular

processes dependant upon it including ATP synthesis and the transportation of amino

acids (Guzzo et al., 2000). The physiological response of the cell to ethanol stress

seems to consist of firstly an increase in the proportion of CFAs in the membrane by

converting cis vaccenic acid to lactobacillic acid (Teixeira et al., 2002) to counteract

the effect of ethanol on membrane fluidity (Grandvalet et al., 2008) followed by an

increase in membrane protein/phospholipid ratio.

Page 83: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

69

Gene expression studies have shown that a number of genes are involved in the

cellular response to ethanol stress (Table 4.1). For example, Cafaro et al., (2014)

reported that geranylgeranyl pyrophosphate synthase (ggpps) synthesis increased in

response to increasing ethanol concentrations. This may in turn lead to an increase in

carotenoid production possibly influencing cell membrane fluidity. The synthesis of

genes encoding heat shock proteins (HSP) is another important response of the cell

reacting to ethanol stress (Nicolaou et al., 2010). The small HSP Lo18 can bind

membranes to help regulate membrane fluidity and is produced in large amounts under

ethanol stress conditions (Maitre et al., 2014). Furthermore, O. oeni cells exhibiting an

increased synthesis of Lo18 have shown a greater ability to survive in wine and to

perform MLF (Maitre et al., 2014).

In addition to what is known about the genetic response to ethanol stress, Bon

et al. (2009) used comparative genome subtractive hybridization to propose that the

presence of eight stress-responsive genes (six from O. oeni) were associated with high

MLF performance. It was suggested that there is a relationship between genome

variation and malic acid metabolism. They also identified six different regions of

plasticity, resulting from recombination or insertion/deletion events and suggested that

IS30-related elements play a role in O. oeni genome plasticity with genomic

enrichment of IS30 found in better performing MLF strains (El Gharniti et al., 2012).

Additionally in comparing the sequence of 11 strains of O. oeni, Borneman et al.

(2012) found evidence of IS element horizontal gene transfer (HGT), including IS30-

mediated insertion events that appear to be transferred from Lactobacillus spp.

Page 84: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

70

Literature searches lead to the generation of a list of genes that may have an

effect on the ethanol tolerance of O. oeni (Table 4.1). In examining the basis for the

enhancement of the strains generated in this study, it was hypothesised that there may

be some changes in either the listed genes or their promoters, which lead to activation

or increased expression. Additionally it was hypothesised that there would be some

IS-mediated rearrangements of the genome.

Page 85: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table 4.1. O. oeni genes and their predicted function that may have an effect on the high ethanol tolerance phenotype of the evolved strain.

Locus tag Gene

name

Predicted function Reference

OEOE_0078 Short chain dehydrogenase (3-oxo-acyl carrier protein reductase) Bon et al., 2009

OEOE_0086 Hypothetical protein Bon et al., 2009

OEOE_0184 hsp18 Heat shock protein Lo18 Maitre et al., 2014

OEOE_0188 ftsH ATP-dependent Zn protease Bourdineaud et al., 2003

OEOE_0348 Cation (cadmium) transport ATPase Bon et al., 2009

OEOE_0353 DNA-binding ferritin-like protein (oxidative damage protectant) Bon et al., 2009

OEOE_0354 Copper chaperone Bon et al., 2009

OEOE_0355 Crp-like transcriptional regulator (Fnr-like protein) Bon et al., 2009

OEOE_0356

OEOE_0307

OEOE_1811

IS30 Transcriptional repressor of class III stress genes Bon et al., 2009

OEOE_0513 ctsR Transcriptional repressor of class III stress genes Grandvalet et al., 2005

OEOE_0514 clpA ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones Seydlová et al., 2012

OEOE_0570 clpP ATP-dependent Clp protease proteolytic subunit ClpP Olguín et al., 2010

OEOE_0572 spoVK ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones Seydlová et al., 2012

OEOE_0640 uvrB/C ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones Seydlová et al., 2012

OEOE_1085 ggpps Geranylgeranyl pyrophosphate synthase Cafaro et al., 2014

OEOE_1176 cfa Cyclopropane-fatty-acyl-phospholipid synthase Grandvalet et al., 2008

OEOE_1268 Integral membrane protein, interacts with FtsH NCBI

OEOE_1309 dnaK ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones Seydlová et al., 2012

OEOE_1345 omrA ABC-type multidrug transport system, ATPase and permease component Bourdineaud et al., 2004

OEOE_1396 groEL Chaperonin GroEL Grandvalet et al., 2005; Seydlová et al., 2012

OEOE_1397 groES Co-chaperonin GroES (HSP10) Grandvalet et al., 2005

OEOE_1447 rmlB dTDP-glucose 4,6-dehydratase Olguín et al., 2010

OEOE_1702 trxA Thiol-disulfide isomerase and thioredoxin Olguín et al., 2010

OEOE_1729 clpX ATP-dependent protease ATP-binding subunit ClpX Olguín et al., 2010

Page 86: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

72

4.2 Methods

4.2.1 Genomic DNA extraction

Genomic DNA was extracted according to section 2.2.2.2 with some variations.

An individual colony of the bacterium (SB3, 90 or 89) was sequentially inoculated in

10 mL, 50 mL and then 1 L of MRSAJ in order to collect enough genetic material for

sequencing. The manufacturers’ method for alternate lysis of cells for reduced DNA

shearing was implemented with the DNA preparations heated at 65 °C for 10 minutes

and vortexed for a few seconds every two minutes.

4.2.2 Sequencing

All sequencing was performed by Dr. Mike Gardener’s group at The Flinders

University of South Australia and The South Australian Museum. SB3 was sequenced

using Roche 454 sequencing on 1/8th

of a pico-titre plate. When the gDNA was

prepared for strain 90 only Ion Torrent sequencing was available for this and at a

reduced cost thus strain 89 (seemingly the second best performer from Chapter 3) was

also sequenced by this method.

4.2.3 Sequence assembly and variant discovery

The genome of SB3 was assembled with the assistance of Dr. Miguel

Roncoroni using MIRA 4.0 (Chevreux et al., 1999). The final assembly coverage was

32× and was contained in 52 contigs with an N50 76346 and N90 23731.

The consensus genome sequence of SB3 was finished using Contiguator 2

(Galardini et al., 2011) against the sequence of PSU-1 (Makarova et al., 2006).

Shotgun reads from all strains (SB3, 89 and 90) were aligned against this consensus

using bowtie2 (Langmead and Salzberg, 2012). Variant discovery was performed

using SAMtools mpileup (Li et al., 2009) and variants were filtered using custom R

Page 87: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

73

scripts. SnpEff (Cingolani et al., 2012) and SIFT (Ng and Henikoff, 2001) were used

to annotate the variants.

4.2.4 SNP analysis and gene ontology (GO) terms

The list of genes containing SNPs was analysed using BLAST to determine if

they had similarity to genes in other organisms but with different functions. SNPs

located in non-coding regions of the genome were also analysed using BLAST to

ascertain if they were located in important regions in other LAB. The conserved

domain database (CDD) (Marchler-Bauer et al., 2013) was used to discover which

protein families each of the loci belonged to and hypothesises its function based on

this. KEGG pathways were utilised to study important gene interactions (Kanehisa

and Goto, 2000; Kanehisa et al., 2014) and lastly GO terms and gene enrichment was

analysed using DAVID (Huang et al., 2008, 2009).

4.3 Results and discussion

The genome of the parent (SB3) was assembled de novo from sequencing

outputs that represented a high level of coverage and was contained in 52 contigs.

Reads from all three strains, SB3, 89 and 90 were then assembled to this sequence. A

total of 34 genomic changes (32 SNPs and 2 insertions) were discovered across the

two strains when compared to the parent. The insertions were in an “A” repeat, of

varying lengths across reads, in a low coverage area and are at this stage considered a

false result. These insertions need to be confirmed using additional sequencing and

further consideration as both are located in OEOE_1026 which is a DNA

topoisomerase IV subunit B. Topoisomerase IV acts to disentangle the replicated

DNA strands and is the target of two classes of antibiotic drugs: quinolones and

coumarins. These antibiotics are used to treat an assortment of different diseases, by

inhibiting DNA replication in the bacteria responsible. In Lb. plantarum isolated from

various environments there was a significant difference in the protein expression of

Page 88: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

74

DNA topoisomerase IV subunit B (GyrB) during lag phase which suggests a possible

role in environmental adaptation (Koistinen et al., 2007).

Of the 32 identified SNPs 24 were located within the coding region of genes,

with 20 resulting in non-synonymous mutations in 19 different genes (Table 4.2) and

four resulting in synonymous SNPs (data not shown). Two of these SNPs, in

OEOE_0544 and OEOE_1433, are also possible false positives as this is an area of

some heterogeneity within the parent strain. These genes are included in the

discussion below but again require further confirmation of SNPs within these genes.

The eight remaining SNPs (data not shown) were located in various non-coding

regions of the genome and are briefly discussed.

Generally synonymous SNPs are largely ignored in studies of this kind;

however, as this is a small data set the synonymous mutations were also included.

There is evidence that synonymous mutations play a role in some phenotypes,

especially in disease, and frequently with an increased virility in pathogens including

the LAB Staphylococcus aureus (Sauna and Kimchi-Sarfaty, 2011).

Page 89: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Table 4.2. Non-synonymous SNPs identified in strains 89 and 90 when compared with SB3. The locus tags and the purported gene function are included from

NCBI (gene database). GO terms (Huang et al., 2008, 2009) that are enriched in the data set are included. SIFT analysis was performed to determine

whether or not the amino acid changes were tolerated (score closer to 0 means it is more likely to affect protein function).

Locus Tags SNP

Protein

Change Strain Putative Gene Function GO Terms Tolerated

OEOE_0160 tCa/tTa S51L 89 Phosphoribosylpyrophosphate synthetase N 0.00

OEOE_0183 Gtt/Att V1018I 90 Transcription-repair coupling factor ATP Binding, nucleotide binding. Y 0.65

OEOE_0196 tgG/tgT W74C 90 Hypothetical protein Y 0.18

OEOE_0433 cCg/cAg P332Q 90 Translation initiation factor IF-2 (IF-2; GTPase) N/A

OEOE_0517 gGa/gTa G60V 89 ATPase component of ABC transporter ATP Binding, nucleotide binding. N 0.01

OEOE_0544 Tgc/Ggc C388G Both YG repeat-containing glycosyl hydrolase N/A

OEOE_0563 cAc/cGc H73R Both

Serine kinase of the HPr protein, regulates carbohydrate

metabolism ATP Binding, nucleotide binding. Y 0.06

OEOE_0665 gCg/gAg A257E 89 F0F1 ATP synthase subunit beta ATP Binding, nucleotide binding. N 0.00

OEOE_0738 gGa/gAa G236E 89

ABC-type multidrug transport system, ATPase

component ATP Binding, nucleotide binding. Y 0.56

OEOE_0870 Gct/Act A370T 90 Hypothetical protein Y 0.09

OEOE_1168 tAc/tCc Y421S Both Amino acid transporter Y 0.56

OEOE_1173 gTa/gCa V72A Both

3-polyprenyl-4-hydroxybenzoate decarboxylase,

flavoprotein (ubiX) Y 0.09

OEOE_1375 Gtt/Ttt V840F 89

DNA-directed RNA polymerase, beta subunit/140 kD

subunit N 0.00

OEOE_1480 cCg/cTg P482L 89 Transketolase N 0.00

OEOE_1581 tgG/tgT W273C 90 Methylase of polypeptide chain release factor Y 0.13

OEOE_1629 atA/atG I331M Both Polyphosphate kinase ATP Binding, nucleotide binding. Y

OEOE_1647 Aca/Gca T381A 89 Cation transport ATPase ATP Binding, nucleotide binding. N 0.00

Page 90: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

76

4.3.1 Mutations in both strain 89 and 90 compared with parent

(SB3)

4.3.1.1 OEOE_0544 YG repeat-containing glycosyl hydrolase

OEOE_0544 is a glycosyl hydrolase and is involved in two KEGG pathways;

starch and sucrose metabolism (sucrose → D-fructose) and also a two-component

signal transduction system. Two-component systems enable bacteria to adapt to

environmental or intracellular changes (El-Sharoud, 2005). In this case a change in

temperature induces a change in the bacterial cell wall and membrane composition

(Figure 4.1). Additionally from KEGG pathways OEOE_0544 shows similarity with

gtfB/C/D which are glucosyltranferases that catalyse the synthesis of extracellular

glucan and are well studied in the oral bacterium Streptococcus mutans (Senadheera et

al., 2007). Furthermore gtfB/C/D are responsible for the adhesion of S. mutans to teeth

(Tsumori and Kuramitsu, 1997), which is possibly translated to adhesion to bioreactor

walls allowing these mutants to remain within the population additionally in E. coli

genes associated with biofilm formation show an increased expression in response to

ethanol stress (Nicolaou et al., 2010).

©Kanehisa Laboratories

Figure 4.1. Two-component system (KEGG reference ooe_02020) (Kanehisa and Goto, 2000;

Kanehisa et al., 2014).

Page 91: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

77

4.3.1.2 OEOE_0563 Serine kinase of the HPr protein, regulates carbohydrate

metabolism

OEOE_0563 is the serine kinase of the HPr protein. The enzyme HPr kinase

plays an important role in the regulation of carbon metabolism in Gram-positive

bacteria particularly in its regulation of carbon catabolite repression (CCR). CCR is a

mechanism that allows bacteria to coordiante and optimise the utilistaion of

abundantly available carbon sources (Poncet et al., 2004). If a mixture of carbon

sources are available, bacteria have the capacity to preferentially take up and

metabolise the carbohydrates that can be easily transformed. The DE experiment used

MRSAJ medium, which is high in glucose and fructose, a very different environment

from the wine niche the bacterium would generally be found in. The enzyme hprK

may also be involved in cell adhesion (Poncet et al., 2004), another possible side effect

from evolution in a bioreactor. This mutation was predicted to be tolerated thus it may

not affect the function of the protein. It would be interesting to monitor expression of

this gene in wine fermentations by each of the evolved strains and the parent to see if

hprK is indeed involved in the evolved ethanol tolerance phenotype.

4.3.1.3 OEOE_1168 amino acid transporter

According to the CDD OEOE_1168 encodes for a transmembrane amino acid

transporter protein (Marchler-Bauer et al., 2013). Ethanol toxcity acts by pertubing

the cell membrane and affecting membrane processes, including amino acid transport

(Chapter 1). OEOE_1168 is the only gene with two SNPs (ggA tAc / ggT tCc). The

first of these is synomous; however the second is a non synomoous muation predicted

to affect protein function. Further investigation into the effects of this protein change

on the transport of amino acids under high ethanol conditions would be beneficial.

Acetate stress can be mitigated by the addition of the amino acids methionine, glycine,

isoleucine and threonine and has been shown to upregulate select amino acid

Page 92: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

78

transporters in E. coli (Nicolaou et al., 2010). As generally stress response is

concomitant (Chapter 1) this may also assist in ethanol stress tolerance.

4.3.1.4 OEOE_1173 UbiX 3-polyprenyl-4-hydroxybenzoate decarboxylase,

flavoprotein

OEOE_1173 encodes for UbiX, 3-polyprenyl-4-hydroxybenzoate

decarboxylase. UbiX is involved in coenzyme Q biosynthesis especially during

logarithmic growth. As an aside from KEGG pathways ggpps, (OEOE_1085) (Table

4.1) is a part of terpenoid back bone biosynthesis that interacts with the ubiquinone

and other terpenoid-quinone biosynthesis of which UbiX is a member. Even so, it

does not explain the apparently enhanced ethanol tolerance or MLF capability of

strains 89 and 90

4.3.1.5 OEOE_1629 polyphosphate kinase (PPK)

PPK is a membrane protein that catalyses the formation of polyphosphate from

ATP. KEGG pathways reveal a role in oxidative phosphorylation (Figure 4.2). Also

located in the pathway for oxidative phosphorylation is OEOE_0665 (F0F1 ATP

synthase subunit beta. SNP only in strain 89) (see 4.3.3.3).

PPK is also involved in bacterial RNA degradation (KEGG reference

ooe03018). Beside the proteins involved specifically in the RNA degradosome, there

are three associated proteins found in O. oeni. They are PPK, DnaK and GroEL.

DnaK and GroEL are both genes found in the literature that may play a role in ethanol

tolerance (Table 4.1) (Grandvalet et al., 2005). Additionally both have been shown to

activate under ethanol stress conditions in B. subtilis (Seydlová et al., 2012). The

disruption of ppk in Lb. casei showed a decrease in growth rate in the presence of

some stressors, particularly low pH (acid stress). The study also tested the strains

under ethanol stress but found no significant difference in growth rate (Alcántara et al.,

Page 93: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

79

2013) suggesting ppk alone is not responsible for the high ethanol phenotype but may

be an important participant.

Page 94: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

80

©Kanehisa Laboratories

Figure 4.2. F1F0 ATPase for the oxidative phosphorylation pathway in bacteria. (KEGG

reference ooe00190; Kanehisa and Goto, 2000; Kanehisa et al., 2014). Green labels are

known gene loci from O. oeni. OEOE_1629 (2.7.4.1) is polyphosphate kinase (ppk)

containing a non-synonymous mutation in both strains. OEOE_0665 (3.6.3.14 ) is F1F0

ATPase subunit β, a non-synonymous mutation in only strain 89

.

Page 95: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

81

4.3.1.6 OEOE_0927 Acetyltransferase and OEOE_1009 GTPase

OEOE_0927 and OEOE_1009 each contain a SNP in both strain 89 and 90.

These are both synonymous SNPs and therefore do not necessarily affect protein

function. OEOE_ 0927 is a member of the N-Acyltransferase superfamily, which

includes various enzymes that characteristically catalyse the transfer of an acyl group

to a substrate. In S. cerevisiae the gene NAT2 which encodes for a N-α-

Acyltransferase was found to be amongst a list of genes essential towards resistance to

high ethanol concentrations (Teixeira et al., 2009). OEOE_1009 GTPase, another

enzyme, binds and hydrolyses GTP, however, no clear link to ethanol tolerance is

apparent.

4.3.1.7 SNPs in non-coding regions

Both strains contained two identical SNPs in non-coding regions. The first was

located immediately downstream (13 bp) of OEOE_0493 which encodes a

polysaccharide transporter (RfbX). OEOE_0494 which is located upstream of this

SNP is a hypothetical protein. The second was located between OEOE_1705 and

OEOE_1706 but when the region was analysed using BLAST the SNP seems to be

located within OEOE_1705 which encodes methylmalonyl-CoA epimerase.

According to the CDD this protein superfamily is found in a variety of structurally

related metalloproteins and a group of antibiotic resistance proteins. OEOE_1706 is a

hypothetical protein, predicted to be a membrane protein, as ethanol acts by perturbing

the membrane and affecting membrane proteins perhaps OEOE_1706 is important to

ethanol tolerance and requires further investigation.

4.3.1.8 Summary of SNPs in both strains

The genes that contain mutations in both sequenced strains encode for a range

of proteins with different functions. OEOE_0544 and OEOE_0563 appear to possibly

be related to adaption to a different environmental niche. OEOE_1629 appears

Page 96: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

82

important to environmental stress response. It would be interesting to study whether

the other members of the population contain this same mutation. Generating strains

from SB3 with analogous mutations would be useful to confirm the importance of

these SNPs.

4.3.2 Mutations only in strain 90

4.3.2.1 OEOE_0183 Transcription-repair coupling factor (Mfd)

MFD is a widely conserved bacterial protein. MFD recognises RNA

polymerases stalled at a non-coding template site of DNA damage and disrupts the

transcription complex (Roberts and Park, 2004). A defect shows an increased

sensitivity to UV irradiation (Selby and Sancar, 1994). The gene mfd has been isolated

and characterised and found to be involved in transcription coupled DNA repair and

DNA recombination in B. subtilis (Ayora et al., 1996). On the loci the SNP is

immediately downstream of the conserved transcription repair coupling factor (TCRF)

domain of the gene (Figure 4.3).

The gene overlapping OEOE_0183 is OEOE_0184 (Figure 4.3), the gene

hsp18, that encodes a ribosome-associated heat shock protein Lo18 (Table 4.1). Lo18

is produced under ethanol stress conditions and increased synthesis has shown a

greater ability, by O. oeni, to survive in wine and to perform MLF (Maitre et al.,

2014). This amino acid change is predicted to be tolerated by the protein; however, it

would be beneficial to see if this SNP downstream affects the function of OEOE_0184

and subsequent production of Lo18.

Page 97: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Figure 4.3. Image of OEOE_0183 from ncbi (http://www.ncbi.nlm.nih.gov/gene/?term=OEOE_0183). The gene is in green, red symbolises the coding regions and the

black sections are other features based on the CDD. The numbers across the top are the bp locations on the genome of O. oeni PSU-1. The SNP in OEOE_0183 is

located in the conserved TRCF region. OEOE_0184 overlaps OEOE_0183 and is immediately upstream of this SNP.

Page 98: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

84

4.3.2.2 OEOE_0433 Initiation factor 2 (infB)

The sequence for infB is highly conserved and encodes for initiation factor 2

which binds to initiator tRNA and controls the entry of tRNA into the ribosome

(Shazand et al., 1990). The infB protein also interacts with GTPase (Shazand et al.,

1990), including possibly OEOE_1009. Any links to ethanol tolerance and MLF are

not immediately apparent.

4.3.2.3 OEOE_1581 Methylase of polypeptide chain release factor

OEOE_1581 encodes an enzyme that uses S-adenosyl methionine (SAM) as a

substrate for methyl transfer. From the CDD it is a part of the protein family PrmC

(Marchler-Bauer et al., 2013). PrmC activity is crucial for Pseudomonas aeruginosa

to adapt to environmental stresses (Pustelny et al., 2013) and a prmC deletion mutant

also showed down regulation of GroEL, which is also known as HSP10, an important

stress response protein in O. oeni (Grandvalet et al., 2005). The interactions between

GroEL and OEOE_1581 may therefore increase the ethanol tolerance of strain 90.

4.3.2.4 OEOE_0911 SAM-dependent methyltransferase

OEOE_0911 a synonymous SNP in a SAM-dependant methyltransferase which

is a biological cofactor that has a role in the transfer of methyl groups to various

biomolecules, including DNA, proteins and small-molecule secondary metabolites.

An increase in CFA content is the first step in the cells response to ethanol stress

(Teixeira et al., 2002) and these CFA’s are formed from unsaturated fatty acids by the

transfer of a methyl group from SAM catalysed by the enzyme cfa (cyclopropane fatty

acid synthetase) (Ramos et al., 1997). It would be interesting to investigate whether

this SNP has an effect on the transcriptional levels of the enzyme cfa and therefore

contributes to the cells response to ethanol stress.

Page 99: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

85

4.3.2.5 SNPs in non-coding regions

Strain 90 contained three SNPs in non-coding regions. The sequences of these

were analysed with BLAST against other LAB species; but, they did not show

homology to any ORFs. The first SNP in a non-coding region is immediately

downstream of OEOE_0085 (Hypothetical protein). Bon et al. (2009) found six

regions of plasticity in the genome of O. oeni, thought to contribute to high performing

strains. OEOE_0085 was located in region two; however, it was not considered to be a

significant marker of high performance; nonetheless, the adjacent hypothetical protein,

OEOE_0086 was found to be a significant marker.

The second SNP in a non-coding region was located between OEOE t0403 and

OEOE_0404. OEOEt0403 is arginine-tRNA ligase and is involved in arginine and

proline metabolism and aminoacyl-tRNA biosynthesis. OEOE_0404 encodes

glyceraldehyde-3-phosphate dehydrogenase which is involved in

glycolysis/glucogenesis and carbon metabolism (Figure 4.4) and the biosythesis of

amino acids (Figure 4.5).

The final SNP in a non-coding region was located between OEOE_1040 and

OEOE_1041. OEOE_1040 is a hypothetical protein and OEOE_1041 is a pseudo

gene. It would be interesting to apply qPCR to monitor the expression of these genes

located up and down stream of the SNP to determine if expression had been affected in

some way.

4.3.2.6 Summary for strain 90

Strain 90 also contains a SNP in two hypothetical proteins, OEOE_0196 and

OEOE_0870 the functions of which are unknown. The mutation in OEOE_0870 is

predicted to affect protein function and therefore may be important and warrants

further investigation.

Page 100: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

86

The non-coding SNP OEOE_0404 is involved in the biosynthesis of amino

acids. Interestingly two SNP’s in genes of strain 89 also have a role in biosynthesis of

amino acids, thus perhaps this pathway has a significant role in ethanol tolerance.

Additionally, both strains contain the same two SNPs in the amino acid transporter

OEOE_1168 implying a possible relationship with the biosynthesis and transport of

amino acids and the adjustment of this in the face of ethanol stress.

Two of the genes seem to be related to SAM methylases. The possible role of

this, in the formation of CFA may be why strain 90 had a better performance in high-

ethanol fermentations than strain 89, which doesn’t contain these SNPs. One of these

SNPs in OEOE_1581 may interact with the stress response gene groEL.

4.3.3 Mutations only in strain 89

4.3.3.1 OEOE_0160 Phosphoribosylpyrophosphate synthetase (PRPP) and

OEOE_1480 Transketolase (TKtA)

Phosphoribosylpyrophosphate synthetase (PRPP) catalyses the removal of

carbon atoms, from the pentose phosphate pathway, which are used for the synthesis of

nucleotides, cofactors NAD+ and NADP+, and the amino acids histidine and

tryptophan (Kilstrup et al., 2005) (Figure 4.5).

PRPP is a substrate in the biosynthesis of histidine and tryptophan has been

characterised in the gram positive Bacillus subtilis (Nilsson and Hove-Jensen, 1987).

Research has shown that membrane disordering resulting from ethanol exposure leads

to leakage of intracellular compounds, including enzymatic co-factors (NAD / NADH)

and ions essential for cell growth and fermentation (Spano and Massa, 2006).

Therefore the synthesis of these compounds might contribute to the bacterium’s

ethanol tolerance. In studies investigating toluene stress in the gram negative

bacterium Pseudomonas putida it was observed that in response to toluene stress ATP

synthetase was down regulated as a response to the disruption in proton motive force

Page 101: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

87

caused by toluene stress. As a cellular response genes involved in NAD(P)H

metabolism were then upregulated (Nicolaou et al., 2010). OEOE_0160 also interacts

with OEOE_1480, a transketolase involved in the amino acid synthesis pathway.

©Kanehisa Laboratories

Figure 4.4. Simplified version of the pathway for carbon metabolism (KEGG pathway

ooe01200; Kanehisa and Goto, 2000; Kanehisa et al., 2014). The arrows in green are gene

encoded functions found in O. oeni. Strain 90 contains a SNP in a region immediately

downstream of OEOE_0404.

Page 102: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

88

©Kanehisa Laboratories

Figure 4.5. Simplified version of the pathway for the biosynthesis of amino acids (KEGG

pathway ooe01230; Kanehisa and Goto, 2000; Kanehisa et al., 2014). The arrows in green are

gene functions found in O. oeni. OEOE_1480 is responsible for the conversion of fructose- 6P

into erythrose 4P, as well as further intermediates into sedoheptulose-7P and then to ribose-5P.

OEOE_0160 converts ribose-5P to PRPP. OEOE_0404 is responsible for the conversion of

glyceraldehyde-3P for downstream reactions culminating in the formation of pyruvate. Strain

90 contains a SNP in a region immediately downstream of OEOE_0404.

OEOE_0404

OEOE_1480

OEOE_0160

Page 103: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

89

4.3.3.2 OEOE_0517 ATPase component of ABC transporter

The SNP seems to be located in the conserved domain ABC_tran_2; ABC

transporter. ABC transporters are transmembrane proteins that utilise ATP to carry out

biological process including translocation of substances across membranes and

translation of RNA and DNA repair (Nicolaou et al., 2010). ABC transporters also

participate in multidrug resistance (Nicolaou et al., 2010). Perhaps this SNP improves

the efficacy of the export of toxic molecules from the cell, the impact of this affect

should be further investigated.

4.3.3.3 OEOE_0665 F0F1 ATP synthase subunit beta and

OEOE_1647 cation transport ATPase

F0F1 ATPase active transporters are located in the cell membrane and play a

role in energy conserving reactions (Figure 4.2) Protons are pumped outwards

generating a proton gradient and the energy released drives further membrane bound

processes (Wen-Ying and Zhen-Kui, 2013). In O. oeni, activity of H+ ATPase is

induced at low pH and this activity is associated with increased acid stress resistance

(Fortier et al., 2003). OEOE_1647 encodes a cation transport ATPase which are

implicated in activities related to pH homeostasis (Mills et al., 2005). As ethanol

seems to affect membrane associated processes and as this SNP is predicted to affect

protein function it would be interesting to study this activity and see if it is reduced or

increased by this mutation. It is also interesting that both these mutations target genes

possibly associated with acid stress responses. The DE and screening were all

performed in MRSAJ medium which has a pH of 6.2. It would be intriguing to

analyse the fermentation profile of strain 89 in a low pH environment, to see if its

MLF performance is better than strain 90 under acid stress.

4.3.3.4 OEOE_0738 ABC multidrug transport system

Page 104: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

90

OEOE_0738 is part of a sub-family of ABC transporters that are known as

ATP-dependant multidrug resistance (MDR) proteins. A protein belonging to this

superfamily has been characterised in O. oeni (Bourdineaud et al., 2004). The gene

encoding this protein, omrA did not show increased expression at 20 % (v/v) ethanol in

O. oeni; however, when expressed in E. coli omrA conferred significant resistance to

10 % ethanol when compared to the control (Bourdineaud et al., 2004). It was

postulated that MDR proteins may facilitate cell survival by maintaining membrane

lipid organisation and influencing membrane fluidity (Bourdineaud et al., 2004).

Membrane fluidity is important in the cells response to ethanol and whilst this

mutation appears to be tolerated, based on its purported function, it warrants further

investigation.

4.3.3.5 OEOE_1375 DNA directed RNA polymerase (rpoB)

OEOE_1375 is rpoB that encodes the β subunit of bacterial RNA polymerase

(Figure 4.6). It is the site of mutations that confer resistance to rifamycin. Marcobal et

al. (2008) analysed SNPs in rpoB to determine an increasing mutation rate in MMR

deficient O. oeni strains as communicated in Chapter 2. RNA polymerase is also a

part of pyrimidine metabolism, assisting in the formation of UTP and CTP and RNA

(Figure 4.7).

Page 105: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

91

©Kanehisa Laboratories

Figure 4.6. Bacterial RNA polymerase (KEGG reference ooe03020; Kanehisa and Goto,

2000; Kanehisa et al., 2014). OEOE_1375 is rpoB which encodes for the β subunit of RNA

polymerase. The β’ and β subunits contain the active centre responsible for RNA synthesis

and determinants for non-sequence specific DNA

Page 106: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

92

©Kanehisa Laboratories

Figure 4.7. Simplified pathway for pyrimidine metabolism (KEGG reference ooe00240; Kanehisa and Goto, 2000; Kanehisa et al., 2014) The gene encoded functions

in green are found in O. oeni. OEOE_1375 assists in the formations between CTP, UTP and RNA.

Page 107: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

93

4.3.3.6 OEOE_1014 hypothetical protein

OEOE_1014 is a hypothetical protein; however, CDD suggests it may be a

member of the conserved DegV protein family. DegV is widely conserved within B.

subtilus, though its function is unknown. Its structure indicates that it may play a role

in fatty acid transport and metabolism (Kinch et al., 2005).

4.3.3.7 Non coding SNP’s

Strain 89 contains SNPs in two non-coding regions: the first is halfway

between OEOE_0463 and OEOE_0464. OEOE_0463 is a hypothetical protein and

OEOE_0464 encodes phosphotransferase system, mannose/fructose-specific

component IIA. OEOE_0464 is also known as ManX and KEGG pathways reveal it

has a role in the phosphotransferase system (PTS) (KEGG reference ooe02060) and

fructose and mannose metabolism (ooe00051). Mannose is a sugar in apple juice but it

is not commonly found in wine so this could be a response, by O. oeni to a different

nutritional environment. The second SNP, when analysed with BLAST, seems to be

located in OEOE_1137 a phosphoribosylaminoimidazole carboxylase ATPase subunit,

which is responsible for nucleotide metabolism, in particular purines.

©Kanehisa Laboratories

Figure 4.8. Mannose metabolism (KEGG reference ooe00051; Kanehisa and Goto, 2000;

Kanehisa et al., 2014). ManX (OEOE_0464) with ManY and ManZ are responsible for the

conversion of mannose into mannose-6-phosphate.

Page 108: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

94

4.3.3.8 Summary for strain 89

It is important to note that MLF performance of O. oeni strain 89 was not as

efficient as that of strain 90 (Chapter 3). It is possible that some of the mutations

detected have decreased its performance or that the base mutations in both strains

aren’t responsible for the new phenotype and the two strains have diverged in their

mechanism of response to ethanol stress with the mechanism in strain 89 not as

effective as strain 90. The role of OEOE_1014, which is a hypothetical protein, would

be interesting to study further. OEOE_1014 shows homology with the DegV protein

family and might have an effect on fatty acid transport. Genes related to fatty acids

seemed important in strain 90, and perhaps this protein, in strain 89 helps in a similar

way but with a different mechanism that was not as effective.

Page 109: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

95

4.3.4 Transposable element

In viewing the annotated sequences it was observed that OEOE_1495 was

annotated out of order on the genomes (Figure 4.9). As PSU-1 was used as the

genomic reference and because it was the first O. oeni genome to be sequenced, the

order of the gene loci in the PSU-1 genome runs numerically. In SB3, 89 and 90

OEOE_1495 is located between OEOEt1213 and OEOEt1214 (these t loci are

tRNA)(Figure 4.9). The location of OEOE_1495 on PSU-1 was confirmed using the

NCBI website (http://www.ncbi.nlm.nih.gov), with OEOE_1495 located between

OEOE_1494 and OEOE_1496 and not between OEOE_t1213 and OEOE_t1214

(Figure 4.10). Additionally it seems that OEOE_1495 has been putatively

characterised as a transposase. Furthermore on the reference PSU-1 sequence the gap

between OEOE_t1213 and OEOE_t1214 is about 90 bp whereas in SB3, 89 and 90 it

is about 10 kb long with the transposase in the middle (Figure 4.9 Figure 4.10).

Different elements of this putative transposon were analysed using BLAST and as well

as aligning to sections of PSU-1 this genetic material showed great similarity to other

Lactobacillus spp., including ABC transporters, 5S ribosomal RNA and transposase.

Possibly this transposase has played a role in facilitating horizontal gene transfer

(HGT) during the evolution of this strain (SB3) and thus the effect of OEOE_1495 on

strain performance should be examined further.

Page 110: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Figure 4.9. The sequences of strains 89, 90 and the parent (SB3) from the genome visualisation program IGV. The top of each section is a coverage map and below

are the individual aligned reads. OEOE_1495 and approximately 10kb of unannotated, genetic material is situated between OEOE_t1213 and OEOE_t1214.

Page 111: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

A

B

Figure 4.10. A. Location of OEOE_1495 on the genome of O. Oeni PSU-1 (http://www.ncbi.nlm.nih.gov/gene/?term=OEOE_1495). B. Arrangement of OEOE_t1214

and OEOE_t1213 on the genome of O. Oeni PSU-1 (http://www.ncbi.nlm.nih.gov/gene/?term=OEOE_t1213).

Page 112: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

98

4.4 Summary

The fitness advantage of specific individual mutants may only play a small role

in the diversification of a DE population. Underlying genetic background variation is

quickly generated which then influences the fate of any individual beneficial mutation.

Therefore later beneficial mutations can depend on how well they piggyback on initial

clonal variations (Lang et al., 2011). Thus mutations that may appear unhelpful may

be important because they lead to the opportunity for new mutations to develop.

In theory neutral mutations should arise, within in a population, by drift at a

uniform rate. According to Marcobal et al. (2008) the spontaneous mutation rate of O.

oeni to rifampin and erythromycin is 1.6 × 10-6

. In this study the mutation rate,

determined according to Foster (2006) was between 1.11 × 10-5

and 2.61 × 10-5

depending on the growth rate. This suggests an increased mutation rate in this case

and alludes to a proportion of these mutations not contributing to the high ethanol

tolerant phenotype.

The adaptation of O. oeni to ethanol is clearly more complex than first thought.

As ethanol is one of the more toxic stressors in wine a number of previous studies have

focused on the response of O. oeni to ethanol. Additionally in the current economic

and environmental climate the search for biofuels has become more important

(Dunlop, 2011). The response of bacterial cells to ethanol is therefore becoming an

increasingly important area of research and yet the actual genetic mechanisms are

largely unknown. A number of genes have been studied and have been discovered to

play a role (Table 4.1, Sumby et al., 2014); however, from this work high ethanol

tolerant bacteria have been generated that are identical to the parental strain in these

implicated genes. Clearly there are additional mechanisms at work. The only genes

that have being reported to be involved in the ethanol stress response that interact with

any in the sequenced genome were, dnaK and groEL, in the RNA degradation

Page 113: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

99

pathway, which interacted with OEOE_1629, a mutation present in both strains.

OEOE_1581, from strain 90, also possibly interacts with groEL.

Some hypotheses have been made but further work is needed. Five genes that

should be investigated first based on the literature in this chapter are OEOE_1629

(ppK) and OEOE_1581 based on their possible interactions with known ethanol

response genes dnaK and groEL. The SNP in OEOE_0911 encoding for SAM-

dependant methyltransferase should also be investigated by studying cfa expression to

ascertain if this SNP effects downstream fatty acid metabolism, an important step in

ethanol tolerance. OEOE_1168 the amino acid transporter contains two SNPs in close

proximity and deserves further investigations based on the importance of amino acids

to acetate stress resistance in E. coli. Finally OEOE_0738, the ABC multidrug

transport system, as part of the MDR superfamily may help enable cell survival under

ethanol stress by influencing membrane fluidity.

For not only these five genes but for all mutations identified in this study it

would be of interest to look at the expression of the genes using qPCR and those in

regions flanking the non-coding mutations to see if expression differs in high ethanol

fermentations as evidence that they may be important candidates. Another option is

applying RNAseq that examines the expression of the whole genome. The change in

one gene might be affecting downstream or upstream performance of other genes. As

there is currently no transformation system available for O. oeni alternative methods of

investigating these genes could be over-expressing or deleting these genes in

Lactobacillus spp. to confirm their necessity to the high ethanol phenotype. From this

data it would be interesting to use other members of the DE population and compare

data from high performing strains and also those that appear to be worse in

performance than the parent.

Page 114: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 4: Comparative genomics

100

Both the synonymous and non-synonymous mutations could be analysed by

checking whether protein levels are different across mutants vs the parent strains to

determine if they are having an effect. Further investigation is warranted on these

genes as evolution of synonymous SNPs in response to environmental pressure clearly

has some relevance to this work. Additionally it would be beneficial to confirm the

insertions in DNA topoisomerase using basic PCR.

In summary there were no major genomic rearrangements between the parent

(SB3) and the evolved strains 89 and 90. Insertion sequence elements did not appear

to play the role that was original hypothesised. Excitingly as there is a clear

phenotypic difference between the strains, new avenues of response of the cell appear

to be at play and must now be investigated further so as to determine their cause. Such

a fuller understanding would help guide bacterial selection, cultivation and culture

management techniques.

Page 115: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 5: Summary and future directions

101

Chapter 5. Thesis summary and future directions

This thesis details the use of DE to produce a more efficient and reliable strain of

O. oeni (strain 90) for use in industrial fermentations and it is the first such study of its

kind. Ethanol was considered one of the most pertinent of the wine stressors and so

was selected as a basis for adaption. With proof-of-concept achieved it would be

interesting to now expand the DE studies on O. oeni, including further DE on strain 90

in wine using combinations of stressors and therefore a more general stress resistance

might produce even more superior strains.

Strain 90 was characterised and compared to the parent (SB3) in multiple MLF’s

in media under a range of temperatures and ethanol concentrations. It completed MLF

at 22 °C at 13 and 15 % (v/v) ethanol and was able to consume 85 % of the available

L-malic at 19 % (v/v) ethanol. The highest concentrations of ethanol in which the

bacteria could remain viable was also established. With strain 90 forming CFUs at 22

% (v/v) ethanol after 48 hours unlike its parent (SB3). In a 15 % (v/v) Pinot Noir

strain 90 completed MLF in 40 % of the time it took the parent, characterisation in

different wine variety, alcohol and temperature is necessary. Further comparisons

between strain 90 and the parent to characterise the differences in their response to

ethanol would be interesting. Included would be an examination of differences in

membrane fluidity under high ethanol conditions using flow cytometry (da Silveira et

al., 2003) and to analyse the differences in fatty acid content of the cells using gas

chromatography (Teixeira et al., 2002).

Lastly the genomes of the SB3, 90 and 89 were sequenced using whole genome

sequencing. Some future study opportunities arising from this work have already been

raised. To expand on this work it would be interesting to study a new strain from a

new DE population to see its response to ethanol adaptation. Evolution can take vastly

Page 116: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Chapter 5: Summary and future directions

102

different tracks and perhaps there are multiple genetic solutions to the same problem of

ethanol toxicity. Additionally members of the population could be isolated over time

based on the hypothesis that rapid genetic change as a response to adaption of the

environment occurs early in the selection process (Lenski, 2010). Importantly and as

previously mentioned, the transposable element OEOE_1495 needs further analysis of

its role in the evolution of certain O. oeni to industrial MLF conditions.

Tolerance to ethanol in lactic acid bacteria, on a molecular level, is the

responsibility of a number of genes including clpX, clcP, trxA, hsp18, ftsH, omrA,

groESL, dnaK, clpA, ctrS and rmlB. These genes are also responsible for the response

to other physiochemical stressors (Sumby et al., 2014). Possibly the improvements in

ethanol tolerance in strain 90 have also improved the tolerance of the strain to other

stressors in wine, epitomised by strain 90 being better able than its parent to perform in

a low temperature MLF at 15 °C. It would be interesting to determine if this strain

performs better when faced with other stresses. Once the genes responsible for this

phenotype are elucidated a clearer picture of general stress response in this bacterium

will emerge.

5.1 Conclusion

This work demonstrated DE as an effective and novel method for the generation

of new and exciting O. oeni strains for industrial applications. A single isolate, strain

90, was selected as a strain that showed an ethanol tolerant phenotype, being found to

retain residual viability in up to 24 % (v/v) ethanol for an hour compared to 22 % (v/v)

by the parent. This strain was also found to complete MLF in Pinot Noir earlier than a

range of other commercially available bacteria. The whole genome sequence of this

strain compared to the parent is the beginning of exciting work in studying the whole

genome response of O. oeni to ethanol stress.

Page 117: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

103

Bibliography

Abdelgadir, W.S., Ahmed, T.K., Dirar, H.A. (1998). The traditional fermented milk

products of the Sudan. International Journal of Food Microbiology 44, 1-13.

Alcántara, C., Blasco, A., Zúñiga, M., Monedero, V. (2013). Polyphosphate in

Lactobacillus: Accumulation and involvement in resistance against stress. Applied and

Environmental Microbiology 80, 1650-1659.

Asmundson, R.V., Kelly, W.J. (1990). The effect of temperature and ethanol

concentration on the growth of Leuconostoc oenos. In: Williams, P.J., et al., (Eds.),

Conference proceedings, Proceedings of the Seventh Australian Wine Industry

Technical Conference. Winetitles, Adelaide, South Australia. 251-252.

Assad-García, J.S., Bonnin-Jusserand, M., Garmyn, D., Guzzo, J., Alexandre, H.,

Grandvalet, C. (2008). An improved protocol for electroporation of Oenococcus oeni

ATCC BAA-1163 using ethanol as immediate membrane fluidizing agent. Letters in

Applied Microbiology 47, 333-338.

Assani, A., Chabane, D., Haïcour, R., Bakry, F., Wenzel, G., Foroughi-Wehr, B.

(2005). Protoplast fusion in banana (Musa spp.): Comparison of chemical (PEG:

Polyethylene glycol) and electrical procedure. Plant Cell, Tissue and Organ Culture 83,

145-151.

Ayora, S., Rojo, F., Ogasawara, N., Nakai, S., Alonso, J.C. (1996). The Mfd protein of

Bacillus subtilis 168 is involved in both transcription-coupled DNA repair and DNA

recombination. Journal of Molecular Biology 256, 301-318.

Bachmann, H., Starrenburg, M.J., Molenaar, D., Kleerebezem, M., van Hylckama

Vlieg, J.E. (2012). Microbial domestication signatures of Lactococcus lactis can be

reproduced by experimental evolution. Genome Research 22, 115-124.

Bachtrog, D., Gordo, I. (2004). Adaptive evolution of asexual populations under

Muller's ratchet. Evolution 58, 1403-1413.

Bartowsky, E., Borneman, A. (2011). Genomic variations of Oenococcus oeni strains

and the potential to impact on malolactic fermentation and aroma compounds in wine.

Applied Microbiology and Biotechnology 92, 441-447.

Bartowsky, E.J. (2005). Oenococcus oeni and malolactic fermentation - moving into

the molecular arena. Australian Journal of Grape and Wine Research 11, 174-187.

Bauer, R., Dicks, L.M.T. (2004). Control of malolactic fermentation in wine. A

review. South African Journal of Enology and Viticulture 25, 74-88.

Beltramo, C., Oraby, M., Bourel, G., Garmyn, D., Guzzo, J. (2004). A new vector,

pGID052, for genetic transfer in Oenococcus oeni. FEMS Microbiology Letters 236,

53-60.

Bergthorsson, U., Andersson, D.I., Roth, J.R. (2007). Ohno's dilemma: Evolution of

new genes under continuous selection. Proceedings of the National Academy of

Sciences 104, 17004-17009.

Page 118: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

104

Boehringer-Mannheim. (1995). L-malic acid. In: GmbH, B.-M., (Ed.), Methods of

enzymatic bioanalysis and food analysis, Mannheim, Germany. 98-99.

Bolotin, A., Wincker, P., Mauger, S., Jaillon, O., Malarme, K., Weissenbach, J.,

Ehrlich, S., Sorokin, A. (2001). The complete genome sequence of the lactic acid

bacterium Lactococcus lactis ssp. lactis IL1403. Genome Research 11, 731.

Bon, E., Delaherche, A., Bilhere, E., De Daruvar, A., Lonvaud-Funel, A., Le Marrec,

C. (2009). Oenococcus oeni genome plasticity is associated with fitness. Applied and

Environmental Microbiology 75, 2079-2090.

Bongers, R.S., Hoefnagel, M.H.N., Starrenburg, M.J.C., Siemerink, M.A.J., Arends,

J.G.A., Hugenholtz, J., Kleerebezem, M. (2003). IS981-mediated adaptive evolution

recovers lactate production by ldhB transcription activation in a lactate dehydrogenase-

deficient strain of Lactococcus lactis. Journal of Bacteriology 185, 4499-4507.

Borneman, A.R., McCarthy, J.M., Chambers, P.J., Bartowsky, E.J. (2012).

Comparative analysis of the Oenococcus oeni pan genome reveals genetic diversity in

industrially-relevant pathways. BMC Genomics 13, 373.

Boumerdassi, H., Monnet, C., Desmazeaud, M., Corrieu, G. (1997). Isolation and

properties of Lactococcus lactis subsp. lactis biovar diacetylactis CNRZ 483 mutants

producing diacetyl and acetoin from glucose. Applied and Environmental

Microbiology 63, 2293-2299.

Bourdineaud, J.-P., Nehmé, B., Tesse, S., Lonvaud-Funel, A. (2003). The ftsH gene of

the wine bacterium Oenococcus oeni is involved in protection against environmental

stress. Applied and Environmental Microbiology 69, 2512-2520.

Bourdineaud, J.P., Nehme, B., Tesse, S., Lonvaud-Funel, A. (2004). A bacterial gene

homologous to ABC transporters protect Oenococcus oeni from ethanol and other

stress factors in wine. International Journal of Food Microbiology 92, 1-14.

Bridier, J., Claisse, O., Coton, M., Coton, E., Lonvaud-Funel, A. (2010). Evidence of

distinct populations and specific subpopulations within the species Oenococcus oeni.

Applied and Environmental Microbiology 76, 7754-7764.

Cafaro, C., Bonomo, M.G., Salzano, G. (2014). Adaptive changes in geranylgeranyl

pyrophosphate synthase gene expression level under ethanol stress conditions in

Oenococcus oeni. Journal of Applied Microbiology 116, 71-80.

Campos, F.M., Couto, J.A., Figueiredo, A.R., Tóth, I.V., Rangel, A.O., Hogg, T.A.

(2009). Cell membrane damage induced by phenolic acids on wine lactic acid bacteria.

International Journal of Food Microbiology 135, 144-151.

Capucho, I., San Romão, M.V. (1994). Effect of ethanol and fatty acids on malolactic

activity of Leuconostoc oenos. Applied Microbiology and Biotechnology 42, 391-395.

Caridi, A., Corte, V. (1997). Inhibition of malolactic fermentation by cryotolerant

yeasts. Biotechnology Letters 19, 723-726.

Carrete, R., Vidal, M.T., Bordons, A., Constanti, M. (2002). Inhibitory effect of sulfur

dioxide and other stress compounds in wine on the ATPase activity of Oenococcus

oeni. FEMS Microbiology Letters 211, 155-159.

Page 119: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

105

Caspritz, G., Radler, F. (1983). Malolactic enzyme of Lactobacillus plantarum.

Purification, properties, and distribution among bacteria. Journal of Biological

Chemistry 258, 4907-4910.

Chambers, P.J., Pretorius, I.S. (2010). Fermenting knowledge: The history of

winemaking, science and yeast research. EMBO Rep 11, 914-920.

Chevreux, B., Wetter, T., Suhai, S. (1999). Genome sequence assembly using trace

signals and additional sequence information, Conference proceedings, German

Conference on Bioinformatics. 45-56.

Cho, K.M., Math, R.K., Asraful Islam, S.M., Lim, W.J., Hong, S.Y., Kim, J.M., Yun,

M.G., Cho, J.J., Yun, H.D. (2009). Novel multiplex PCR for the detection of lactic

acid bacteria during kimchi fermentation. Molecular and Cellular Probes 23, 90-94.

Chu-Ky, S., Tourdot-Marechal, R., Marechal, P.-A., Guzzo, J. (2005). Combined cold,

acid, ethanol shocks in Oenococcus oeni: Effects on membrane fluidity and cell

viability. Biochimica et Biophysica Acta (BBA) - Biomembranes 1717, 118-124.

Cingolani, P., Platts, A., Wang, L.L., Coon, M., Nguyen, T., Wang, L., Land, S.J., Lu,

X., Ruden, D.M. (2012). A program for annotating and predicting the effects of single

nucleotide polymorphisms, SnpEff. Fly 6, 80-92.

Clermont, O., Bonacorsi, S., Bingen, E. (2000). Rapid and simple determination of the

Escherichia coli phylogenetic group. Applied and Environmental Microbiology 66,

4555-4558.

Cocconcelli, P.S., Morelli, L., Vescovo, M., Bottazzi, V. (1986). Intergeneric

protoplast fusion in lactic acid bacteria. FEMS Microbiology Letters 35, 211-214.

Coffey, A.G., Daly, C., Fitzgerald, G. (1994). The impact of biotechnology on the

dairy industry. Biotechnology Advances 12, 625-633.

Couto, J., Rozes, N., Hogg, T. (1996). Ethanol‐induced changes in the fatty acid

composition of Lactobacillus hilgardii, its effects on plasma membrane fluidity and

relationship with ethanol tolerance. Journal of applied bacteriology 81, 126-132.

Cox, D.J., Henick-Kling, T. (1989). Chemiosmotic energy from malolactic

fermentation. Journal of Bacteriology 171, 5750-5752.

Cox, D.J., Henick-Kling, T. (1990). A comparison of lactic acid bacteria for energy-

yielding (ATP) malolactic enzyme systems. American Journal of Enology and

Viticulture 41, 215-218.

Cox, D.J., Henick-Kling, T. (1995). Protonmotive force and ATP generation during

malolactic fermentation. American Journal of Enology and Viticulture 46, 319-323.

da Silveira, M.G., Baumgartner, M., Rombouts, F.M., Abee, T. (2004). Effect of

adaptation to ethanol on cytoplasmic, and membrane protein profiles of Oenococcus

oeni. Applied and Environmental Microbiology 70, 2748-2755.

da Silveira, M.G., Golovina, E.A., Hoekstra, F.A., Rombouts, F.M., Abee, T. (2003).

Membrane fluidity adjustments in ethanol-stressed Oenococcus oeni cells. Applied and

Environmental Microbiology 69, 5826-5832.

Page 120: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

106

da Silveira, M.G., San Romão, M.V., Loureiro-Dias, M.C., Rombouts, F.M., Abee, T.

(2002). Flow cytometric assessment of membrane integrity of ethanol-stressed

Oenococcus oeni cells. Applied and Environmental Microbiology 68, 6087-6093.

Darwin, C. (2008). On the origin of species: by means of natural selection, or the

preservation of favoured races in the struggle for life. Illustrated ed., Quammen, D.

(Ed), Stirling, New York.

Davis, C.R., Wibowo, D., Eschenbruch, R., Lee, T.H., Fleet, G.H. (1985). Practical

implications of malolactic fermentation: A review. American Journal of Enology and

Viticulture 36, 290-301.

Davis, C.R., Wibowo, D., Fleet, G.H., Lee, T.H. (1988). Properties of wine lactic acid

bacteria: Their potential enological significance. American Journal of Enology and

Viticulture 39, 137-142.

de las Rivas, B., Marcobal, Á., Muñoz, R. (2004). Allelic diversity and population

structure in Oenococcus oeni as determined from sequence analysis of housekeeping

genes. Applied and Environmental Microbiology 70, 7210-7219.

del Cardayré, S. (2005). Developments in strain improvement technology. In: Zhang,

L., Demain, A.L., (Eds.), Natural products: Drug discovery and therapeutic medicine.

Humana Press. 107-125.

Desroche, N., Beltramo, C., Guzzo, J. (2005). Determination of an internal control to

apply reverse transcription quantitative PCR to study stress response in the lactic acid

bacterium Oenococcus oeni. Journal of Microbiological Methods 60, 325-333.

Dicks, L. (1994). Transformation of Leuconostoc oenos by electroporation.

Biotechnology Techniques 8, 901-904.

Dicks, L.M.T., Dellaglio, F., Collins, M.D. (1995). Proposal to reclassify Leuconostoc

oenos as Oenococcus oeni [corrig.] gen. nov., comb. nov. International Journal of

Systematic Bacteriology 45, 395-397.

Dicks, L.M.T., Endo, A. (2009). Taxonomic status of lactic acid bacteria in wine and

key characteristics to differentiate species. South African Journal of Enology and

Viticulture 30, 72-90.

Dunlop, M.J. (2011). Engineering microbes for tolerance to next-generation biofuels.

Biotechnology for Biofuels 4, 32.

Dykhuizen, D.E., Hartl, D.L. (1983). Selection in chemostats. Microbiological

Reviews 47, 150-168.

El-Sharoud, W.M. (2005). Two-component signal transduction systems as key players

in stress responses of lactic acid bacteria. Science Progress 88, 203-228.

El Gharniti, F., Dols-Lafargue, M., Bon, E., Claisse, O., Miot-Sertier, C., Lonvaud, A.,

Le Marrec, C. (2012). IS30 elements are mediators of genetic diversity in Oenococcus

oeni. International Journal of Food Microbiology 158, 14-22.

Endo, A., Okada, S. (2006). Oenococcus kitaharae sp. nov., a non-acidophilic and

non-malolactic-fermenting Oenococcus isolated from a composting distilled shochu

Page 121: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

107

residue. International Journal of Systematic and Evolutionary Microbiology 56, 2345-

2348.

Eom, H.-J., Cho, S., Park, M., Ji, G., Han, N. (2010). Characterization of Leuconostoc

citreum plasmid pCB18 and development of broad host range shuttle vector for lactic

acid bacteria. Biotechnology and Bioprocess Engineering 15, 946-952.

Erbslöh. Catalogue [Online]. Available at

http://www.erbsloeh.com/en/datenblatt/WEIN/BioStart_Bianco_SK3.pdf (Accessed:

4th February 2010).

Fiocco, D., Capozzi, V., Goffin, P., Hols, P., Spano, G. (2007). Improved adaptation to

heat, cold, and solvent tolerance in Lactobacillus plantarum. Applied Microbiology

and Biotechnology 77, 909-915.

Fortier, L.C., Tourdot-Marechal, R., Divies, C., Lee, B.H., Guzzo, J. (2003). Induction

of Oenococcus oeni H+-ATPase activity and mRNA transcription under acidic

conditions. FEMS Microbiology Letters 222, 165-169.

Foster, P.L. (1999). Mechanisms of stationary phase mutation: A decade of adaptive

mutation. Annual Review of Genetics 33, 57-88.

Foster, P.L. (2006). Methods for determining spontaneous mutation rates. Methods in

Enzymology 409, 195-213.

Fugelsang, K.C., Edwards, C.G. (2007). Lactic acid bacteria. In: Fugelsang, K.C.,

Edwards, C.G., (Eds.), Wine microbiology: Practical applications and procedures.

Springer New York. 29-44.

Furet, J.-P., Quenee, P., Tailliez, P. (2004). Molecular quantification of lactic acid

bacteria in fermented milk products using real-time quantitative PCR. International

Journal of Food Microbiology 97, 197-207.

G-Alegrı́a, E., López, I., Ruiz, J.I., Sáenz, J., Fernández, E., Zarazaga, M., Dizy, M.,

Torres, C., Ruiz-Larrea, F. (2004). High tolerance of wild Lactobacillus plantarum and

Oenococcus oeni strains to lyophilisation and stress environmental conditions of acid

pH and ethanol. FEMS Microbiology Letters 230, 53-61.

Galardini, M., Biondi, E.G., Bazzicalupo, M., Mengoni, A. (2011). Contiguator: A

bacterial genomes finishing tool for structural insights on draft genomes. Source Code

for Biology and Medicine 6.

Garbay, S., Lonvaud-Funel, A. (1996). Response of Leuconostoc oenos to

environmental changes. Journal of Applied Bacteriology 81, 619-625.

Garvie, E.I. (1967). The growth factor and amino acid requirements of species of the

genus Leuconostoc, including Leuconostoc paramesenteroides (sp.nov.) and

Leuconostoc oenos. Journal of General Microbiology 48, 439-447.

Garvie, E.I. (1975). Part 14. Gram positive cocci. In: American Society for

Microbiology, (Ed.), Bergey's manual of determinative bacteriology. Waverly Press

inc., Baltimore. 510-513.

Page 122: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

108

Ginetti, F., Perego, M., Albertini, A.M., Galizzi, A. (1996). Bacillus subtilis mutS

mutL operon: Identification, nucleotide sequence and mutagenesis. Microbiology 142,

2021-2029.

Giudici, P., Solieri, L., Pulvirenti, A.M., Cassanelli, S. (2005). Strategies and

perspectives for genetic improvement of wine yeasts. Applied Microbiology and

Biotechnology 66, 622-628.

Gockowiak, H., Henschke, P.A. (2003). Interaction of pH, ethanol concentration and

wine matrix on induction of malolactic fermentation with commercial 'direct

inoculation' starter cultures. Australian Journal of Grape and Wine Research 9, 200-

209.

Godden, P., Muhlack, R. (2010). Trends in the composition of Australian wine, 1984-

2008. Australian and New Zealand Grapegrower and Winemaker 558, 47-61.

Gong, J., Zhao, X., Xing, Q., Li, F., Li, H., Li, Y., Chai, L., Wang, Q., Zheltikov, A.

(2008). Femtosecond laser-induced cell fusion. Applied Physics Letters 92, 093901-

093903.

Grandvalet, C., Assad-Garcia, J.S., Chu-Ky, S., Tollot, M., Guzzo, J., Gresti, J.,

Tourdot-Marechal, R. (2008). Changes in membrane lipid composition in ethanol- and

acid-adapted Oenococcus oeni cells: Characterization of the cfa gene by heterologous

complementation. Microbiology 154, 2611-2619.

Grandvalet, C., Coucheney, F., Beltramo, C., Guzzo, J. (2005). CtsR is the master

regulator of stress response gene expression in Oenococcus oeni. Journal of

Bacteriology 187, 5614-5623.

Guzzo, J. (2011). Stress responses of Oenococcus oeni. In: Tsakalidou, E.,

Papadimitriou, K., (Eds.), Stress responses of lactic acid bacteria. Springer US. 349-

365.

Guzzo, J., Jobin, M.-P., Diviès, C. (1998). Increase of sulfite tolerance in Oenococcus

oeni by means of acidic adaptation. FEMS Microbiology Letters 160, 43-47.

Guzzo, J., Jobin, M.P., Delmas, F., Fortier, L.C., Garmyn, D., Tourdot-Marechal, R.,

Lee, B., Divies, C. (2000). Regulation of stress response in Oenococcus oeni as a

function of environmental changes and growth phase. International Journal of Food

Microbiology 55, 27-31.

Haber, L.T., Walker, G.C. (1991). Altering the conserved nucleotide binding motif in

the Salmonella typhimurium MutS mismatch repair protein affects both its ATPase and

mismatch binding activities. The EMBO Journal 10, 2707.

Hansen, E.B. (2002). Commercial bacterial starter cultures for fermented foods of the

future. International Journal of Food Microbiology 78, 119-131.

Henick-Kling, T. (1993). Malolactic fermentation. In: Fleet, G.H., (Ed.), Wine

Microbiology and Biotechnology. Harwood Switzerland. 289-362

Hopwood, D.A., Wright, H.M. (1978). Bacterial protoplast fusion: Recombination in

fused protoplasts of Streptomyces coelicolor. Molecular and General Genetics 162,

307-317.

Page 123: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

109

Hou, L. (2009). Novel methods of genome shuffling in Saccharomyces cerevisiae.

Biotechnology Letters 31, 671-677.

Huang, D.W., Sherman, B.T., Lempicki, R.A. (2008). Systematic and integrative

analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols 4,

44-57.

Huang, D.W., Sherman, B.T., Lempicki, R.A. (2009). Bioinformatics enrichment

tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic

Acids Research 37, 1-13.

Husnik, J.I., Volschenk, H., Bauer, J., Colavizza, D., Luo, Z., van Vuuren, H.J.J.

(2006). Metabolic engineering of malolactic wine yeast. Metabolic Engineering 8,

315-323.

Jin, G., Hayes, A.M., Jiranek, V., Grbin, P.R. (2013). Identification of bacteria

associated with 'wild' or uninoculated malolactic fermentations in red wine,

Proceedings of the 15th Australian Wine Industry Technical Conference, Sydney,

NSW.

Jiricny, J. (2006). The multifaceted mismatch-repair system. Nature Reviews

Molecular Cell Biology 7, 335-346.

John, R.P., Gangadharan, D., Madhavan Nampoothiri, K. (2008). Genome shuffling of

Lactobacillus delbrueckii mutant and Bacillus amyloliquefaciens through protoplasmic

fusion for L-lactic acid production from starchy wastes. Bioresource Technology 99,

8008-8015.

Kaleta, P., O'Callaghan, J., Fitzgerald, G.F., Beresford, T.P., Ross, R.P. (2010).

Crucial role for insertion sequence elements in Lactobacillus helveticus evolution as

revealed by interstrain genomic comparison. Applied and Environmental Microbiology

76, 212-220.

Kanehisa, M., Goto, S. (2000). KEGG: Kyoto encyclopedia of genes and genomes.

Nucleic Acids Research 28, 27-30.

Kanehisa, M., Goto, S., Sato, Y., Kawashima, M., Furumichi, M., Tanabe, M. (2014).

Data, information, knowledge and principle: Back to metabolism in KEGG. Nucleic

Acids Research 42, D199-D205.

Kawecki, T.J., Lenski, R.E., Ebert, D., Hollis, B., Olivieri, I., Whitlock, M.C. (2012).

Experimental evolution. Trends in Ecology & Evolution 27, 547-560.

Kelly, W.J., Huang, C.M., Asmundson, R.V. (1993). Comparison of Leuconostoc

oenos strains by pulsed-field gel electrophoresis. Applied and Environmental

Microbiology 59, 3969-3972.

Kilstrup, M., Hammer, K., Ruhdal Jensen, P., Martinussen, J. (2005). Nucleotide

metabolism and its control in lactic acid bacteria. FEMS Microbiology Reviews 29,

555-590.

Kinch, L.N., Cheek, S., Grishin, N.V. (2005). EDD, a novel phosphotransferase

domain common to mannose transporter EIIA, dihydroxyacetone kinase, and DegV.

Protein Science 14, 360-367.

Page 124: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

110

Koistinen, K.M., Plumed-Ferrer, C., Lehesranta, S.J., Kärenlampi, S.O., Von Wright,

A. (2007). Comparison of growth-phase-dependent cytosolic proteomes of two

Lactobacillus plantarum strains used in food and feed fermentations. FEMS

Microbiology Letters 273, 12-21.

Kok, J., Buist, G., Zomer, A.L., Van Hijum, S.A.F.T., Kuipers, O.P. (2005).

Comparative and functional genomics of lactococci. FEMS Microbiology Reviews 29,

411-433.

Kunkee, R.E. (1968). Malo-lactic fermentation. Advances in Applied Microbiology 9,

235-279.

Kunkee, R.E. (1984). Selection and modification of yeasts and lactic acid bacteria for

wine fermentation. Food Microbiology 1, 315-332.

Kunkee, R.E., Ough, C.S., Amerine, M.A. (1964). Induction of malo-lactic

fermentation by inoculation of must and wine with bacteria. American Journal of

Enology and Viticulture 15, 178-183.

Laffort Oenologie. Catalogue [Online]. Available at

http://www.laffort.com/en/products/lactic-acid-bacteria (Accessed: 4th February

2010).

Lafon-Lafourcade, S., Lonvaud-Funel, A., Carre, E. (1983). Lactic acid bacteria of

wines: Stimulation of growth and malolactic fermentation. Antonie Van Leeuwenhoek

49, 349-352.

Lallemand. Catalogue [Online]. Available at

http://www.lallemandwine.com/catalog/products/view/2126 (Accessed: 4th February

2010).

Lang, G.I., Botstein, D., Desai, M.M. (2011). Genetic variation and the fate of

beneficial mutations in asexual populations. Genetics 188, 647-661.

Langmead, B., Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2.

Nature Methods 9, 357-359.

Le, O., Shen, B., Iismaa, S., Burgess, B. (1993). Azotobacter vinelandii mutS:

Nucleotide sequence and mutant analysis. Journal of Bacteriology 175, 7707-7710.

Lenski, R.E. (2010). Phenotypic and genomic evolution during a 20,000-generation

experiment with the bacterium Escherichia coli, Plant Breeding Reviews. John Wiley

& Sons, Inc. 225-265.

Li, B., Tsui, H.-C.T., LeClerc, J.E., Dey, M., Winkler, M.E., Cebula, T.A. (2003).

Molecular analysis of mutS expression and mutation in natural isolates of pathogenic

Escherichia coli. Microbiology 149, 1323-1331.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G.,

Abecasis, G., Durbin, R. (2009). The sequence alignment/map format and SAMtools.

Bioinformatics 25, 2078-2079.

Liccioli, T., Tran, T.T., Cozzolino, D., Jiranek, V., Chambers, P., Schmidt, S. (2011).

Microvinification—how small can we go? Applied Microbiology and Biotechnology

89, 1621-1628.

Page 125: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

111

Liu, M., Nauta, A., Francke, C., Siezen, R.J. (2008). Comparative genomics of

enzymes in flavor-forming pathways from amino acids in lactic acid bacteria. Applied

and Environmental Microbiology 74, 4590-4600.

Lonvaud-Funel, A. (1995). Microbiology of the malolactic fermentation: Molecular

aspects. FEMS Microbiology Letters 126, 209-214.

Lonvaud-Funel, A. (1999). Lactic acid bacteria in the quality improvement and

depreciation of wine. Antonie Van Leeuwenhoek 76, 317-331.

Lonvaud-Funel, A. (2000). Understanding wine lactic acid bacteria. Progress and

prospects in controlling wine quality. In: Rantz, J.M., (Ed.), Proceedings of the

American Society for Enology and Viticulture 50th

Anniversary Annual Meeting.

American Society for Enology and Viticulture, Seattle,Washington. 278-284.

Machielsen, R., Siezen, R.J., van Hijum, S.A.F.T., van Hylckama Vlieg, J.E.T. (2011).

Molecular description and industrial potential of Tn6098 conjugative transfer

conferring alpha-galactoside metabolism in Lactococcus lactis. Applied and

Environmental Microbiology 77, 555-563.

Maitre, M., Weidmann, S., Dubois-Brissonnet, F., David, V., Covès, J., Guzzo, J.

(2014). Adaptation of the wine bacterium Oenococcus oeni to ethanol stress: Role of

the small heat shock protein Lo18 in membrane integrity. Applied and Environmental

Microbiology 80, 2973-2980.

Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A.,

Pavlova, N., Karamychev, V., Polouchine, N., Shakhova, V., Grigoriev, I., Lou, Y.,

Rohksar, D., Lucas, S., Huang, K., Goodstein, D.M., Hawkins, T., Plengvidhya, V.,

Welker, D., Hughes, J., Goh, Y., Benson, A., Baldwin, K., Lee, J.-H., Díaz-Muñiz, I.,

Dosti, B., Smeianov, V., Wechter, W., Barabote, R., Lorca, G., Altermann, E.,

Barrangou, R., Ganesan, B., Xie, Y., Rawsthorne, H., Tamir, D., Parker, C., Breidt, F.,

Broadbent, J., Hutkins, R., O'Sullivan, D., Steele, J., Unlu, G., Saier, M.,

Klaenhammer, T., Richardson, P., Kozyavkin, S., Weimer, B., Mills, D. (2006).

Comparative genomics of the lactic acid bacteria. PNAS 103, 15611-15616.

Makarova, K.S., Koonin, E.V. (2007). Evolutionary genomics of lactic acid bacteria.

Journal of Bacteriology 189, 1199-1208.

Malherbe, S., Tredoux, A., Nieuwoudt, H., du Toit, M. (2012). Comparative metabolic

profiling to investigate the contribution of O. oeni MLF starter cultures to red wine

composition. Journal of Industrial Microbiology & Biotechnology 39, 477-494.

Marchler-Bauer, A., Zheng, C., Chitsaz, F., Derbyshire, M.K., Geer, L.Y., Geer, R.C.,

Gonzales, N.R., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Lu, S., Marchler,

G.H., Song, J.S., Thanki, N., Yamashita, R.A., Zhang, D., Bryant, S.H. (2013). CDD:

Conserved domains and protein three-dimensional structure. Nucleic Acids Research

41, D348-352.

Marcobal, A.M., Sela, D.A., Wolf, Y.I., Makarova, K.S., Mills, D.A. (2008). Role of

hypermutability in the evolution of the genus Oenococcus. Journal of Bacteriology

190, 564-570.

Page 126: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

112

McBryde, C., Gardner, J.M., de Barros Lopes, M., Jiranek, V. (2006). Generation of

novel wine yeast strains by adaptive evolution. American Journal of Enology and

Viticulture 57, 423-430.

Miller, J.H. (1996). Spontaneous mutators in bacteria: Insights into pathways of

mutagenesis and repair. Annual Reviews in Microbiology 50, 625-643.

Mills, D.A., Rawsthorne, H., Parker, C., Tamir, D., Makarova, K. (2005). Genomic

analysis of Oenococcus oeni PSU-1 and its relevance to winemaking. FEMS

Microbiology Reviews 29, 465-475.

Mills, S., O’Sullivan, O., Hill, C., Fitzgerald, G., Ross, R.P. (2010). The changing face

of dairy starter culture research: From genomics to economics. International Journal of

Dairy Technology 63, 149-170.

Monnet, C., Aymes, F., Corrieu, G. (2000). Diacetyl and alpha -acetolactate

overproduction by Lactococcus lactis subsp. lactis biovar diacetylactis mutants that

are deficient in alpha -acetolactate decarboxylase and have a low lactate

dehydrogenase activity. Applied and Environmental Microbiology 66, 5518-5520.

Morelli, L., Cocconcelli, P.S., Bottazzi, V., Damiani, G., Ferretti, L., Sgaramella, V.

(1987). Lactobacillus protoplast transformation. Plasmid 17, 73-75.

Muller, H.J. (1964). The relation of recombination to mutational advance. Mutation

Research/Fundamental and Molecular Mechanisms of Mutagenesis 1, 2-9.

Naouri, P., Chagnaud, P., Arnaud, A., Galzy, P. (1990). Purification and properties of

a malolactic enzyme from Leuconostoc oenos ATCC 23278. Journal of Basic

Microbiology 30, 577-585.

National Center for Biotechnology Information [Online]. Available at

http://www.ncbi.nlm.nih.gov (Last accessed December 2014).

Ng, P.C., Henikoff, S. (2001). Predicting deleterious amino acid substitutions. Genome

Research 11, 863-874.

Nicolaou, S.A., Gaida, S.M., Papoutsakis, E.T. (2010). A comparative view of

metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels

and chemicals, to biocatalysis and bioremediation. Metabolic Engineering 12, 307-

331.

Nilsson, D., Hove-Jensen, B. (1987). Phosphoribosylpyrophosphate synthetase of

Bacillus subtilis. Cloning, characterization and chromosomal mapping of the prs gene.

Gene 53, 247-255.

O’Neill, A.J., Chopra, I. (2002). Insertional inactivation of mutS in Staphylococcus

aureus reveals potential for elevated mutation frequencies, although the prevalence of

mutators in clinical isolates is low. Journal of Antimicrobial Chemotherapy 50, 161-

169.

Olguín, N., Bordons, A., Reguant, C. (2010). Multigenic expression analysis as an

approach to understanding the behaviour of Oenococcus oeni in wine-like conditions.

International Journal of Food Microbiology 144, 88-95.

Page 127: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

113

Oliver, A., Baquero, F., Blázquez, J. (2002). The mismatch repair system (mutS, mutL

and uvrD genes) in Pseudomonas aeruginosa: Molecular characterization of naturally

occurring mutants. Molecular Microbiology 43, 1641-1650.

Osborne, J.P., Edwards, C.G. (2006). Inhibition of malolactic fermentation by

Saccharomyces during alcoholic fermentation under low- and high-nitrogen

conditions: A study in synthetic media. Australian Journal of Grape and Wine

Research 12, 69-78.

Osborne, J.P., Edwards, C.G. (2007). Inhibition of malolactic fermentation by a

peptide produced by Saccharomyces cerevisiae during alcoholic fermentation.

International Journal of Food Microbiology 118, 27-34.

Pang, P., Lundberg, A., Walker, G. (1985). Identification and characterization of the

mutL and mutS gene products of Salmonella typhimurium LT2. Journal of Bacteriology

163, 1007-1015.

Parekh, S., Vinci, V.A., Strobel, R.J. (2000). Improvement of microbial strains and

fermentation processes. Applied Microbiology and Biotechnology 54, 287-301.

Patnaik, R., Louie, S., Gavrilovic, V., Perry, K., Stemmer, W.P., Ryan, C.M., del

Cardayré, S. (2002). Genome shuffling of Lactobacillus for improved acid tolerance.

Nature Biotechnology 20, 707-712.

Patynowski, R.J., Jiranek, V., Markides, A.J. (2002). Yeast viability during

fermentation and sur lie ageing of a defined medium and subsequent growth of

Oenococcus oeni. Australian Journal of Grape and Wine Research 8, 62-69.

Pedersen, M.B., Iversen, S.L., Sørensen, K.I., Johansen, E. (2005). The long and

winding road from the research laboratory to industrial applications of lactic acid

bacteria. FEMS Microbiology Reviews 29, 611-624.

Pedraza-Reyes, M., Yasbin, R.E. (2004). Contribution of the mismatch DNA repair

system to the generation of stationary-phase-induced mutants of Bacillus subtilis.

Journal of Bacteriology 186, 6485-6491.

Perfeito, L., Fernandes, L., Mota, C., Gordo, I. (2007). Adaptive mutations in bacteria:

High rate and small effects. Science 317, 813-815.

Petri, R., Schmidt-Dannert, C. (2004). Dealing with complexity: Evolutionary

engineering and genome shuffling. Current Opinion in Biotechnology 15, 298-304.

Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time

RT-PCR. Nucleic Acids Research 29, e45.

Pilone, G.J., Kunkee, R.E. (1976). Stimulatory effect of malo-lactic fermentation on

the growth rate of Leuconostoc oenos. Applied and Environmental Microbiology 32,

405-408.

Poncet, S., Mijakovic, I., Nessler, S., Gueguen-Chaignon, V., Chaptal, V., Galinier, A.,

Boël, G., Mazé, A., Deutscher, J. (2004). HPr kinase/phosphorylase, a Walker motif

A-containing bifunctional sensor enzyme controlling catabolite repression in gram-

positive bacteria. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics

1697, 123-135.

Page 128: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

114

Prunier, A.-L., Leclercq, R. (2005). Role of mutS and mutL genes in hypermutability

and recombination in Staphylococcus aureus. Journal of Bacteriology 187, 3455-3464.

Pustelny, C., Brouwer, S., Müsken, M., Bielecka, A., Dötsch, A., Nimtz, M., Häussler,

S. (2013). The peptide chain release factor methyltransferase PrmC is essential for

pathogenicity and environmental adaptation of Pseudomonas aeruginosa PA14.

Environmental Microbiology 15, 597-609.

Ramos, J.L., Duque, E., Rodríguez-Herva, J.-J., Godoy, P., Haïdour, A., Reyes, F.,

Fernández-Barrero, A. (1997). Mechanisms for solvent tolerance in bacteria. Journal of

Biological Chemistry 272, 3887-3890.

Renault, P. (2002). Genetically modified lactic acid bacteria: Applications to food or

health and risk assessment. Biochimie 84, 1073-1087.

Renouf, V., Delaherche, A., Claisse, O., Lonvaud-Funel, A. (2008). Correlation

between indigenous Oenococcus oeni strain resistance and the presence of genetic

markers. Journal of Industrial Microbiology and Biotechnology 35, 27-33.

Roberts, J., Park, J.-S. (2004). Mfd, the bacterial transcription repair coupling factor:

Translocation, repair and termination. Current Opinion in Microbiology 7, 120-125.

Rosenberg, S.M. (2001). Evolving responsively: Adaptive mutation. Nature Review

Genetics 2, 504-515.

Rosenberg, S.M., Hastings, P.J. (2003). Microbiology and evolution: Modulating

mutation rates in the wild. Science 300, 1382-1383.

Sato, H., Yanagida, F., Shinohara, T., Suzuki, M., Suzuki, K.-I., Yokotsuka, K. (2001).

Intraspecific diversity of Oenococcus oeni isolated during red wine-making in Japan.

FEMS Microbiology Letters 202, 109-114.

Sauer, U. (2001). Evolutionary engineering of industrially important microbial

phenotypes. In: Nielsen, J., et al., (Eds.), Metabolic Engineering, vol. 73. Springer

Berlin Heidelberg. 129-169.

Sauna, Z.E., Kimchi-Sarfaty, C. (2011). Understanding the contribution of

synonymous mutations to human disease. Nature Reviews Genetics 12, 683-691.

Schuller, D., Casal, M. (2005). The use of genetically modified Saccharomyces

cerevisiae strains in the wine industry. Applied Microbiology and Biotechnology 68,

292-304.

Selby, C.P., Sancar, A. (1994). Mechanisms of transcription-repair coupling and

mutation frequency decline. Microbiological Reviews 58, 317-329.

Senadheera, M.D., Lee, A.W.C., Hung, D.C.I., Spatafora, G.A., Goodman, S.D.,

Cvitkovitch, D.G. (2007). The Streptococcus mutans vicX gene product modulates

gtfB/C expression, biofilm formation, genetic competence, and oxidative stress

tolerance. Journal of Bacteriology 189, 1451-1458.

Seydlová, G., Halada, P., Fišer, R., Toman, O., Ulrych, A., Svobodová, J. (2012).

DnaK and GroEL chaperones are recruited to the Bacillus subtilis membrane after

short-term ethanol stress. Journal of Applied Microbiology 112, 765-774.

Page 129: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

115

Shareck, J., Young, C., Byong, L., Miguez, C.B. (2004). Cloning vectors based on

cryptic plasmids isolated from lactic acid bacteria: Their characteristics and potential

applications in biotechnology. Critical Reviews in Biotechnology 24, 155-208.

Shazand, K., Tucker, J., Chiang, R., Stansmore, K., Sperling-Petersen, H., Grunberg-

Manago, M., Rabinowitz, J., Leighton, T. (1990). Isolation and molecular genetic

characterization of the Bacillus subtilis gene (infb) encoding protein synthesis

initiation factor 2. Journal of Bacteriology 172, 2675-2687.

Skelley, A.M., Kirak, O., Suh, H., Jaenisch, R., Voldman, J. (2009). Microfluidic

control of cell pairing and fusion. Nature Methods 6, 147-152.

Spano, G., Massa, S. (2006). Environmental stress response in wine lactic acid

bacteria: Beyond Bacillus subtilis. Critical Reviews in Microbiology 32, 77-86.

Spath, K., Heinl, S., Egger, E., Grabherr, R. (2012). Lactobacillus plantarum and

Lactobacillus buchneri as expression systems: Evaluation of different origins of

replication for the design of suitable shuttle vectors. Molecular Biotechnology 52, 40-

48.

Spettoli, P., Nuti, M.P., Zamorani, A. (1984). Properties of malolactic activity purified

from Leuconostoc oenos ML34 by affinity chromatography. Applied and

Environmental Microbiology 48, 900-901.

Stephanopoulos, G. (2002). Metabolic engineering by genome shuffling. Nature

Biotechnology 20, 666-668.

Sumby, K.M., Grbin, P.R., Jiranek, V. (2010). Microbial modulation of aromatic esters

in wine: Current knowledge and future prospects. Food Chemistry 121, 1-16.

Sumby, K.M., Grbin, P.R., Jiranek, V. (2014). Implications of new research and

technologies for malolactic fermentation in wine. Applied Microbiology and

Biotechnology 98, 8111-8132.

Swiegers, J., Bartowsky, E., Henschke, P., Pretorius, I. (2005). Yeast and bacterial

modulation of wine aroma and flavour. Australian Journal of Grape and Wine

Research 11, 139-173.

Taddei, F., Radman, M., Maynard-Smith, J., Toupance, B., Gouyon, P., Godelle, B.

(1997). Role of mutator alleles in adaptive evolution. Nature 387, 700-702.

Teixeira, H., Goncalves, M., Rozes, N., Ramos, A., San Romao, M. (2002).

Lactobacillic acid accumulation in the plasma membrane of Oenococcus oeni: A

response to ethanol stress? Microbial Ecology 43, 146-153.

Teixeira, M.C., Raposo, L.R., Mira, N.P., Lourenço, A.B., Sá-Correia, I. (2009).

Genome-wide identification of Saccharomyces cerevisiae genes required for maximal

tolerance to ethanol. Applied and Environmental Microbiology 75, 5761-5772.

Teusink, B., Wiersma, A., Jacobs, L., Notebaart, R.A., Smid, E.J. (2009).

Understanding the adaptive growth strategy of Lactobacillus plantarum by in silico

optimisation. PLoS Computational Biology 5, e1000410.

Page 130: Enhanced Wine-Making Efficiency Through Fool-Proof ... · successfully to generate improved strains of other lactic acid bacteria and its efficacy as a method for the production of

Bibliography

116

Tsumori, H., Kuramitsu, H. (1997). The role of the Streptococcus mutans

glucosyltransferases in the sucrose-dependent attachment to smooth surfaces: Essential

role of the gtfC enzyme. Oral Microbiology and Immunology 12, 274-280.

van Kranenburg, R., Kleerebezem, M., van Hylckama Vlieg, J., Ursing, B.M.,

Boekhorst, J., Smit, B.A., Ayad, E.H.E., Smit, G., Siezen, R.J. (2002). Flavour

formation from amino acids by lactic acid bacteria: Predictions from genome sequence

analysis. International Dairy Journal 12, 111-121.

van Reenen, C.A., Dicks, L.M. (2011). Horizontal gene transfer amongst probiotic

lactic acid bacteria and other intestinal microbiota: What are the possibilities? A

review. Archives of Microbiology 193, 157-168.

Wang, Y., Li, Y., Pei, X., Yu, L., Feng, Y. (2007). Genome-shuffling improved acid

tolerance and L-lactic acid volumetric productivity in Lactobacillus rhamnosus.

Journal of Biotechnology 129, 510-515.

Wen-Ying, Z., Zhen-Kui, K. (2013). Advanced progress on adaptive stress response of

Oenococcus oeni. Journal of Northeast Agricultural University (English Edition) 20,

91-96.

Yang, D., Woese, C.R. (1989). Phylogenetic structure of the "Leuconostocs": An

interesting case of a repidly evolving organism. Systematic and Applied Microbiology

12, 145-149.

Yu, L., Pei, X., Lei, T., Wang, Y., Feng, Y. (2008). Genome shuffling enhanced L-

lactic acid production by improving glucose tolerance of Lactobacillus rhamnosus.

Journal of Biotechnology 134, 154-159.

Zapparoli, G., Tosi, E., Azzolini, M., Vagnoli, P., Krieger, S. (2009). Bacterial

inoculation strategies for the achievement of malolactic fermentation in high-alcohol

wines. South African Journal of Enology and Viticulture 30, 49-55.

Zavaleta, A.I., Martínez-Murcia, A.J., Rodríguez-Valera, F. (1997). Intraspecific

genetic diversity of Oenococcus oeni as derived from DNA fingerprinting and

sequence analyses. Applied and Environmental Microbiology 63, 1261-1267.

Zhang, Y.-X., Perry, K., Vinci, V.A., Powell, K., Stemmer, W.P.C., del Cardayre, S.B.

(2002). Genome shuffling leads to rapid phenotypic improvement in bacteria. Nature

415, 644-646.

Zúñiga, M., Pardo, I., Ferrer, S. (2003). Conjugative plasmid pIP501 undergoes

specific deletions after transfer from Lactococcus lactis to Oenococcus oeni. Archives

of Microbiology 180, 367-373.