environmental and identification study of algae present in...

Republic of Iraq

Ministry of Higher Education

& Scientific Research University of Baghdad/ College of Science

Environmental and Identification study

of Algae Present in Three Drinking Water

Plants in Baghdad and Molecular

Detection of someToxigenic

Cyanobacteria

A Thesis

Submitted to the College of Science-University of Baghdad in

Partial Fulfillment of the Requirements for the Degree of Doctor of

Philosophy (Ph.D) in Botany/ Phycology.

By

Ibrahim Jabber Abed

B. Sc. Microbiology/College of Science/University of Mustansaryia 0221

M. Sc. Botany/College of Science/University of Baghdad 0222

Supervised by

Prof. Dr. Abdul latif.M.Jawad

جسخ اؼشاق صاسح ازؼ اؼب اجحش اؼ

جبؼخ ثغذاد / وخ اؼ

دراسخ ثيئيخ وتشخيصيخ للطحبلت الموجودح في ثالث محطبد لميبه

الشرة في ثغذاد والتشخيص الجزيئي لجعض الطحبلت الخضر

المزرقخ المنتجخ للسم

اغشحخ مذخ اى

دسجخ دوزسا فسفخ جضء زطجبد ثغذاد وخ اؼ / جبؼخ غحبت -ػ اجبد

لذذ لج

اثراهيم جبثر عجذ

اسزصشخاجبؼخ -وخ اؼ - ح لس ػ احب - احبء جشخ /ػ حبح /ثىبسط

0221

0222 جبؼخ ثغذاد –وخ اؼ -لس ػ احبح - /جبدبجسزش

ثأششاف

أ.د.عجذ الطيف محمذ جواد الدي 0214جشي رشش اضب 1342حش

بسم اهلل الرحمن الرحيم

إنك أنت العليم الحكيم قالوا سبحانك ال علم لنا إال ما علمت نا

صدق اهلل العلي العظيم

سورة البقرة (23اية )

Dedication

To

My dear family, father's soul, mother and brothers,

thank you for your endless love which is truly the

best family I could have.

My lovely wife, Ghusoon, thank you for believing in

me, for your patience and love which enabled me

to complete this work.

My wonderful daughter, Ruqyia, never ending love.

Ibrahim

ACKNOWLEDGEMENT

First of all, my great thank to God Allah for all his endless blessings and

helping me to successfully complete this study.

I have been fortunate in my supervisors, colleagues, family and friends; all

have contributed, in different ways, to the completion of my thesis.

However, some people deserve special mention.

Professor Dr. Abdul Latif M. Jawad, I am most grateful to you for being

my supervisor during my PhD study period, thank you for your patience,

endless encouragement and confidence in my capability as a scientist. Thank

you very much.

Special thanks to the staff of Center and Department of Water research and

Directorate of water Treatment Technology and Ministry of Science &

Technology: Ahmed Aidan Al- Hussieny, Roeda F.Kamel & Suaad K.

Salman for their scientific assistance.

Special thanks go to my best friend Dr. Laith Al-Dulaimi for his

encouragement and scientific advice during the period of the study.

I would like to thank all the staff of drinking water stations.

My sincer gratitude goes to all my colleagues and friends at the Department

of Biology, College of Science, University of Baghdad for their interest and

encouragement. Finally, I would like to express my deepest gratitude to all

who had given me their support which enabel me to complete this thesis.

Certification

We certify that this thesis was prepared under our supervision at College

of Science, University of Baghdad, as a partial requirement for the degree of

Doctor of Philosophy (Ph.D) in Phycology.

Signature:

Prof. Dr. Abdul latif M. Jawad

Date:

In view of the available recommendation, I forward this thesis for debate

the examining committee.

Signature:

Prof. Dr. Sabah N. Alwachi

Head of Department of Biology

College of Science

University of Baghdad

Date:

Committee’s Certification

We, the examining committee, certify that we have read this dissertation and

have examined the student Ibrahim Jabber Abed in its contents and that in

our opinion it is adequate with good standing as a dissertation for the degree

of Doctor of philosophy (PhD) in Phycology.

Dr. Foad Manher Alkam

Professor

Chairman

/ / 0214

Dr. Muayad Sabri Shawkat Dr. Niemat Jameel

Abdulbaqi

Professor Assistant Professor

Member Member

/ / 0214 / / 0214

Dr. Mohammed F. Shather Dr. Ithar Kamil Abbas

AlMarjani Al-Mayaly

Assistant Professor Assistant Professor

Member Member

/ / 0214 / / 0214

Dr. Abdul latif M. Jawad

Professor

Advisor

/ / 0214

Approved for the College of committee of graduate studies.

Prof. Dr. Saleh Mahdi Ali

Dean

College of Science

Baghdad University

/ / 0214

Introduction

Cyanobacteria are ubiquitous organisms known which have the ability to

produce a wide spectrum of secondary metabolites, some of which are

cyanobacteria toxins which are becoming increasingly important in fresh,

marine and brackish waters worldwide(Martins and Vasconcelos, 0211) due

to the eutrophication of water bodies, and also possibly due to climate

change (Hernandez et al., 0222). Cyanobacterial blooms cause oxygen

depletion, alter food webs and threaten freshwater bodies worldwide used

for agriculture, fishing, recreation and drinking (Martins and Vasconcelos,

0211). The quality of drinking water may be significantly reduced by the

presence of cyanobacteria capable of producing toxins.

In fresh water some cyanobacteria may produce dermal toxins,

neurotoxins and hepatotoxins which including nodularins and microcystins

(Rodgers, 0222).

Microcystin was first characterized from the unicellular species Microcystis

aeruginosa, which was the most common toxic cyanobacterium in eutrophic

fresh water (Oberholster et al., 0222) and reported in four cyanobacterial

orders: Oscillatoriales, Chroococales, Stigonematales and Nostocales. The

production of nodularin is a distinct characteristic of genera Nodularia

(Jungblut and Neilan, 0222).

The diversity, growth of cyanobacteria, formation of blooms and

cyanotoxins regulation in different planktonic cyanobacteria are influenced

by a variety of physical, chemical and biological factors (Heath, 0222).

Over the past three decades, the frequency and global distribution of

toxic cyanobacterial incidents reveales to have increased might be related to

the global climate changes (Neilan et al., 0214). Cyanobacteria will

dominate phytoplankton communities, for several reasons (Paerl and

Huisman, 0222), first, high atmospheric CO0 content will result in higher

rates of photosynthesis. This carbonate source can change the pH of water,

allowing more tolerant cyanobacteria to out-compete other phytoplankton.

Second, as water temperature increases, phytoplankton growth rate

increases. While eukaryotic primary producers’ growth rates begin to

decline when water temperature reaches 02˚ C, cyanobacterial growth rates

remain high. Finally, with unknown weather patterns associated with climate

change, droughts that increase salinity of waters can encourage growth of

salt-tolerant cyanobacteria (Stewart, 0211).

The Tigris River is one of two main sources of drinking water for Iraq,

serving population approximately seven million people settled in Baghdad

city, this river usually affected by agricultural and industrial eutrification and

the sewage effluents, which provide suitable environment for cyanobacterial

growth and potential microcystin production. The eutrification is in part due

to sewage effluents, high turbidity, river discharge or by agricultural runoff.

There are significant costs associated with water cleaning procedures

that are needed to remove cyanotoxins and produce water of an acceptable

standard for human consumption (Saker et al., 0222).

Sensitive physicochemical detection methods, such as high

performance liquid chromatography (HPLC) and Enzyme Linked

Immunosorbent Assay (ELISA) has been established for most cyanotoxins

(Pearson and Neilan, 0222). These methods needed laborious sample

preparation protocols, as well as expensive machinery and purified toxin

standards that are often difficult to obtain. However, molecular detection

methods particularly these based on the polymerase chain reaction (PCR),

were extremely sensitive, specific and rapid detection methods for toxic

cyanobacteria (Pearson and Neilan, 0222). Ghosh et al. 0222 reported that

the aminotransferase domain of mcy E amplified using HEP primers in

natural samples of different orders producing microcystin revealed that PCR

amplification and hepatotoxin production was correlated by 1221.

Therefore, this study was aimed to:

1- Identify all dominant algae of some drinking water treatment stations

in Baghdad.

0- Using molecular detection based on the PCR assay for targeting toxin-

producing cyanobacteria to replace laborious and time-consuming

microscopic techniques for the early detection of potentially toxic

species that could be useful to companies responsible for the

surveillance of drinking water allows these companies to implement

appropriate measures for preventing the growth of these organisms,

such as artificial destratification or the application of water –

cleansing procedures.

Chapter One

Literature Review

1. Literature Review

1.1 General Overview

The word algae originate from the Latin word for seaweed and are now

applied to a broad assemblage of organisms that can be defined both in terms

of morphology and general physiology (Bellinger and Sigee, 0212). They

are simple organisms, without differentiation into roots, stems and leaves,

and their sexual organs are not enclosed within protective coverings. Some

algae have become secondarily heterotrophic, taking up complex organic

molecules by organotrophy or heterotrophy (Tuchman, 1222), but still

retaining fundamental genetic affinities with their photosynthetic relatives.

The term algae (singular alga) was not strictly a taxonomic term but is used

as an inclusive label for a number of different phyla that fit the broad

description noted above which include both prokaryotes and eukaryotes

(Pfandl et al., 0222).

Algae most commonly occur in water, be it fresh water, marine, or

brackish. However, they can also be found in almost every other

environment on earth, from the algae growing in the snow of some

American mountains, lichen associations on bare rocks, desert soils, or hot

springs. In most habitats they function as primary producers in the food

chain which producing organic material from sun light, carbon dioxide, and

water. Besides forming the basic food source for these food chains, they also

form the oxygen necessary for the metabolism of the consumer organisms.

Some algae, particularly the reds and browns, were harvested and eaten as a

vegetable, or the mucilages were extracted from the thallus for use as gelling

and thickening agents (Tang and Vincent, 0220).

1.1 Freshwater Environments

Aquatic biology can be divided into two major disciplines limnology

(water bodies within continental boundaries) and oceanography (dealing

with oceans and seas, occurring between continents). Aquatic algae which

present within continental boundaries, where water is typically fresh (non

saline) and where water bodies are of two main types (Bellinger and Sigee,

0212):

1-Standing (lentic) waters particularly lakes and wetlands.

0-Running (lotic) waters including streams and rivers.

The distinction between lentic and lotic systems was not absolute, since

many standing waters such as lakes have a small but continuous flow-

through of water and many large rivers have a relatively low rate of flow at

certain times of year. Although the difference between standing and running

waters is not absolute, it is an important distinction in relation to the algae

present, since lentic systems were typically dominated by planktonic algae

and lotic systems by benthic organisms (Bellinger and Sigee, 0212).

1.1.1 Planktonic Algae

Planktonic algae dominate the surface of standing waters where light is

bright enough for them to produce food by photosynthesis. The planktonic

algae community is typically composed of green algae, blue-green algae,

diatoms, and euglenas forming bloom that depend on lake trophic status and

these blooms are considered desirable as the beginning of the food chain..

Many species of algae are involved in algae blooms and these species

change over time based on temperature, light, nutrients, and other factors

(Pfandl et al., 0222).

1.1.1 Benthic Algae

Benthic algae occur at the bottom of the water column in lakes and

rivers, and are directly associated with sediments including rocks, mud and

organic debris (Al-Dulaimi, 0222). They were frequently present in mixed

biofilms (with bacteria, fungi and invertebrates). Under high light

conditions, the biofilm may become dominated by extensive growths of

filamentous algae forming a periphyton community. Attached algae may

also be fixed to living organisms as epiphytes including higher plants, larger

attached algae and large planktonic colonial algae. Many algal species have

both planktonic and benthic stages in their life cycle. In some cases they

developed as actively photosynthetic benthic organisms, which subsequently

detached and become planktonic (Bellinger and Sigee, 0212).

1.1.3 Cyanobacterial Mass Populations

Codd et al., (0222) divided cyanobacterial mass populations into three

types which could be readily observable:

1. Blooms of planktonic species. These may be positioned throughout the

water column due to their buoyancy regulating ability, or to water body-

mixing processes. Bloom-forming genera with toxin-producing members

include Microcystis, Anabaena, Anabaenopsis, Planktothrix,

Aphanizomenon, Cylindrospermopsis, Raphidiopsis,and Nodularia.

0. Scums of planktonic species. These accumulate at the water surface due

to a rapid increase in cyanobacterial buoyancy, followed by calm

weather. Scum production was particularly common with Microcystis,

Anabaena, Anabaenopsis, Planktothrix, and Aphanizomenon, and less so

with the remaining genera.

4. Mats and biofilms of benthic and littoral species. These may grow on the

surface of the sediment in shallow water or on rocks at the water margin.

Genera with toxigenic members include Phormidium, Oscillatoria, and

Lyngbya.

1.3.1 The Major Groups of Algae in Fresh Water

Freshwater algae could be grouped into 12 major divisions (phyla) in

relation to macroscopically appearance and biochemical/cytological

characteristics. Some indications of the ecological and taxonomic diversity

of these groups were given by the number of constituent species for

freshwater and terrestrial algae in the British Isles (Sigee, 0223). Green

algae and diatoms were far out numbering other groups which reflecting

their widespread occurrence and ability to live in diverse habitats and

diatoms in particular (over 1222 species) were ecologically successful, both

as planktonic and benthic organisms (John et al. 0220).

1.3 Factors Favoring Bloom Formation by Cyanobacteria

1.3.1 Light Intensity and Buoyancy

Cyanobacterial movement within the water column was due to the

presence of specialized gas-filled vesicles which gave them lower density

than that of water, making them buoyant (Walsby et al., 0222). These gas

vesicles have hydrophilic outer surface and a hydrophobic inner surface. The

structures have density of about a tenth that of water and make

cyanobacterial cells of lower density than that of water. Cyanobacteria were

therefore frequently exposed to light and this might account for a faster

growth than in other microbes found in the same ecosystem. High light

intensities increase cellular iron intake, since Fe+4

seems to be converted to

Fe+0

by light before it was transported into algal cells which might

ultimately be responsible for higher growth rate. Iron was an essential

component in a number of enzymes and protein complexes of respiratory

and photosynthetic electron transport and nitrate assimilation (Rascher et al.

0224).

1.3.1Temperature

For optimal growth, cyanobacteria prefer warm conditions that ranged

between 02 and 02 ˚C. (Robarts and Zohary, 1222) .These temperatures

were higher than that needed for green algae and diatoms therefore,

cyanobacteria could out-compete other species when subjected to extreme

temperature conditions. This also explained why in temperate and boreal

water bodies most cyanobacterial bloom during summer is dominant.

Temperature changes have also been found to induce variations in both the

concentration and peptide composition of the toxins that different

temperatures could be correlated with different chemical forms of produced

toxin (Katirciogola et al., 0223).

1.3.3Nutrients

Nutrients, such as nitrogen and phosphorus are essential for

cyanobacterial growth. Low nitrogen to phosphorus ratio has also been

observed to favor cyanobacterial blooms (Villareal and Carpenter, 0224). It

was found that cyanobacteria have higher affinity for nitrogen and

phosphorus than many other photosynthetic organisms (Kaebernick et al.,

0221) which thrive better than other phytoplanktonic organisms under

condition of nitrogen or phosphorus limitations. As well as their high

nutrient affinity, cyanobacteria could store substantial amounts of

phosphorus enough to perform two to four cell divisions, which correspond

to a 3-40 fold increase in biomass. Low nitrogen to phosphorus ratio has

also been noted to favor cyanobacterial bloom (Kaebernick et al., 0221;

Villareal and Carpenter, 0224).

1.1 Algal Toxins

Algal toxins produced in sufficient quantities, with sufficient potency,

to kill cultured organisms, decrease feeding and growth rates, cause food

safety issues, or adversely affect the quality of the product (Rodgers, 0222).

The production of algal toxins was normally associated with algal

bloom, or the rapid growth and exceptionally dense accumulation of algae.

The term Harmful Algae Bloom (HAB) was used to describe a proliferation

of algae, or phytoplankton, severe bloom of even non-toxic algae can cause

some problems, because bloom deplete the oxygen in the shallow waters of

many aquaculture systems. The number of HAB around the world was

increasing and scientists were unsure why this trend was occurring. The

cause might be natural (species dispersal) or human related (climate change,

nutrient enrichment) and /or transport of algae in ship ballast water (Johnk et

al., 0222).

There were three ways in which humans and animals could be poisoned

by algae:

1. Through contact with contaminated water.

0. Consuming fish or other species taken from the contaminated water.

4. Drinking contaminated water.

The effects of algal blooms vary widely, some of them toxic only when

these are in high densities, while others could be toxic at low densities (a

few cells per liter). Some blooms discolor the water (thus the terms "red

tide" and "brown tide"), while others are almost undetectable with casual

observation.

Harmful Algal Blooms caused serious economic losses in aquaculture if

they killed cultured organisms or cause consumers concern about food

safety. Preliminary estimates showed that the effect of HAB outbreaks on

United states economy was more than 032 million per year or 01 billion per

decade. Toxin-producing algae might become more prevalent in the future,

especially in eutrophic freshwater systems (Sunda, 0222).

1.1Classification of Cyanotoxins

Cyanobacterial toxins were grouped according to the physiological

systems, organs, tissues, or cells which are primarily affected. They include

the following (Codd et al., 0222):

1. Neurotoxins: anatoxin-a and homoanatoxin-a were postsynaptic,

cholinergic neuromuscular blocking agents, and were alkaloids.

Anatoxin-a is a guanidinemethyl phosphate ester, which inhibits

acetylcholinesterase. The saxitoxins of which about 02 structural

variants known in cyanobacteria, were carbamate alkaloids which

block sodium channels.

0. Hepatotoxins: have been mostly implicated in cyanobacterial

toxicoses. They included the cyclic heptapeptide microcystins, of

which over 22 structural variants recorded, and the cyclic

pentapeptide nodularins, of which about 2 variants were known.

These peptides inhibited protein phosphatases and caused changes in

membrane integrity and conductance, and were tumour promoters, in

addition to causing major liver damage.

4. Cytotoxins: cylindrospermopsin was a guanidine alkaloid inhibitor of

protein synthesis which causes wide spread necrotic injury in

mammals (liver, kidneys, lungs, spleen and intestine). It was also

genotoxic and could cause chromosome loss and DNA strand

breakage.

3. Irritants and gastrointestinal toxins: aplysiatoxin,

debromoaplysiatoxin, and lyngbyatoxin, produced by marine

cyanobacteria, cause skin irritation and are tumour promoters.

Lipopolysaccharide endotoxins (LPS), widely produced by

cyanobacteria, may contribute to inflammatory and gastrointestinal

incidents. Table 1-1 showed the classification of cyanotoxins

according to these physiological systems.

Toxin Classification

by

target organ

systems

Toxin-producing

genera

LD15 (i.p.* mouse)

Microcystins

Hepatotoxins

(liver)

Anabaena, Anabaenopsis, Aphanocapsa,

Arthrospira, Hapalosiphon, Microcystis,

Nostoc, Oscillatoria, Planktothrix,

Snowella, Woronichinia

02->1222

μg/kg

Nodularins Hepatotoxins

(liver)

Nodularia 42–22

μg/kg

Anatoxin-a,

homoanatoxin-a

Neurotoxins

(Nerve synapse)

Anabaena, Aphanizomenon, Arthrospira,

Cylindrospermum, Microcystis,

Oscillatoria, Phormidium, Planktothrix,

Raphidiopsis

022–422

μg/kg

Anatoxin-a(s) Neurotoxin

(Nerve synapse)

Anabaena 02-32 μg/kg

Table 1-1. Cyanotoxins with public health significance from acute exposures

(Stewart et al., 1552; Hardy, 1552).

*i.p. intraperitoneal

** GIT Gastrointestinal Tract

Cyanobacterial toxins were grouped according to their toxicological

properties into three categories (Mohamed, 0222):

1. Hepatotoxins: (e.g. microcystins, nodularins and cylindrospermopsin).

0. Neurotoxins: (e.g. paralytic shellfish poisons and anatoxins).

4. Dermatotoxins: Endotoxins or LPS were an obligate part of the outer

cell wall of Gram-negative bacteria including cyanobacteria. LPS consist

of lipid A, core polysaccharides and an outer polysaccharide chain.

Lipid A is the part responsible for the toxic action in human. Compared

with LPS of enteric bacteria, cyanobacterial LPS are 12 times less toxic

in mammalian studies. However, cyanobacterial LPS were found to be

more potent than LPS of enteric bacteria on the detoxification enzyme,

glutathione-S-transferase, in aquatic organisms including plants,

invertebrates and fish.

However, based on their chemical structure, cyanotoxins falls into three

main groups: namely, cyclic peptides (microcystins and nodularins);

Saxitoxins

Neurotoxins

(Nerve axons)

Anabaena, Aphanizomenon,

Cylindrospermopsis, Lyngbya,

Planktothrix

12–42 μg/kg

Cylindrospermopsin General

cytotoxin (multiple organ

systems affected. liver, kidney,

GIT** , heart,

spleen, thymus,

skin)

Anabaena, Aphanizomenon,

Cylindrospermopsis, Raphidiopsis,

Umezakia

0.1 mg/kg

(03 hours)

022μg/kg

(2–2 day)

alkaloids (neurotoxins and cylindrospermopsin); and LPS (Msagati et al.,

0222).

1.2 Microcystins and Nodularins

Microcystins were cyclic heptapeptides cyanotoxins produced by

members of several cyanobacterial genera including Microcystis,

Planktothrix (Oscillatoria), Anabaena, Nostoc, Anabaenopsis and

Hapalosiphon (Adamovský, 0212).

Nodularins are cyclic pentapeptides produced by Nodularia spumigena,

a brackish water cyanobacterium (Beltrán et al. 0210). Microcystins contain

five invariant amino acids namely d-alanine (position 1), d-methylaspartic

acid (position 4), Adda (position 2), d-glutamic acid (position 2) and N-

methyldehydroalanine (position 2) in addition to two variant aminoacids at

positions 0 and 3 which are normally l-amino acids (Figure 1-1). One of the

invariant amino acids is a unique β_aminoacid abbreviated as Adda (4-

amino-2-methoxy-0,2,2-trimethyl-12-phenyl-3,2-dienoic acid) (Falconer

and Humpage, 0222).

Figure 1-1. General structure of microcystin (Neilan et al., 1333)

Microcystins are relatively polar molecules due to the presence of free

carboxylic acids in their structures and the frequent presence of arginine

with a free side chain in positions 0 and 3. The toxins are named according

to the two variable l-amino acids at positions X and Z. Microcystin-LR

(Figure 1-0) contains the amino acids leucine (L) and arginine (R) at these

positions (McElhiney et al., 0220). Currently there are over 22 variants of

microcystin, which have been characterized and they were different in their

toxicities. However, microcystin-LR is the most common in cyanobacteria,

However scientists reported that there are more than one microcystin in a

particular strain of cyanobacterium (Falconer, 0222).

Figure 1-1. General structure of microcystin-LR (Lee, 1553).

The cyclic pentapeptide nodularin contains aminoacids similar or

identical to those found in microcystins, namely arginine, glutamic acid, β-

methyl aspartic acid, Nmethyldehydrobutyrine [0-(methyl-amino)-0-

dehydrobutyricacid] and the Adda (Figure 1- 4). Nodularins are structurally

similar to microcystins and exerts similar toxicities (Nicholson and Burch,

0221).

Figure 1-3.General structure of Nodularin (Moffitt and Neilan, 1551)

The structure of the pentapeptide nodularin is similar to the heptapeptide

microcystin. They share the same motif in the cyclic peptide core erythro-β-

methyle-Asp- Arg- Adda- Glu, where adda is on abbreviation of 4- amino-

2- methoxy-12- phenyl- 0,2,2 –trimethyle – deca-3(E) 2 (E) –dienoic acid.

The major structural difference as compared to microcystin was the presence

N-methyldehydrobutyrine in the rest of the peptide core, instead of the Leu-

Ala- Methyldehydroalanine present in microcystin (Mikhailov et al., 0221).

The nodularia strains that produced nodularin are distributed worldwide

(Hitzfeld et al., 0222). The growth of these cyanobacteria in brackish water

decreased the possibility for direct poisoning of humans by ingestion of

drinking water. However, humans and domestic animals could be poisoned

while swimming in contaminated waters and the high stability of the toxin

entering the food chains of animals used in agriculture and aquaculture could

lead to possible poisonings of humans (Mikhailov et al., 0221).

Microcystins and Nodularin were synthesized by the thiotemplate

mechanism characteristic for non-ribosomal peptide synthesis, Polyketide

synthesis and fatty acid synthesis (Kurmayer and Christiansen, 0222).

Microcystins occur in freshwater worldwide were mainly produced by

colonial Microcystis spp., filamentous Anabaena spp., oscillatoria spp.,

Anabaenopsis spp., Nostoc spp. and Aphanizomenon spp. (Figueiredo et al.,

0223). Microcystin-LR, in particular, was known to be produced by species

belonging to the genera Anabaena, Microcystis, Nostoc and Anabaenopsis

while MC-YR was produced by Microcystis viridis and Haplosiphon spp.

(WHO, 0224).

There are not conclusive studies about the purpose of microcystin

(secondary metabolites) synthesis but some results indicated that it might act

as a chemical defense against grazing (Henning et al., 0221),while Kearns

and Hunter,(0221) attributed the presence of these toxins as allelopathic

effect over algal competitors , in addition to regulating endogenous protein

phosohotase or being used as nitrogen reserve.

World Health Organization (WHO, 0224) has provided a provisional

guideline for microcystin-LR in drinking water (2.221 mg/L) and a tolerable

daily intake of 2.23μg/kg-day (Table 1-0). For recreational guidance, WHO

developed microcystin concentrations corresponding to low (3μg/L),

moderate (02 μg/L), and high (scums) risk associated with cyanobacteria

densities.

Table 1-1. WHO guidelines and risk levels for microcystin (WHO, 1553).

Microcystin

concentration

Cyanobacteria cells/ml

Tolerable Daily Intake day-g/kgμ 2.23

2.23 μg/kg-day

-

Recreational

bathing waters

Low risk 3 μg/L 02,222

Moderate risk 02 μg/L 122,222

High risk - Scums

Drinking Water 1 μg/L

1 μg/L -

1.1 Human Exposure to Hepatotoxin

Cyanobacteria are rich sources of bioactive compounds; structurally

diverse metabolites with cytotoxic, tumour-promoting and enzyme-

inhibiting properties.

The exposure to cyanobacterial toxins is mainly through diet and/or direct

contact with contaminated waters. There are types of possible exposure as

follows (Msagati et al., 0222):

1. Possible exposure through consumption of animal meat and ingestion

of water (or scum).

0. Possible exposure through fish consumption and blue-green algal

products used as food supplements.

4. Exposure through dermal contact. Swimming in waters containing

toxic blooms of cyanobacteria might expose swimmers to

cyanotoxins.

Human health effects are diverse: gastroenteritis, nausea, vomiting,

fevers, flu-like symptoms, sore throat, blistered mouth, ear and eye irritation,

rashes, myalgia, abdominal pains including painful hepatomegaly,

pulmonary consolidation, visual disturbances, kidney damage, and liver

damage. Increased incidence of primary liver cancer has been found to be

associated with exposure to cyanobacteria in raw drinking water in China as

well as exposure to cyanobacterial microcystins via haemodialysis water

resulting in deaths in Brazil (Azevedo et al., 0220; Codd et al., 0222).

The earliest reports of poisoning Cyanobacteria might be about 1222

years ago from the Han dynasty of China. General Zhu-Ling, while on a

military campaign in South China, reported losing troops from poisoning

whilst crossing a river. They reported that the river was green in color at the

time and that his troops drank from the green water (Chorus and Bartram,

1222). Another earliest recorded case of cyanobacterial toxin poisoning, a

male physician became ill after falling into a lake that was experiencing a

microcystis and Anabaena circinalis bloom. He developed severe abdominal

pain, nausea, severe headache, myalgia, arthralgia, and Malaise. But the

world’s first scientific report of the toxic nature of cyanobacteria was written

by George Francis, who described in 1222 the rapid death of stock animals

at Lake Alexandrina, a freshwater lake at the mouth of the Murray River in

South Australia (Brookes et al. 0222).

Hepatotoxins induced massive haemorrhages and disruptionin

mammalian liver as well as some adverse kidney effects. Microcystins and

nodularins have also been observed to induce apoptotic changes in mammals

when administered into mouse embryo fibroblast and rat promyeloctic

leukemia cells. Morphological changes such as membrane budding, as well

as cell shrinkage and organelle redistribution have also been observed in

human fibroblasts, human endothelial cells, human epithelial cells, human

lymphocytes and rat promyelocytes (Drobac et al. 0214).

1.2 Identification of Cyanopacteria and Their Toxins

1.2.1 Identification of Cyanopacteria

Cyanobacterial identification was usually made by traditional taxonomic

methods for phytoplankton analysis, and using morphological characteristics

as the main basis. Nevertheless, these methods have been proven not

satisfactory in many occasions such as when studying isolates that might

changed their size, shape and colony characteristics when cultivated in

different cultures (Vasconcelos, 0222). Therefore, the new techniques could

be used for both naturally collected species and laboratory isolates for

identification of cyanobacterial species by targeting different genes (Neilan

et al., 1222).

The photosynthetic apparatus of a cyanobacterium contains chlorophyll

a and specific accessory pigments, including allophycocyanin, phycocyanin

and phycoerythrin. Phycocyanin found in Cyanobacteria, Rhodophytes, and

Cryptophytes and between these organisms cyanobacteria are the most often

encountered and predominant members of the freshwater environment.

Therefore, distribution of phycocyanin in this aquatic microorganism makes

the study of phycocyanin gene sequence heterogeneity ideal for the

classification of freshwater cyanobacteria (Neilan et al., 1222). Phycocyanin

operon contains genes coding for two bilin subunits and three linker

polypeptides (Figure 1-3).

The intergenic spacer (IGS) between the two bilin subunit genes,

designated as b (cpcB) and a (cpcA) showed variations in their sequences

which are capable of differentiating genotypes below the generic level make

it useful for the identification of cyanobacteria via PCR (Wu et al., 0212).

Figure 1-1. Phycocyanin operon (Neilan et al., 1331).

Universal primers for direct sequencing of 12S rRNA genes are usually

designed to be used with axenic cultures. In several studies 12S rRNA gene

has successfully been used for cyanobacterial phylogeny (Lyra et al., 1222;

Rajaniemi et al., 0222; Arima et al., 0210). Furthermore, the restriction

fragment length polymorphism (RFLP) of particular PCR products can

provide signature profiles specific to the genus, species, or even strain of

cyanobacteria has been undertaken using RFLPs of the 12S rRNA gene

(Lyra et al., 1222).

Analysis of the intergenic transcribed spacer region between the 12S

and 04S rRNA genes has been shown to be variable in length and number in

cyanobacteria that used to discriminate between different cyanobacterial

species and for phylogenetic analysis (Gugger et al., 0220).

Random amplified polymorphic DNA (RAPD) was used to generate

unique and identifying profiles for members of cyanobacterial genera

Anabaena and Microcystis. This method is based on the combination of the

two 12-meroligonucleotides in a single PCR and provided

specific and repeatable DNA fingerprints which made it possible to

discriminate among all toxigenic cyanobacteria studied, to the taxonomic

ranks of genera, species and strains. Analysis of DNA typing results

obtained by this method clearly discriminates between genera Anabaena and

Microcystis (Oinam et al., 0211). In addition, denaturing gradient gel

electrophoresis has been applied to the identification of Cyanobacteria

(Ramsing et al., 0222).

Flow cytometry was an increasingly valuable technique for the detection

and enumeration of waterborne pathogens at low numbers. Fluorescent in

situ hybridization (FISH) was a promising method for cyanobacterial

detection using labeled cyanobacterial DNA markers (Codd et al., 0222).

1.2.1 Detection of Toxins

To protect water users from poisoning and exposure to the toxins, it is

important to know the identity and quantity of the toxins in drinking water,

dietary supplements, important areas for recreation, animal Poisoning cases,

etc. (Meriluoto and Codd, 0222). Identification and quantification of

cyanobacterial toxin can be done by:

1.2.1-1 Biochemical Screening Methods of Cyanobacterial

Hepatotoxins

Screening assays are diagnostic tests, which establish the presence or

absence of a substance. Usually these tests provide quick, inexpensive and

reproducible results. Among the biochemical screening methods commonly

used for cyanobacterial peptide toxins are:

1. Mouse Assays

Toxin extracts are administered by intraperitoneal injection into the

mouse. It has generally been used in a qualitative manner to determine a

bloom as toxic or non-toxic and they have been shown not to be suitable for

determining microcystins at low concentration in water (Nicholson and

Burch, 0221).

1. Enzyme Linked Immunosorbent Assay

Enzyme linked immunosorbent assays (ELISAs), have been developed

for peptide cyanotoxins and have proved to be sensitive although many

studies have shown variable cross-reactivates. However, the technique has

been useful for routine screening of water for cyanotoxin contamination

(Pyo et al., 0222).

3. Phosphatase Inhibition Assays

Microcystins and nodularin, inhibit serine and threonine phosphatase

enzymes responsible for the dephosphorylation of intracellular

phosphoproteins. The inhibition of these enzymes was related to the

hepatotoxicity of these compounds and their tumor promotion properties.

The inhibition reaction by these toxins could be used as measure of toxin

concentrations (Chorus, 0221).

1.2.1-1 Physicochemical Analysis of Cyanobacterial Hepatotoxins.

These were analytical methods which used physicochemical properties

of cyanobacterial hepatotoxins such as the presence of UV chromophores

within their structures, specific functional groups present in their structures

and molecular weights. Among the methods employed were as follows:

1. HPLC Separation and Detection Methods

The widely reported procedures for the separation of microcystins and

nodularins employ the use of HPLC.

Although lack of both toxin standards and toxicity data, HPLC procedures

were still the most appropriate for monitoring for compliance with the

guidelines as stipulated by WHO (Mathys and Surholt, 0223).

0. Liquid Chromatography–Mass Spectrometric

Liquid chromatography–mass spectrometric may be employed when

further confirmation and identification of cyanotoxins were required. Mass

spectrometry as a detection technique provides the best solution to the

problem of cyanopeptide toxins since these toxins produce characteristic

ions in their mass spectra that enables the simultaneous separation and

identification of cyanotoxins in a mixture and determination of peptide

cyanotoxins with detection limits of∼2.20µg /L (Robillot et al, 0222).

3. Electrochemical Detection Methods

Other detection methods for peptide cyanotoxins include

electrochemical detection but the sensitivity with peptide cyanotoxins such

as microcystin-LA, which does not containing arginine, tryptophan or

tyrosine, was very poor (Meriluoto et al., 1222).

3. Capillary Electrophoresis

Capillary electrophoresis and related techniques have also been

considered for the separation and quantification of the peptide hepatotoxins.

But these have lower sensitivity when compared with HPLC procedures and

are not suitable for routine monitoring of water without further development

(Li et al., 1222).

1. Gas Chromatographic Method

A gas chromatographic method based on oxidation of microcystins that

splits the Adda side chain to produce4-methoxy-0-methyl-3-phenylbutyric

acid has been reported. Determination of this compound by gas

chromatography or by HPLC with fluorescence detection was reported with

detection limits of 2.34 ng in water samples. The limitation of this method

was that it required tedious procedures during the extraction, cleanup,

oxidation and post-treatment in order to eliminate the reagents used (Tsuji et

al., 0221).

1.2.1-3 Molecular Methods

The identification of genes responsible for biosynthesis of microcystins

by Microcystis and some other genera of cyanobacteria opened the

possibility of applying molecular methods to detect the presence of

cyanobacterial species and their genes encoding for the biosynthesis of

important cyanotoxins (Saker et al., 0222).

Several studies have demonstrated the relationship between microcystin

synthetase genes and the presence of microcystin in cyanobacterial cells.

Conventional PCR could be used to detect microcystin/nodularin producers

since the gene clusters are now known and several primers are available for

these large gene clusters (22kb for microcystins and 32 kb for nodularin). It

was evident that cyanobacteria often produce plenty of non–ribosomal cyclic

or linear peptides other than microcystins (Rouhiainen et al. 0223; Fastner et

al. 0221; Welker et al. 0223) and nodularins, and this should be taken into

consideration in primer design.

Microcystis aeruginosa was found worldwide, the most frequently

occurring microcystin producing cyanobacterial species and its biosynthetic

genes have been known for the longest time. For this reason, most studies

have focused on the detection of toxic Microcystis strains but later studies

found that other genera produced this toxin such as Oscillatoria and

Anabaena (Vaitomaa et al. 0224). There were few general primers designed

to detect several different producers of microcystins (Hisbergues et al. 0224;

Rantala et al. 0223).

The microcystin (myc) gene clusters contain peptide synthetases and

tailoring enzyme that encoded by ten genes (Microcystis and Anabaena) or

nine genes (Oscillatoria and Nodularia) as shown in Figure 1-2 (Kurmayer

and Christiansen, 0222).

Figure 1-1.The genetic baisis of toxin production in Cyanobacteria

(Kurmayer and Christiansen, 1553)

Vaitomaa et al. (0224) and Rantala et al. (0223) successfully used mcyE

primers to get PCR product from all known microcystin and nodularin

producers. This gene region was involved in the construction of Adda,

activation and condensation of glutamate. Adda and glutamic acid were

present in both microcystins and nodularins and showed to be the most

important determinants for toxicity of these compounds (Harada et al. 1222;

Rinehart et al., 1223; Goldberg et al. 1222). Structural variations of Adda

and glutamic acid in microcystins and nodularins are less frequent than other

parts of these molecules, which made this gene region attractive for primer

and probe design (Rantala et al. 0223). The microcystin synthetase genes

were ancient and the non–toxic strains have lost these genes during

evolution. This also implies that individual strains of cyanobacteria might

have retained these genes and new toxin producers among the cyanobacteria

currently regarded as non–producing species may still be found. DNA–based

detection methods are only able to identify potential toxin producers. The

analysis of high number of Microcystis strains and also environmental

samples have found only few cases where microcystin synthetasegenes were

detected but the organism was unable to produce microcystins possibly due

to mutations in the large gene cluster (Kaebernick et al. 0221).

Jungblut and Neilan, (0222) designed a PCR to detect all potential

microcystin and nodularin-produsing cyanobacteria from laboratory cultures

as well as in harmful algal blooms. They chose the aminotransferase domain,

which was located on the modules mcy E and nda F of the microcystin and

nodulrin synthetase enzyme complexes, respectively, as the target sequence

because of its essential function in the synthesis of all microcystins as well

as nodularin.

Baron-Sola et al., (0210) developed a multiplex PCR assay that allows

simultaneous detection of microcystin and / or cylindrospermopsin

producing strains in mixed population of cyanobacteria which various

primers sets were designed using mcy and aoa gene sequence related with

microcystin and cylindrospermopsin synthesis respectively.

Al-Tebrineh et al., (0211) developed quantitative PCR (qPCR) assay

based on SYBR-green chemistry for detection of potentially hepatotoxic

cyanobacteria spanning all known microcystin and nodularin producing taxa

using primers specifically targeting mcy and nda F.

DNA chips (microarrays) offer new insights into cyanobacterial

populations in natural environmental settings and for monitoring since large

amount of data could be created fast and the method automated. DNA chip

technology could identify all cyanobacteria that were present in a sample

accurately and identify the toxin producers depending on the designed

probes. It should be emphasized that toxic cyanobacteria could not be

identified by microscopy, thus this new technology was superior when it

comes to the identification of potentially toxic cyanobacteria in samples. It

had been developed a microarray based on 12S rRNA genes for a few

genera of cyanobacteria including Phormidium, Microcystis, Oscillatoria,

Anabaena, Aphanizomenon and Nostoc (Kurmayer and Christiansen, 0222).

Chapter Two Materials & Methods

1. Materials and Methods

1.1 Chemical Materials and Apparatus

1.1.1 Apparatus and Equipment

Certain equipments and instruments were used in this study (Table 0-1).

Table 1-1. Apparatus and equipment used in this study

Apparatus and Equipments Company (Origin)

Autoclave Express (U.K)

Centrifuge Beckman coulter (Germany)

Deep freezer Sanyo (Japan)

Digital camera Sony (China)

Water Distiller Control (England)

Electronic balance Matter (Switzerland)

Gel electrophoresis Cleaver (U.K)

Hot plate with magnetic stirrer IKA (Germany)

Cooled illuminated Incubator Heating block (Belgium)

Master cycler gradient PCR Eppendorff (Germany)

Microfuge Hettich (Germany)

Micropipette Human (Germany)

Compound Light Microscope Olympus (Japan)

Drying oven Memmert (Germany)

pH meter Jenwey (U.K)

Refrigerator Concord (Lebanon)

Spectrophotometer Shimadzu (Japan)

Transilluminator Consort (Germany)

Vortex Fanem (Brazil)

Water bath Memmert (Germany)

1.1.1 Chemical Materials

The chemical materials used to fulfill this study demands listed in Table (0-

0).

Table (1-1) The chemical materials used in this study.

Company (Origin) Chemical materials

FLUKA (Switzerland) NaNO4

FLUKA (Switzerland) K0HPO3

BDH ( England) MgSO3.2H0O

BDH ( England) Na0CO4

BDH ( England) Na0SiO4

BDH ( England) CaCl0

BDH ( England) EDTA-Na

BDH ( England) FeCl4

BDH ( England) MnCl0.3H0O

BDH ( England) (NH3)2.Mo2O03.3H0O

BDH ( England) ZnSO3.2H0O

BDH ( England) Citric acid

BDH ( England) CuSO3.2H0O

BDH ( England) Ferric acid

FLUKA (Switzerland) CoCl0.2H0O

FLUKA (Switzerland) H4BO4

BDH ( England) NaCl

FLUKA(Switzerland) MnCl0

HI media (India) Agar agar

GCC ( England) Hexane

GCC ( England) Ethanol

Promega (USA) Ethidium Bromide dye

GCC ( England) Tris-HCL

BDH ( England) Sodium acetate

BDH (England) chloroform

BDH ( England) isopropanol

1.1.3 Structural Culture Media

1. Modified Chu-15 Medium

Modified Chu-12 was used for the enhancement of algal growth

(Kassim et al., 1222). Stock solution of each salt was prepared by dissolving

certain weight of the salt as it clearly demonstrate in Table 0-4 in one litter

of distilled water; 0.2 ml was taken from each stock solution and completed

with D.W up to one litter, then autoclaved and added finally to get one litter

of modified Chu-12 and its pH was set on 2.3 before the sterilization using

2.21N of sodium hydroxide or hydrochloric acid.

Table 1-3. The components concentration of chemicals used in modified Chu-

15 medium.

Number of stock

solution

Chemical formula of each

salt

Concentration

g/l

1 MgSO3.2H0O 12

0 K0HPO3 3

4 NaNO4

CaCl0

2

12

3 FeCl4 2.40

2 EDTA-Na 3

2 NaCl 42

2 Na0CO4 2

2

MnCl0.3H0O

(NH3) 2Mo2O03.3H0O

ZnSO3.2H0O

CuSO3.2H0O

COCl0.2H0O

H4BO4

2.20

2.202

2.003

2.22

2.223

2.022

2 Na0Sio4 2.2

1. Allen's Medium

Modified Allen's medium was used for the enhancement of algal

growth especially blue-green algae (Allen, 1222). The stocks were prepared

for all macro and micro elements (Table 0-3) and dissolved in one liter of

distilled water to prepare Allen culture medium which was buffered to pH

2.2 using 2.21N of sodium hydroxide or hydrochloric acid. Allen culture

medium autoclaved and kept in refrigerator until needed.

Table 1-1. The components concentration in Allen's culture medium.

Macro element Stock

solutions

ml / liter

NaNO4 422 g/l 2

Na0CO4 12 g/l 0

Na0SiO4.2H0O 02 g/l 0

Citric acid 4.2 g/l 0

Ferric acid 4.2 g/l 0

EDTA 2.20 g/l 0

CaCl0 14.0 g/l 0

MgSO3.2H0O 42.2 g/l 0

K0HPO3 o.122 g/l 2

Micro element Stock

solutions

ml / liter

H4Bo4 2.22 g/l 1

Na0MOo3.0H0O 2.2 g/l 1

MnCl0.3H0O 2.2 g/l 1

ZnSO3.2H0O 2.022 g/l 1

CoCl0.0H0O 2.2 g/l 1

CuCl0.0H0O 2.23 g/l 1

1.1 Site Description and Sample Collection

During September 0211 to August 0210, samples were collected

monthly from three drinking water treatment stations in Baghdad City that

are represent three sites : northern , middle and southern of city. These

stations located on the Tigris River (Figure 0-1) as follows:

1. Sharak Dijla (S. Dijla) station which located in northern of Baghdad.

This station located on longitude 33°02'02.22"E and latitude

44°14'20.22"N.

0. Al-Wathba station located in the center of Baghdad. This station

located on longitude 02°33'32.22"E and latitude 02°44'44.22"N.

4. Al- Rasheed station located in southern of Baghdad. This station

located on longitude 33°02'02.22"E and latitude 44°14'20.22"N.

Figure 1-1. Map of studied stations on Tigris River in Baghdad

(Google earth programme)

Baghdad

City

Sharek Dijla

Station

Al-Wathba

Station

Al-Rasheed

Station

1.2

km

15.1

km

Samples were collected from the higher superficial layer 02-42cm deep

from intake of river and sedimentation tank in the amount of two samples,

one of them for isolation and other for algal identification while attached

algal (periphyton) samples were collected from the walls of sedimentation

tanks. Collection method was performed using a 02µ mesh net. Samples

were transported immediately to the lab and incubated under controlled

conditions for algal growth (022) µE/m /s and 022 0 C˚.

Attached algal samples were prepared by selection an area 02×02 cm

from attached algae on walls of sedimentation tank, then determined area

was scraped by spatula and brought to lab in 222 ml a beaker covered with

aluminum foil. Algae were rinsed 2-2 times with distilled water to remove

the clay and particles. The bio mass of algae was fractionated to pieces and

every fraction was located in a petridish containing 12 ml distilled water to

fractionation and cutting the biomass to small pieces using needles , then the

solution with contents were sucked using syringe into beaker, this process

repeated 3-2 times to homogenize of content with algal biomass. The

aqueous solution which contain suspend algae were transported to flask

contain 222 ml culture media chu-12 or Allen's, then flask incubated in

laminar incubator (Al-Dulaimi, 0222).

Lugol's solution was added to the collected water samples will be used

for algal identification. Lugol's solution prepared by dissolving 12g pure

iodine in distilled water, then 02g potassium iodide was added then the

volume completed to 022ml distilled water, then 02 ml glacial acetic acid

was added and kept until performing the microscopic examine.

1.3 Phytoplankton and Periphyton

1.3.1 Qualitative Study

Non-diatomic algae were identified by preparing slides and examined

under 32 xs by using compound microscope in depending on the following

references which used for identification of non-diatomic algae (Desikachary,

1222; Prescott, 1223; Prescott, 1222; Prescott, 1220).

While diatoms were identified after dissolving the organic matter by

using nitric acid and examined under 122 xs in depending on (Hustedt,

1242; Hustedt, 1222).

One liter of each sample was placed in one liter Duran cylinder and

mixed with Lugol's solution and left to settle for 12 days and then

concentrated to 122 ml by a siphon.

The same steps were repeated on 122 ml of the concentrated sample, it

was placed in 122 ml cylinder and left for one week in the laboratory for

reduction to 12 ml. A clean slide was left on a hot plate at 22-22 °C and a

2.22 ml drop of the preserved concentrated sample was put in the middle of

the slide and dried, then a drop of concentrated Nitric acid was put on the

dried drop and after evaporation of the acid drop, Canada Balsam was placed

on a cover slip and put on the dried sample and pressed to remove any air

bubbles (Furet and Benson, 1220).

1.3.1 Quantitative Study

Total number count of Phytoplankton and periphyton was performed by

use sedimentation method (Furet and Benson, 1220).

One liter of each sample taken was put in graduated cylinder (1222 ml),

samples were preserved by adding drops of Lugol's solution and left in stand

place, after seven days, 222 ml were sucked by siphon method. The rest was

transported to another cylinder (122 ml) and left at the same method to

seven days, after that 22 ml withdrawn and the rest (12 ml) put in covered

glass container with adding two drops of Lugol's solution.

3.1 Isolation and Purification of Algae

Uni-algal culture was obtained by using the following methods:

A- Chu-12 nutrient solution solidified by 01 agar-agar and autoclaved, after

sterilization with 32-22 C˚ was poured in petri-dishes and left to solidify.

Then the surface of each plate was inoculated with 1 ml of sampled water,

the inoculum distributed with a sterile spreader or streaking using a sterile

loop. The inoculated plates were kept in a cooled illuminated incubator with

about 022 µE/m /s light intensity and 022 0 C˚ for 2- 12 days. Aggregated

colonies were observed on the surface of plates. Part from these colonies

was stroke on other plates. Each subculture was examined intervaly, this

method was repeated till a uni algal culture or cultures have been gained

(Stein, 1224).

A small part of unialgal culture (which was microscopically confirmed

as unialgal culture) was transferred into Chu-12 nutrient solution within a

022 ml sterile flask and incubated for 0-4 weeks according to method of

Jawad (1220) to get appropriate growth. In order to sustain the viability of

the uni algal growth, these cultures should be renewed every two weeks by

sub culturing into another Chu-12 nutrient solution.

B- Serial dilutions from the collected samples were prepared starting with

1ml of sample inoculated into 2 ml of Chu-12 nutrient solution. This

procedure was repeated with examining of each dilution until one species of

algae was obtained. After the target dilution was microscopically examined

several times to ensure obtaining unialgal culture, 0 ml of unialgal culture

was transferred into 02 ml of fresh Chu-12 enhancement solution then

incubated for algal growth which described previously till the culture turn

into greenish color (Jawad, 1220). Obtained algal isolates were identified

with help of classical algal classification references (Desikachary, 1222;

Prescott, 1224).

1.1 Physio-Chemical Parameters

1.1.1 Field Work

Water samples were taken from different sites of studied stations located

on the Tigris River.

1.1.1.1 Temperature

Water temperature was measured immediately in the field by placing

a precise clean mercury thermometer (range 12 to 22 Cº) graduated up to 2.1

Cº.

1.1.1.1 Electrical Conductivity and pH

The electrical conductivity, and pH were measured by using pH-EC-

TDS meter (HANNA Instruments).The expression of results were S/cm for

conductivity .

1.1.1.3 Turbidity

Turbidity was determined by using Turbidometer (HACH Instruments)

model 0122A after instrument calibration by known turbidity stander

solution. Turbidity expressed with Nephlometric Turbidity Unit (NTU).

1.1.1.1 Calcium

Calcium levels were calculated by following the procedure below:

0ml of Sodium hydroxide (1N) were added to 22 ml sample and shacked

well, then 2.1 gm of Murexide indicator was added and shacked well, the

solution will have a pink Color. The titration was carried out against 2.21 M

EDTA solution until the color changed from pink to purple (Lind, 1222).

Calcium expressed in mg/ l.

1.1.1.1 Magnesium

Magnesium levels calculated from the subtraction the results of Calcium

from the total hardness as results (Lind, 1222). Magnesium expressed in

mg/ l.

mg Mg +0

per liter = 10.12 x (m Eq hardness per liter – m Eq Ca+0

per liter)

m Eq hardness per liter = mg hardness per liter x 2.21222

m Eq Ca+0

per liter = mg Ca+0

per liter x 2.2322

1.2 Nutrients

For nutrient analysis, samples were collected and Filtrated in the same

day. One liter from each site was filtered by using GF/C 2.32 µm filter

papers, by a Millipore Apparatus. From the filtered sample 022 ml was

collected in a glass container for NO0-, NO4

- and SiO3

-4 analysis. The

containers were then kept in the refrigerator until analysis in the laboratory.

1.2.1 Dissolved Nitrate

Nitrate estimated by taking 2ml of sampled water which diluted to 22 ml

with distilled water .One ml of HCl (1 M) was added to the sample, the

solution was measured in 1cm cuvette using a wavelength of 002nm .The

water sample estimation was repeated in a wavelength of 220 nm, the

differences between two measures had been depended (APHA, 1222)

Nitrate concentration was estimated by this expression:

µg NO4-N/L= (mgNO4 _ N) (3.34)/ml of sample

1.2.1 Dissolved Nitrite

Fifty ml from the water sample was taken and one ml Sulphanilamide

solution was added with shaking. After two minutes 1ml n-(1-naphthyl)-

ethelene-diamine solution was added. After 12-02 minutes the absorbance of

the light pink color of samples were measured by a Cintra-2 UV-Visible

Spectrophotometer at wavelength 234 nm (APHA, 1222). Results were

stated in the unit μg nitrogen- nitrite /l.

1. 2.3 Reactive Dissolved Silicate

The used method was basically taken from Mullin and Riley (1222), as

described by Parsons et al., (1223). The resulting extinction was then

measured spectrophotometrically at 212 nm, and was stated in the unit μg

SiO3-Si/l.

1.1 Extraction of Gnomic DNA

1.1.1 Extraction of Gnomic DNA from Cyanophyceae Isolates

DNA was extracted from cyanobacterial isolates cells using a following

manual purification procedure (Matehkolaei et al., 0210):

1. Algal growth was concentrated by centrifuge (2222 rpm/12 min) to

obtain heavy growth.

0. Placed in 1.2ml tube containing 022 µl lysis buffer (022Mm Tris-HCL,

02Mm EDTA, 2.2 % SDS, 022mM NaCl) and crushed with conical

grinder.

4. Incubated for 02 min at 122˚C.

3. Added 122µl of sodium acetate (4.2 M).

2. Kept at -02 ˚C for 12 min.

2. Centrifuged at 10222 rpm for 12 min.

2. Supernatant was extracted once with phenol-chloroform-isoamyl alcohol

(0250351) and subsequently with chloroform, then centrifuged at 10222

rpm for 12 min.

2. DNA was precipitated with equal volume of isopropanol and centrifuged

at 10222 rpm for 12 min.

2. Pelt DNA washed with 022 µl of 221 ethanol.

12. Centrifuged at 10222 rpm for 12 min.

Dried and suspended in 22 µl TE buffer (12 mM Tris-HCl, 1 mM EDTA,

pH= 2.3).

1.1.1 Extraction of Gnomic DNA from Chlorophyceae Isolates for

Specificity test (Doyle and Doyle, 1335)

1. Preheat 2-2.2 ml of CTAB isolation buffer (01 cetyltrimethyl ammonium

bromide, 1.3 M NaCl, 2.01 0-mercaptoethanol, 02 mM EDTA, 122 mM

Tris-HCl, pH 2.2) in a 42 ml glass centrifuge tube to 22 C˚ in a water

bath.

0. Grind 2.2-1g fresh chlorophyceae isolates in 22 C˚ CTAB isolation

buffer in a preheated mortar.

4. Incubate sample at 22˚C for 42 minutes with optional occasional gentle

swirling.

3. Extract once with chloroform-isoamyl alcohol (0351), mixing gently but

thoroughly.

2. Spin in clinical centrifuge (swinging bucket rotor) at room temperature to

concentrate phases using 2,222 x g for 12 min.

2. Remove aqueous phase with wide bore pipette, transfer to clean glass

centrifuge tube, add 0/4 volumes cold isopropanol, and mix gently to

precipitate nucleic acids.

2. If possible, spool out nucleic acids with a glass hook and transfer to 12-

02 ml of wash buffer (221 EtOH, 12 mM ammonium acetate).

2. Spin down nucleic acids using 2,222 x g for 12 min after a minimum of

02 min of washing. The wash step is another convenient stopping point,

as samples can be left at room temperature in wash buffer for at least two

days without noticeable problems.

2. Pour off supernatant carefully (some pellets are still loose even after this

longer spin) and allow to air dry briefly at room temperature.

12. Resuspend nucleic acid pellet in 1 ml TE buffer.

11. Add RNAase A to a final concentration of 12µg/ml and incubate 42

min at 42 C˚.

10. Dilute sample with 0 volumes of distilled water or TE, add

ammonium acetate (2.2 M stock, pH 2.2) to a final concentration of 0.2

M, mix and add 0.2 volumes of cold EtOH, and gently mix to precipitate

DNA.

14. Spin down DNA at high speed (12,222 x g for 12 min in refrigerated

centrifuge).

13. Air dry sample and resuspend in appropriate amount of TE.

1.1.3 Estimation of the DNA Concentration and Purity

The DNA concentration was determined by using spectrophotometer,

12µl of each DNA specimen were added to 222µl of distal water and mixed

well. Spectrophotometer was used to measure the optical density (O.D) at

wave length of 022nm and 022nm.

An O.D of one corresponds to approximately 22µg/ml for double strand

DNA. The concentration of DNA was calculated according to the formula:

DNA concentration (µg/ml) = O.D 022nm × 22 × dilution factor

Spectrophotometer was used also to estimate the purity ratio of DNA

according to below formula:

DNA purity = O.D 022nm / O.D 022nm

The ratio used to detect nucleic acid contamination in protein

preparation. DNA quality can be assessed by 2.21 agarose gel

electrophoresis (Maniatis et al., 1220).

1.2 Conventional PCR Technique

PCR technique was applied on seven cyanobacterial isolates (Nostoc

carneum, Microcystis aeruginosa, M. flos-aquae, Westiellopsis prolifica,

Oscillatoria limnetica, Lyngbya sp. and Chroococcus turigidus which were

isolated from the three stations of study.

1.2.1 Primers Selection and Preparation

The first set of primers (PCβF/PCαR) was used as a positive control to

confirm the presence of cyanobacterial DNA and produced a 222 bp gene

fragment from the phycocyanin operon, shared by all cyanobacteria (Saker

et al., 0222)

The aminotransferase (AMT) domain which is located on the modules

mcyE of the microcystin synthetase enzyme complex was chosen as the

target sequence for the second set of primers (HEPF/ HEPR) because of its

essential function in the synthesis of all microcystins and nodularins. It was

possible to amplify a 320 bp PCR product from the AMT domain of all

tested hepatotoxic species.

Primers were provided in lyophilized form, dissolved in sterile distilled

water to give a final concentration of 122 pmol/ µl as recommended by

provider and stored in a deep freezer until used in PCR amplification. The

primer sequence used in this listed in Table 0-2.

Table 1-1. The primers sequence used in conventional PCR (Jungblut and

Neilan, 1552;Saker et al. 1551).

Primer

name

Sequence

1´ 3´

Length GC

%

PCR

products

HEPF TTTGGGGTTAACTTTTTTGGGCATAGTC 02 33 320 bp

HEPR AATTCTTGAGGCTGTAAATCGGGTTT 02 32

PCβF GGCTGCTTGTTTACGCGACA 02 42 222 bp

PCαR CCAGTACCACCAGCAACTAA 02 42

1.2.1 Determination of PCR Specificity (Saker et al., 1551).

For specificity of PCR, DNA from some chlorophyta (Scenedesmus sp.

and Chlorella sp.) that were isolated from the same positions in drinking

treatment stations were extracted using the same extraction method in

section 0.2.0. DNA concentration and purity from each one was determined

then PCR was performed and the results observed on a 1.21 agarose gel

electrophoresis. The PCR was considered specific for particular bacteria

when DNA amplification of a specific product was obtained to that

bacterium and not to others used in this study.

1.2.3 PCR Amplification

The extracted DNA, primers and PCR premix (Accupower, Bionear) was

thawed at 3˚C, vortex and centrifuged briefly to bring the contents to the

bottom of the tubes. PCR mixture was set up in a total volume of 02µl

included 2µl of PCR premix, 1µl of each primer and 0µl of template DNA

then the rest volume was completed with sterile D.W. PCR mixture was

performed according to the number of tests and distributed into PCR

reaction tubes with 12µl, vortex and added 0µl of template DNA. Negative

control contains all material except that distilled water was instead of

template DNA.

PCR reaction tubes were placed into thermocycler PCR instrument. DNA

was amplified using the protocol in Table 0-2:

Table 1-2. The program used in the thermocyler PCR.

Stage Temperature (time) PCβF/PCαR

Temperature (time) HEPF/ HEPR

Initial denaturation 22˚C (0min) 22˚C (0min)

Denaturation 22˚C (22

sec)

42 cycles

22˚C (22sec)

42 cycles

Annealing 20˚C (42sec) 23˚C (32sec)

Extension 20˚C (1min) 20˚C (1min)

Final extension 20˚C (2min) 20˚C (2min)

12µl of PCR product was separate in 1.21 agarose gel electrophoresis,

the size of amplified products were compared with the 122bp DNA ladder to

determine the exact size of these products.

0.2 Statistical Analysis

The statistical programmed SPSS (Statistical Package for the Social

Sciences) version twenty was used to analysis the effect of difference factors

in this study. Mean and standard error values were calculated for each of

physio-chemical parameters. T- independent test was used to analysis the

differences in Physical-chemical parameters and also for count of

cyanophyceae between stations.

ANOVA table was employed to study the effect of Physio-chemical

parameters on count of cyanophyceae in studied stations.

Chapter Three Results & Discussion

3. Results and Discussion

3.1 Physical, Chemical and Biological Characteristics

Study of physical, chemical and biological characteristics of aquatic

ecosystems is extremely important because physical and chemical analysis

provide information on water conditions which are critical when the object

under study is a lotic system, in which the water is continually renewed at

each point. Biological analysis can detect possible alterations in water

quality, as well as the tendencies over times that are reflected in habitat

changes or the nature of aquatic organisms (Chellappa et al., 0222).

3.1.1 Physical and Chemical Characteristics of sampling river intake

1. Temperature

The results of the current study revealed that the water temperature was

ranged between 14–40°C in all stations during the study period. Water

temperature which recorded was the highest at Al-Rasheed station was 40°C

during August whereas the lowest value was 14 °C in S. Dijla and Al-

Wathba stations during January (Figure 4-1).

There is an important role of temperature in water quality monitoring

that affects the amount of dissolved oxygen, rate of photosynthesis by

aquatic plants and phytoplankton, and metabolic rates of aquatic organisms

(Boyd, 0222).

The climate of Iraq characterized with seasonal and daily fluctuations,

thereby the temperature was highly varied between summer and winter.

Temperatures of water in the studied stations revealed clear variations

during the study period; the highest was in August while the lowest was in

January. Many researchers reported that air temperature and energy of sun

influences the water temperature and this belongs to the seasonal and daily

fluctuations in all months of year (Al- janabi, 0211). However, there are

other influences such as: climatic conditions, flood; inflows and outflows

(streams, creeks, groundwater seepage, etc.); the shape and depth of the

water body basin; wind and waves; even the clarity of water which could

affect the temperature (Canter, 1222).

Figure 3-1. Monthly variations in temperatures of studied stations.

Statistical analysis revealed that the water temperature at all stations

recorded significant (P ≤2.221) between months of study period, but not

between studied stations. Moreover, the water temperature showed

significant positive correlation (P ≤2.221) with the total cell count of

cyanobacteria in all studied stations.

1. Turbidity

The results revealed that the water turbidity ranged between 2–102 NTU

with significant variations in turbidity (P≤2.22) were observed between

0

5

10

15

20

25

30

35

Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug

Tem

pra

ture

C º

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

months during study period in all stations but no significant differences were

showed in water turbidity between studied stations. The highest value was

102 NTU during April 0210 in Al-Wathba and Al- Rasheed stations, while

the lowest value was 2 NTU during December 0211 in S. Dijla station

(Figure 4-0).

Figure 3-1. Monthly variations of water turbidity in the studied stations.

The results revealed that the highest turbidity was appeared at Al-

Wathba and Al-Rasheed stations, these stations are located in regions with

industrial and energy plants. Al-Wathba station was located in the center of

Baghdad, with many industrial plants, hospitals and factories are located

there, all these plants and factories discharge their influents and wastes in the

river, while Al-Rasheed station was located at Southern part of Baghdad

in the Zaafaraniyah region where Al-Dura oil refinery, the company of plant

oil and Baghdad plant for electricity were located near this region. Factories

products such as paints and other wastes discharged directly into the river

without any treatments. Therefore, the results showed significant differences

0

20

40

60

80

100

120

140


Turb

idit

y

NTU

Months

S. Dijla St.

Al-Wathba St.

Al-Rasheed St.

between water turbidity and total cell count of cyanobacteria in Al-Rasheed

and Al-Wathba stations (P≤2.22) and S. Dijla station (P≤2.221).

3. Water pH

The results of this study revealed that pH values ranged between 2.2 and

2.4 (Figure 4-4). The highest value was on March while the lowest value

was on December in Al-Wathba station with significant difference (P≤2.22)

between months during study period in this station only. A significant

increasing in pH value observed in S. Dijla (P ≤2.221) and decreasing Al-

Wathba (P≤2.22) stations compared with Al-Rasheed station in October,

November and December; and S. Dijla station (P ≤2.221) on

April, May and June. In addition, no significant effects of pH value on the

total cell count of cyanobacteria.

Figure 3-3. Monthly variations of water PH in the studied stations.

7.5

7.6

7.7

7.8

7.9

8

8.1

8.2

8.3


pH

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

The maximum values of pH in the water of the studied stations were

scored in winter and springs seasons while the minimum values were in

summer season which might be due to phytoplankton productivity (Dwaish,

0210). There were no significant differences in pH recorded between

months during study period at all stations.

pH values were not much different in most study period and mostly

alkaline, the reason might be related to the abundance of bicarbonates and

carbonates in freshwater (Lind, 1222) and this results agreed with the study

of Al-ganabi, (0211).

In general, pH value increased in the spring and summer during study

period, this might be due to the highly blooming density of phytoplankton in

these seasons which revealed highly total count, Sabri et al. (1222) and

Goldman and Horne, (1224) have reported when the highly density of

phytoplankton are abundance, photosynthesis will activated and utilizing of

CO0 will increased and this lead to raising pH value.

.

1. Electrical Conductivity (E.C) µS/cm

Electrical conductivity results in this study ranged between224 µS/cm

and 1220 µS/cm, the lowest was recorded during October in S. Dijla

station, while the highest was observed on December in Al-

Wathba station that had significant differences (P≤2.22) between months of

study (Figure4-3).

Figure 3-1. Monthly variations of the water conductivity in the

studied stations.

In this study, S. Dijla and Al-Wathba stations showed significant

increasing in electrical conductivity compared with Al-Rasheed station on

July, August and September as well as it was no significant effect of pH

value on the total cell count of cyanobacteria.

However, the high electrical conductivity prove the eutriphic status of

the river area because of sediments increasing which composed of highly

dissolved ions and minerals concentrations which discharged in the river

(Detay, 1222), and this agreed with the current study which revealed that the

highly values was in December and January, this might be related to increase

of dissolved minerals because of the rain in these months and the draft of

soil which discharged in the river.

1. Ca+1

Concentrations

Figure 4-2 showed that Ca+0

concentration values during the study period

were ranged from 22 to 112 mg/l, the lowest value was during October in S.

0

200

400

600

800

1000

1200


Co

nd

icti

vity

(m

icro

sem

ins/

cm)

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed s.t

Dijla station, while the highest values was during December 0211 in Al-

Rasheed station. During month’s period, the Ca+0

concentrations revealed

significant differences in S. Dijla and Al-Wathba stations (P≤2.22).

Moreover, a significant decreasing in Ca+0

Concentrations in S. Dijla station

compared with other stations on October, November, December (P≤2.221),

January, February, March (P≤2.22); and (P ≤2.221) on June, July and

August. Ca+0

Concentrations not observed any effect on cell count of

cyanobacteria during study period.

Calcium is one of the dissolved positive ions that essential for animals

and plants (Hem, 1222). Gypsum and dolomite rocks found adjacent to

Tigris River north of Baghdad city are source of calcium ions because of

their high capabilities to dissolve. However, the ground water provides

calcium ions during leaching process of gypsum soil found in Tigris-River

basin (Al-Taai, 0222). On the other hands, increasing of calcium ions by

human activities due to formation of carbonic acid and dissolving of Lime

stones or from mixing of the surface water with the wastewater which

contains large quantities of organic materials and the oxidation of these

materials lead to produce carbon dioxide which increases calcium ions

(Langmuir, 1222; Al-Janabi, et al., 0210).

Monthly variation of calcium ions concentration was increased in

December due to rainfall and increase of water levels which help to dissolve

quantities of calcium ions especially when river pass in regions enriched

with gypsum (AL-Sarraf, 0222), however this level decreased in spring and

Summer which might be related to the utilizing of these ions for skeleton

formation of some organisms, or for eggs growing and reproduction of

fishes (Al-Maliki, 0222).

Figure 3-1. Monthly variations in Calcium of studied stations.

2. Mg+ Concentrations

The results appeared that Mg+ concentrations values during the study

period were ranged from 04 to 43 mg/l (Figure 4-2); the highest reading

values was showed during December and March in Al-Wathba station that

had significant differences (P≤2.22) between months of study while the

lowest readings was scored during September in S. Dijla station. A

significant decreasing in Mg+0

concentrations in S. Dijla stations in

comparison with Al-Wathba stations (P≤2.221) and Al-Rasheed station

(P≤2.22) on January, February and March. Also, it was found a significant

positive correlation with the total count of cyanobacteria (P≤2.221) in Al-

Wathba stations.

The monthly variation of magnesium ions concentration during this study

varied which might be due to the depth of the river, the rate of flux, the

geological nature of adjacent regions, the nature of river bottom,

concentration of salts and turbidity…etc (Lee et al., 1224).

0

20

40

60

80

100

120

Sep

Oct

No

v

De

c

Jan

Feb

Mar

Ap

r

May Jun

Jul

Au

g

Ca

(mg/

L)

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

The reasons of increasing magnesium concentration in Tigris River

belonged to the leaching of the soil in regions adjacent to the river especially

mid of Iraq, these regions are rich with magnesium and calcium ions

especially in rainy months (Al-Maliki, 0222).

Figure (3-2). Monthly variations in Magnesium of studied stations.

Al-Sarraf (0222) reported that Tigris River affected by Al-azaim River

which known to have high level of magnesium and calcium ions.

1. Nitrite NO1 (mg/l)

Reactive nitrites values for the current study ranged between (2.212 and

2.24) mg/l, the lowest value was in Al-Wathba station during December and

July, while the highest value was in the same station during April and

February (Figure 4-2). There were no significant differences during month’s

period but there was a significant increase in NO0 Concentrations which

observed between S. Dijla and Al-Wathba stations (P≤2.22) on October,

November, December, June, July and August as well as significant increase

0

5

10

15

20

25

30

35


Mg

(mg/

L)

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

at Al-Rasheed station (P≤2.22) on June, July and August compared with

other stations. There was no significant effect of NO0 Concentrations on cell

count of cyanobacteria in this study.

Nitrite compound considered as a medium product and non stable

effected by the oxidation and reduction of non-organic nitrogen, present in

low level of waters with good ventilation. This converts by the oxidation to

NO4 while NO0 reduced and convert to ammonia when oxygen is low

(Goldman and Horn, 1224). Generally, the levels of nitrite reported to be

law in the flow waters (Reid, 1221).

The current results showed that the concentration of nitrite were low

and readings did not pass more than 2.12 mg/L, this might be due to good

ventilation of Tigris river, but high concentration of nitrite in February and

April could be attributed to secretions of phytoplankton and zooplankton

(Hutchinson, 1222).

Figure 3-1. Monthly variations in Nitrite of studied stations.

.

0

0.002

0.004

0.006

0.008

0.01

0.012

0.014

0.016

NO

2 (

mg/

L)

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

2. Nitrate NO3 (mg/l)

The results of nitrates values shown in figure 4-2 ranged between

2.212 and 2.24 mg/l. The highest value was 1.32 mg/l in S. Dijla station

during April, while the lowest value was 2.43 mg/l in the same station

during December. There was a significant difference in NO4 concentration

during month’s period in S. Dijla (P≤2.22) and Al-Rasheed stations

(P≤2.221) and also a significant difference in NO0 concentrations appeared

in Al-Wathba station (P≤2.22) on October, November and December

compared with Al-Rasheed station. there was no significant effect of NO0

Concentrations on total cell count of cyanobacteria in this study.

Concentrations of Nitrate scored high level at summer and spring this

probably due to the bacterial activity and decomposition of organic

compounds associated with higher temperature. On the other hand, the

decreased concentrations of NO4 in spring were mostly due to decrease of

aquatic plants growth during these seasons (Dwaish, 0210).

Figure 3-2. Monthly variations of Nitrate in studied stations.

0

0.2

0.4

0.6

0.8

1

1.2

1.4


NO

3(M

g/L)

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

The relative increasing of nitrate on January, February, March and April

might be related to the rainfall or to the draft of some sedimentation enriched

with minerals (Al-Nimma, 1220; Al-Lami, 1222). These temporarily

increasing were resulted from discharging of sewage wastewater or the draft

of nitrogen compounds from adjacent regions of the river as well as it has

been pointed that increase of phosphate and nitrates together give indicator

for source of chemical fertilizer (McKenzie et al., 0221).

The source of nitrates in water is flowing from agricultural regions

which contain chemical fertilizer or from the effluents of factories and

sewage wastewater which discharged without any treatment in the river (Al-

Janabi, 0211).

The reduction of nitrates during August might be belonged to the

utilization by organisms which consider the essential source for plants in

general and especially for algae (Maitland, 1222; Saad and Antoine, 1222).

3. Silicate Sio1 (mg/l)

Silicate values results ranged between 2.2 and 1.2 mg/l, the highest

value was in S. Dijla station during April and July, while the lowest value in

Al-Rasheed station during December (Figure 4-2). During month’s period,

the silicate concentrations observed significant differences in Al-wathba

stations (P≤2.22) and Al-Rasheed station (P≤2.221). There was a significant

increase in silicate Concentrations which observed in S. Dijla (P≤2.22)

on April, May and June compared with other stations.

The high positive correlation between diatoms and reactive silicate

might be due to the main biological uptake of silicon which caused by a

specific abundant, group of algae (the diatoms). They have a substantial

silica requirement because they construct their cell wall from silica and that

agreed with Reynolds (1223) who reported that the ratio of silica to

chlorophyll could be as high as 42–32 on a weight basis (Dwaish, 0210).

Dwaish, (1511) has reported the importance of silicon to aquatic

organisms in relation to its nutrient role which are significant to aquatic

organisms indirectly for acidic systems by reducing the environmental harm

from aluminum release due to acidic deposition.

Figure 3-3. Monthly variations of Silicate in studied stations.

3.1.1 Biological Characteristic of Phytoplankton and Periphyton

(Attached algae)

A total of 022 algal taxa (Table 1, Appendix 1) were identified in all

studied stations, 121 taxa belonged to Bacillariophyceae (diatoms), 32 taxa

to cyanophyceae and 22 taxa to chlorophyceae as illustrated in Table 4-1.

0

1

2

3

4

5

6

7


SIO

3 (

mg/

L)

Months

S.Dijla St.

Al-wathba St.

Al-Rasheed St.

The purpose of identification of main algal groups in the studied stations

was to know the location of cyanobacteria among these algae groups and

then we can assess the hazards of algal blooming of cyanobacteria according

to their dominancy.

In study of Al-Janabi, 0211 reported that freshwater algae in Iraq as to

Tigris river (in three site of Baghdad city) contains (004) species belong to

22 genera, (134) of them represented (42) genera related to

Bacillariophyceae, (32) species belong to (02) genera of Chlorophyceae and

(12) species related to Cyanophyceae, as well, there were four species to

Euglenophyceae has been represented by three genera. Rhodophyceae,

charophyceae, Xanthophyceae and Chrysophyceae were found with one

species for each one.

Table 4-1. List of algal species identified during the study period.

Absence (-), Presence (+).

Studied Stations

Taxa

S. Dijla

St.

Al-Wathba

St.

Al-Rasheed

St.

CYANOPHYCEAE

Anabaena sp. + + +

A. fertilissima - - +

Aphanocapsa endophytica - + +

Aphanizomenon sp. + - -

Chroococcus limneticus + + +

C. minor + + +

C. turgidus + + +

Haematococcus lacustris - - +

Gloeocapsa sp. + + +

http://www.google.iq/search?q=Aphanizomenon&spell=1&sa=X&ei=1DcGUvaPJsKlO8LfgNgF&ved=0CCMQvwUoAA&biw=1252&bih=572

G. aeruginosa - - +

Lyngbya sp. + + +

L. connectens + + +

L. gardneri - - +

L. lagerheimii + + +

L. spirulinoides - - +

Merismopedia elegans + - +

Microspora loefgrenii - - +

Microcystis aeruginosa + + +

M. flos-aquae + + +

Nostoc sp. - - +

N. carneum + + +

N. linckia + + +

Oscillatoria agardhii - + +

O. amoena + + +

O. curviceps + + +

O. formosa - + +

O. foreaui + + +

O. limnetica + + +

O. limosa + + +

O. ornata + + +

O. proboscidea + + +

O. peronata + + +

O. princeps + + +

O. proteus + + +

O. pseudogeminata - + -

O. subbrevis + + +

O. sancta + + +

O. tenuis + + +

O. tanganyikae + + +

Phormidium sp. + + +

P. tenue - + +

P. mucicola + - -

Spirulina sp. + + +

S. laxissima - - +

S. laxa + - +

S. major - - +

Tetraedron minimum - + -

Tetradesmus wisconsinense - + -

Westiellopsis prolifica * + + +

CHLOROPHYCEAE

Actinastrum gracilimum - - +

Ankistrodesmus sp. + + +

A. falcatus + + +

Botryococcus sp. + + +

Cladophora sp. + + +

C. glomerata + + +

C. crispate - + -

Chlamydomonas sp. + - +

C. angulosa + + -

C. cienkowskii + + +

C. epiphytica - + -

Chlorella ellipsoidea + + +

C. vulgaris + + +

Chrysidiastrum sp. + + +

Closteriopsis longissima + + +

Coelastrum microporum + + +

C. reticulatum + + +

Cosmarium sp. - + +

Dictyosphaerium sp. + - -

D. ehrenbergianum + - -

Dispora sp. + - -

Eremosphaera viridis - + -

Gloeocystis sp. + + -

Kirchneriella sp. + + +

K. lunaris + - -

K. obesa + - +

K. subsolitaria - + +

Microspora sp. - - +

Mougeotia sp. + + +

Mougeotia scalaris + + +

Monoraphidium contortum + - +

Oedogonium sp. + + +

O. capillare + + +

O. crassum - + -

O. globosum + - -

O. pratense - - +

Pandorina sp. + + +

P. morum - - +

Pediastrum boryanum + + +

P. duplex + + +

P. sculptatum + + +

P. simplex + + +

Scenedesmus. dimorphus + + +

S. quadricauda + + +

Selenastrum gracile - - +

Sphaerocystis sp. - + +

Spirogyra sp. + + +

S. aequinoctialis - - +

S. novae-angliae - - +

S. rhizobrachialis + - +

S. subsalsa + - -

S. scrobiculata + - -

Staurastrum sp. + + +

Ulothrix sp. + + +

U. aequalis + - -

U. tenerrima + - -

U. subconstricta + - -

Vaucheria sp. + + +

BACILARIOPHYCEAE

Achnanthes affinis + + +

A.delicatula + - -

A. minutissima - - +

A.microcephala + + +

A. hungarica + + +

A. lanceolata - + -

Amphlperora alata - - +

Amphora ovalis + + +

A. holsatica - + +

A. normanni - - +

A. commutata - + +

A. veneta + + +

Anomoeoneis vitrea + - +

Bacillaria paxillifer + + +

Calonies permagna - + -

C. venticosa + - -

C. bacillum - + -

C. amphisbaena - + -

Cymatoptopleura solea - + +

Cocconeis placentula + + +

C. disculus - + -

Cymbella affinis + + +

C. aspera + - +

C. cistula + + +

C. laevis - + -

C. amphicephala - - +

C. tumida + + +

C. lanceolata - + -

C. ventricosa + + +

C. helvetica - + -

C. gracilis + + +

C. cesatii + - -

C. cymbiformis + - -

C. naviculiformis - + +

C. parva + - -

C. caespitosa + + +

C. brehmii + - -

C. leptoceros + + +

Cyclotella comata + + +

C. atomus - + -

C. meneghiniana + + +

C. ocellata + + +

Diatoma elongatum + + +

D. vulgare + + +

D. hiemale - - +

Epithemia sp. + - +

Eunotia lunaris - + -

E. tenella - + +

E. pectinalis + + -

Fragilaria virescens - + +

F. brevistriata + + +

F. producta + - +

F. construens + - -

F. intermedia + + +

Gomphonema olivaceum + + +

G. gracile + - +

G. intricatum + - +

G. constrictum - - +

G. bohemicum + + +

G. lanceolatum - + -

G. acuminatum + - +

G.angustatum + + +

G. longiceps - + -

G. tergestinum + + -

Gyrosigma acuminatum + + +

G. attenuatum + + +

G. peisonis - + -

Hantzschia amphioxys - + +

Mastogloia elliptica + - -

M. smithii + + +

Melosira granulata + + +

M. ambigua + + +

M. dickiei + + +

M. italica - + -

Navicula clementis + - +

N. dicephala - - +

N. dubius - - +

N. cryptocephala - + -

N. radiosa + + +

N. phyllepta - + -

N. cymbula - - +

N. gracilis - + -

N. grimmei + + +

N. halophila + + -

N. lanceolate - - +

N. fragilarioides - + -

N. capitatoradiata - - +

N. neoventricosa - + +

N. seminulum - + +

N. pseudolanceolata + - +

N. brekkaensis + + +

N. tuscula - - +

N. hungarica - - +

N. graciloides - + -

N. insociabilis - - +

N. enigmatica + + -

N. peregrina + - -

N.digitoradiata + - -

N. anglica + - -

N. trivialis + + -

N.mutica - + -

N. schroeteri + + +

N. rostellata + - +

N. pusilla + - -

Nitzschia acicularis + + +

N. apiculata + - +

N. vitrea + - -

N. communis - + +

N. dissipate + + +

N. clausii + - -

N. longissima + + +

N. tryblionella - + +

N. subcapitellata + - -

N. obtusa + + -

N. parvula + - -

N. ignorata + - -

N. umbonata - - +

N. hungarica - - +

N. recta - + +

N. linearis + + +

N. minutula - + +

N. palea + + +

N. multiseries - - +

N. gracilis + + +

N. sigma + + +

N. sigmoidea + + +

N. romana + + +

N. fruticosa + + +

N. closterium - - +

N. intermedia - - +

N. vermicularis + + +

N. hantzschiana - - +

Neidium iridis + + +

Peronia fibula + + +

Pinnularia borealis + + +

P. appendiculata + + -

P. subcapitata - + +

P.gracillima - - +

P. globiceps - + -

P. leptosoma - + +

P. molaris + - +

P. acuminata - + +

P. tabellaria + - -

P. viridis + + -

P. biceps + + -

Rhopalodia parallela - + +

Rhoicosphenia curvata + + +

R. marina + + +

Stephanodiscus sp. + + +

Surirella ovalis - + +

S. ovata + + +

S. subsalsa - - +

Stauroneis sp. + + -

S. anceps + - -

Syndra ulna + + +

S. acus - + +

S. radians - + -

S. delicatissima + + +

S. tabulata + + +

S. rumpens - + -

Tabellaria flocculosa + - -

* New record species in Iraq

3.1 Dominant Blue-green Algae Species

Seven isolates were isolated from the river intake of the studied

stations which were: Microcystis aeruginosa, Microcystis flos-aquqae,

Lyngbya sp., Chroococcus turigidus, Westiellopsis prolifica, Oscillatoria

limnetica and Nostoc carneum. which belonged to four cyanobacterial

orders: Oscillatoriales, Chroococales, Stigonematales and Nostocales. As

showed in table 4-0 demonstrated the classification of dominant genera

isolated from stations that belongs to cyanobacteria.

Table 3-1. Morphological characters of the dominant cyanobacterial genera

Isolated from three stations located on Tigris River.

Classification Morphological characteristics

Non-heterocystous Filamentous forms

Division: Cyanophyta

Class: Cyanophyaceae

Order: Oscillatoriales

Family: Oscillatoriaceae

Genus: Lyngbya

Filamentous, composed of a uniseriate,

unbranched trichome of cells inclosed by a

non-gelatinous, more or less firm sheath,

planktonic and solitary, or aggregated,

forming entangled masses on substrate or

intermingled among other algae, some

speciesspirally coiled; trichomes mostly

cylindrical throughout and tapering very

slightly, if at all, toward the apices, which

are usually not capitates (Figure 4-12 A).



Order: Oscillatoriales

Family: Oscillatoriaceae

Genus: Oscillatoria

Trichomes unbranched and separate,

straight, slightly bent at apices; sheath

diffluent; filaments showed oscillatory and

creeping movements; cell cylindrical

sometimes quadrate; biconcave discs or dead

cells present which results in the formation

of hormogonia; apices of trichomes

distinctly marked provided with calyptra

(Figure.4-12 B).

Heterocystous Filamentous forms



Order: Nostocales

Family: Nostocaceae

Genus: Nostoc

Trichomes contorted, moniliform; sheath

thick, consistent and smooth; cells spherical

or barrel shaped; heterocysts intercalary;

akinites spherical, formed near or away from

the heterocysts (Figure 4-12 C).



Order:Stigonematales

Family: Hapalosiphonaceae

Genus:Westiellopsis

Filaments with true branching; made of

prostrate and erect systems, prostrate system

multiseriate, erect system uniseriate;

branches short, arising on both the sides:

individual sheath around filaments absent;

(Figure 4-12 D).

Unicellular forms

http://www.algaebase.org/browse/taxonomy/?id=87027



Order: Chroococcales

Family: Chroococcaceae

Genus: Microcystis

Forms clusters of cells (colonies) which may

be spherical, lobed or an extensive reticulate

mass. Suspended colonies often appear as

small blue-green "clots" to the unaided eye.

Individual cells are very small (4-2 mm

diameter) with conspicuous, highly

refractive pseudovacuoles that cause the

colonies to be buoyant and float to surface.

Cells of a colony are held together by a

transparent, gelatinous matrix which may be

difficult to discern under microscopic

examination (Figure 4-12 E and F).



Order: Chroococcales

Family: Chroococcaceae

Genus: Chroococcus

One-celled, or an association of 0-40 spherical,

hemispherical or ovate individuals, either free-

floating, adhering to submerged substrates, or

forming expansions in moist aerial habitats; each

cell with a sheath which may be distinct from or

(as in most planktonic species) confluent with

the common mucilage investing a group of cells;

several generations of sheath, present as a result

of successive cell divisions; sheaths either

hyaline or ochraceous; cell contents

homogeneous or granular, not vacuolated, light

to bright blue-green, olive-green, or yellowish

(Figure 4-12 G).

12µ

m

µm

12µ

m

µm

12µ

m

µm

12µ

m

µm

12µ

m

µm

12µ

m

µm

12µ

m

µm

A

G

F E

D

B

C

Figure 3-15. Photomicrographs of some dominant cyanobacteria isolated from three

stations on Tigris River. A: Lyngbya sp., B: Oscillatoria limnetica, C: Nostoc carneum,

D: Westiellopsis prolifica, E: Microcystis flos-aquae, F: M. aeruginosa

G: Chroococcus turigidus.

The Check list of Algae of Maulood and Toma, (0223) showed that

Westiellopsis prolifica is not recorded in Iraqi freshwater; however, this

cyanobacterium was identified as new record species in Iraqi freshwater

belonged to the order of Stigonematales. (Figure 4-11). Branched filaments

are devoid of a sheath and are not enveloped in mucilage. thallus

filamentous with true branching; filaments of two kinds, primary filaments

slightly thicker and more or less creeping, secondary filaments, thinner and

generally growing erect; filaments without a sheath and consisting of one

row of cells; with barrel-shaped cells, 2-10µ broad as long as or slightly

longer. heterocysts intercalary, oblong- cylindrical, 2.2-2µ broad and 12.2-

00µ long; gonidia formed singly in each cell of pseudohormocyts; the

dilated terminal portions of the secondary branches, by profuse transverse

and longitudinal division, form clusters of rounded cells (pseudohormocysts)

the contents of which escape as gonidia and develop into new alga.

This blue-green alga is capable of growing in different types of waste

water and could utilize various organic substances under varied growth

condition. It is a nitrogen-fixing (heterocystous blue-green alga), oxygenic,

photoautrophic and (Dash and Mishra, 1222). This alga tolerate many severe

conditions, were isolated from arid zones samples (Tiwari et al., 0222).

The dominant cyanobacterial genera in all studied stations in most of

the study period were: Lyngbya spp., Oscillatoria spp., Microcystis spp.,

Westiellopsis spp. , Nostoc spp. , Chroococcus spp. (Figure 4- 12). These

taxa were observed in all studied stations in most sites of samples

collection{river intake, sedimentation tanks and walls of sedimentation

tanks}while the genera Phorimidium spp., Tetradesmus spp.,Gloeocapsa

spp., Aphanocapsa spp., Haematococcus spp. were varied in their presence

during study peroid. However, Lyngbya spp. and Oscillatoria spp.

a

d

b

c

12µ

m

µm

12µ

m

µm

12µ

m

µm

12µ

m

µm

Figure 3-11. Westiellopsis prolifica. a: a mature plant; b: filament showing

secondary branch formation; c: a pseudohormocysts, showing longitudinal

division; d: free gonidia liberated from pseudohormocyst; e: filament with

heterocyst.

Were observed present in all studied stations and in most study period

compared with other cyanobacterial isolates.

The dominant species of Bacillariophyceae which identified in all

studied stations and most periods of study were: Melosira granulate,

Cyclotella meneghiniana, Cymbella affinis, Nitzschia palea, Syndra ulna,

Diatoma vulgare, Cocconies placentula, Cocconeis pediculus , Cyclotella

ocellata, and these findings agreed with the study of Al-Janabi, (0211).

The dominant genera of Chlorophyceae in most of study peroid were:

Pediastrum spp., Chlamydomonas spp. , Chlorella spp., Mougeotia spp.,

Scenedesmus spp. and Monorephidum spp., while the genera Pandorina

spp.was observed in S. Dijla station during October and November at all

sites of collected samples.

Bacillariophyceae group were dominant according to the total number

of taxa(diversity) in all stations, the second group of dominant algae was

Chlorophyceae follwoed by cyanophyceae. Interestingly, this dominancy

agreed with many studies on the Iraqi aquatic ecosystems which done by

e

12µ

m

µm

Huq et al., 1222; Huq et al.,1222; Saad and Antoine 1222; Saadala, 1222;

Al-Kubaisi, 1222; Al-Temimi, 0222; Al-Sarraf, 0222 and Farkha,

0222,Dwaish, 0210; Al-ganabi, 0211 but it does not agreed with these

studies when compared with the total cell count (disscused later) which

showed that dominancy was to Bacillariophyceae group while the second

group was cyanophyceae follwoed by Chlorophyceae (Table 0, Appendix 0).

Differences in the results with others might be belongs to the variations in

the climate of Iraq which related to the increase of temperature through

passed ten years compared with the temperature recorded on last decades,in

addition to the increase of pollutants (agricultural runoff , industrial and

sewage effluents) that discharged in the river. These factors provide

protected mesocosms of cyanobacteria growth and play a main role in their

dominancy. Vasconcelos (0222) reported that the most common

phytoplankton organisms are associated with eutrophication of freshwater

system are cyanobacteria.

Al-Sarraf, (0222) reported that the great similarity of speciation

formation between species in the studied stations belonged to the same

source of water which provides these stations.

Over the past three decades, the frequency and global distribution of

toxic cyanobacterial incidents reveales to have increased might be related to

the global climate changes (Neilan et al., 0214). Scientists suggest that

cyanobacteria will dominate phytoplankton communities for several reasons

included high atmospheric CO0 content will result in higher rates of

photosynthesis that can change the pH of water and allowing more tolerant

cyanobacteria to out-compete other phytoplankton. Increasing of water

temperature lead to increase phytoplankton growth rate while eukaryotic

primary producers’ growth rates begin to decline when water temperature

reaches 02˚C. In addition, with unknown weather patterns associated with

climate change, droughts that increase salinity of waters can encourage

growth of salt-tolerant cyanobacteria (Stewart, 0211). Finaly, the toxin

biosynthesis genes cluster associated transposition and the natural

transformability of certain species lead to a broader distribution of toxic

cyanobacterial taxa worldwide (Pearson et al., 0222).

The phytoplankton in many temperate fresh water ecosystem is often

dominated by cyanobcteria during mid-to late summer. In addition, warm

summer temperatures appear to favor bloom-forming cyanobacteria because

many species have high temperature optima for growth and photosynthesis

>02˚C (Tang et al.,1222). There are many studies reporting positive

correlation between cyanobacterial dominancy and water temperature

regardless of whether they are bloom-forming, mat-forming cyanobacteria

(Varis,1224) .

Interestingly, Al-Rasheed Station showed high pollution that might be

related to the location of this station in the south of Baghdad city. All wastes

of factories and sewage effluents are discharged in Tigris River lead to

increase the eutrification which increase the algal blooming especially

cyanobacterial blooming. This study showed that Al-Rasheed and Al-

Wathba stations revealed a heavy blooming compared with S.

Dijla station which increases possibility to produce cyanotoxins. In the case

of cyanobacterial blooms, toxigenic species often dominate cyanobacterial

blooms, with estimates suggesting that more than 221 of cyanobacterial

blooms typically produce cyanotoxins (Renaud et al. 0211). Figure 4-10

showed the blooming of algae in sedimentation tank.

A B

C D

Figure 3-11. Algal blooms in a studied station. A: a sedimentation tankB:

algal bloom. C and D: attached algae on the walls of sedimentation tank.

3.3 Phytoplankton and Periphyton (Attached algae) Total Count

Algae were considered as the main base for primary production in

natural waters (Reynolds, 1223). The total count of Phytoplankton in

stations measured during this study for river intakes, sedimentation tanks

and attached algae were varied (Figure 4-14). The total cell count of

attached Cyanophyceae was the highest (40.222 cell x 123/l) compared with

attached Bacillariophyceae and Chlorophytceae were 12.2cell x 123/l and 2

cell x 123/l

respectively. The total count of Bacillariophyceae was the

highest in river intake (2.2 cell x 123/l) and sedimentation tank (4.4 cell x

123/l) in studied stations. Usually the dominancy was for Bacillariophyceae

(Diatoms), but these results suggest that the dominancy of algae could be

changed from site to another. Cyanophytceae, the attached algae showed

higher total count in Al-Wathba station (40.222 cell x 123/l) in comparison

with other stations whereas the total count of river intake and sedimentation

tank have higher count in Al-Rasheed station (1.2 cell x 123/l and 1.2 cell x

123/l) respectively.

Figure 3-13. Total cell count of all algal groups in studied stations sites.

Figure 4-14. showed that the total count of attached cyanophaceae was

hgiher in Al-Wathba and Al-Rasheed stations comparrd with attached

Bacilariophyceae that might be related to the highly pollutants which

dischrged in river stretch where these stations locate,or might be due to the

acquisition of cyanphyceae to mucelagenous sheath which contributed to

increase the adhesive capability of these organisms,in addition to their

secreting of some compounds showed antimicrobial (anti diatomic,

antifungal and antibacterial) activities (Abed et al. 0211) or these organisms

0

5

10

15

20

25

30

35

cell

× 1

0⁴

/L

Bacillariophyceae

River intake

Sed. tank

Attached Algae

Cyanophyceae Chlorophyceae

have strong adhesive strength represented by secreting visco-elastic

materials (Callow and Callow, 0220), all these might be enable these

organisms to out-compete the other groups of algae to make the biofilm.

But in S.Dijla Station. The total count of attached Bacilariophyceae was

hgiher compared with attached cyanophaceae might be due to the low

pollutants which discharged in this region where S.Dijla located because of

limited industerial and energy plants compared with Al-Wathba and Al-

Rasheed stations.

The dominance of diatoms in most sites of stations resulting from

forming biofilms. They adhere to surfaces by secreting sticky extracellular

polymeric substances which provide the mechanism for motility of diatoms

called gliding. Attached cells divide rapidly giving rise to colonies that

eventually coalesce to form a compact biofilm, which may achieve 222 μm

in thickness.

In general the lowest total count for all groups of algae was in the

sedimentation tank, this might belonged to addition of alum which

precipitate planktons to bottom.

Monthly variations of total attached cyanobactreial count were the

highest in spring and summer months which might be due to highly

temperature.The total counts was droped down during winter and autumn

with decreasing of temperature ( Figure 4-13 ).

Results showed that Al-Wathba station had the highest attached

cyanobactreial total count in August ( 2.2 cell x 123/l) and the lowest on

November (2.213 cell x 123).

Figure 3-11. Monthly variation of attached cyanobactreial total count.

Cyanophyceae in river intake tended to be the highest total number

during summer; while they droped down during winter and autumn with

decreasing of temperature (Figure 4-12). Results showed that

Al-Rasheed station on August was the highest in total count of

cyanophyceae (3.40 cell x124

/l), while the lowest total count was in

Al-Wathba station on November (2.213 cell x123). This might be due to the

highly pollution in the region where Al-Rasheed station located.

0

1

2

3

4

5

6

7

8

9

10

Sep Oct Nov Dec Jen Feb Mar Apr May Jun Jul Aug

Ce

ll х

10

⁴ /

L

Months

S.Dijla St.

Wathba St.

Rasheed St.

Figure 3-11. Monthly variation in river intake of cyanobacterial total count.

The cyanophyceae present in the river intake of S. Dijla station showed

low cell count on July, August and September compared with Al-

Rasheed station (P≤2.22) that might be due to the region where

Al-Rasheed station locates (Table 0, Appendix 0). Also, the results revealed

significantly decreasing total count of attached cyanophyceae in S. Dijla

station (P≤2.22) compared with other stations on January, February and

March as well as with Al-Wathba station (P≤2.22) on June, July and August.

In the current study, the total cell count of cyanophyceae in sedimentation

tank was the highest during summer in September in Al-Wathba station

(Figure 4-12). Furtheremore, the statstical analysis showed significant

reduction in the total count of cyanophyceae in sedimentation tank in S.

Dijla station (P≤2.22) compared with other stations on April, May, June,

July, August and September.

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45


Ce

ll х

10

⁴ /

L

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

Figure 3-12. Monthly variation of cyanbacterial total count in

sedimentation tank.

Figures mentioned above suggest that the seasonal variations showed the

highest density of cyanophyceae obtained during summer and spring

months, while lower densities were observed in autumn and winter. The

results appered that the differences in temperature might be associated with

the variation in phytoplankton biomass. Thus, it is important to explore

variability in terms of seasonal changes (Peterson and Stevenson, 1222;

Dwaish, 0210).

Present study showed that there were some species which represnted as

pollution indicators such as Oscillatoria sp ., Lyngbya sp. And this agreed

with Al-Temimi (0222) study who noticed that these species of algae

increased in wastes region, effluents and wastwater directly discharged to

the river. Thus, this phenomena in this study was appeared in Al-Wathba

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1


Ce

ll х

10

⁴ /

L

Months

S.Dijla St.

Al-Wathba St.

Al-Rasheed St.

and Al-Rasheed stations due to large pollutants found in regions of these

stations were located.

The biological colonization of sedimentation walls depends on

environment and substrate has shown that the composition and predominant

phototroph species (cyanobacteria or algae) depend on the local climate

temperate or tropical (Govin et al., 0214).

3.1 PCR Technique

3.1.1 DNA Extraction

Genomic DNA was successfully extracted from approximately 122 mg

weight of cultured cells by using a manual purification procedure phenol-

chloroform-isoamyl alcohols method, DNA bands were confirmed and

analysed by gel electrophoresis (Figure 3-71). The purity of extracted DNA

was ranged between 7.1-7.3.

Figure 3-11. Analysis of genomic DNA of cyanobacteria isolates on agarose

gel (5.24) for two hours at 1 V/cm for 1 hrs, stained with ethidum bromide

and visualized on a UV transilluminator.

2555b

p

1555b

p

1555b

p

M: 1555bp DNA ladder. Lane 1-1: Genomic DNA extracted from Lyngbya

sp., Nostoc carneum, Westiellopsis prolifica, Microcystis aeruginosa,

Chroococcus turigidus, Microcystis flos-aquqae, Oscillatoria limnetica)

3.1.1 Detection of Cyanobacteria by PCR Technique

The development of a molecular method for the identification of

cyanobacteria is essential for the rapid and accurate analysis of members of

cyanobacterial population (Nelian et al., 1222).

In the current study, the gene fragment of the phycocyanin operon

containing the IGS (cpcBA-IGC) from cyanobacteria that commonly

associated with toxic bloom events was amplified. A distinct amplicon

patterns was produced from all of the DNA extracts with a size between

242-222 bp when analyzed in gel electrophoresis (Figure 4-12), confirming

the presence of cyanobacterial DNA from isolates collected from fresh water

of S. Dijla, Al-Wathba and Al- Rasheed on Tigris River in Baghdad. While

lysates of a green algae Scenedesmus sp. and Chlorella sp. does not possess

pycocyanin operon, gave no PCR product.

From these data revealed that the amplifications of the cpcBA-IGC from

cyanobacteria with no DNA detected from noncyanobacterial isolates was

provided reliable results.

Several studies used these sets of primer and reported the same results

(Saker et al., 0222; Baron-Sola, et al., 0210). Except in Nelian et al (1222)

study, he was reported that phycocyanin gene fragments from Nostoc

commune and Nostoc punctiforme were unable to be amplified by using

these primers while Strains of all of the cyanobacterial genera were

successfully amplified. In recent study found that Nostoc punctiforme had

short sequence and incomplete of cpcBA-IGC region resulting in high

variability in these genes and cause heterogeneity of genus Nostoc (Teneva

et al., 0210).

Figure 3-12. Gel electrophoresis of amplified cpcBA-IGC (235-155bp) in

cyanobacterial isolates. Agarose (1.14), 1 V/cm for 1 hrs, stained with

ethidum bromide and visualized on a UV transilluminator.

M. 155 bp DNA ladder. Lane 1-1. Westiellopsis prolifica, Microcystis

aeruginosa, Microcystis flos-aquqae, Nostoc carneum ,Oscillatoria limnetica,

Lyngbya sp. and Chroococcus turigidus respectively. Lane 2-3. Scenedesmus

sp. and Chlorella sp. Lane 15. Negative control.

For cyanobacteria, the phycocyanin operon is among the most used

molecular markers. The c-phycocyanin genes (cpcB and cpcA) and the

intervening IGS are relatively large-sized in comparison with other genes

encoding for photosynthetic pigments (~222- 222bp). In addition, these

genes are found in all cyanobacteria and they are almost totally restricted to

this group of organism when in freshwater ecosystems and it provides a

means of rapid and direct identification of cyanobacterial strains in samples

M 3 1 1 2 1 2 3 15 1 1

1555bp

155b

p

235-155

bp

containing complex microbial communities (Bolch et al., 1222; Wu et al.,

0212).

3.1.3 Detection of Microsystin by PCR Technique

The HEP primers were successfully amplified the 320 bp fragments of

mcy E gene from all microcystin-producing cyanobacterial isolates as shown

in Figure 4-12.

These positive results agreed with the study of Jungblut and Neilan

(0222). Ghosh et al. (0222) reported that the aminotransferase domain of

mcy E amplified using HEP primers in natural samples of different orders

producing microcystin revealed that PCR amplification and hepatotoxin

production was correlated by 122 %. Fiore et al. (0222) reported that

Westiellopsis was suspected to be mycrocystin producer.

Figure 3-13. Gel electrophoresis of amplified mycE (111bp) in cyanobacterial

isolates. Agarose (1.14), 1 V/cm for 1 hrs, stained with ethidum bromide and

visualized on a UV transilluminator.

1555bp

155bp 111bp

M 1 1 15 3 1 1 2 1 2 3

M. 155 bp DNA ladder. Lane 1-1. Westiellopsis prolifica, Microcystis

aeruginosa, Microcystis flos-aquqae, Nostoc carneum, Oscillatoria limnetica,

Lyngbya sp. and Chroococcus turigidus respectively. Lane 2-3. Scenedesmus

sp. and Chlorella sp. Lane 15. Negative control.

The detection of cyclic peptide hepatotoxin genes by using HEPF and

HEPR primers was developed to identify potentially microcystin or

nodularin-producing cyanobacterial blooms that posses the AMT domain of

either mcy E or nda F, involved in the production of microcystin or

nodularin from four order of cyanobacteria included Oscillatoriales,

Chroococales, Stigonematales and Nostocales (Jungblut and Neilan,0222).

The designing of primers based on the five complete microcystin

synthetase sequence of Microcystis aeruginosa PCC2222, M. aeruginosa

K-142, Anabaena strain 22 and Planktothrix sp. 102/2, as well as the

nodularin synthetase gene of Nodularin spumgina NSOR12 (Christiansen et

al.,0224; Moffitt and Neilan, 0223; Rouhiainen et al,.0223).

These primers targeted the AMT in the mcyE/ndaF gene for microcystin

and nodularin synthesis, respectively. This domain catalyzes the addition of

D- glutamate to Adda, an essential step in the synthesis of both microcystin

and nodularin (Al-Tebrineh et al., 0211).

Jungblut and Neilan,(0222) reported that is the AMT domain, which is

located on the modules mcyE and ndaF of the microcystin and nodularin

synthetase enzyme complexes, respectively, it was chosen as the target

sequence because of its essential function in the synthesis of all microcystins

as well as nodularins. Therefore, can use these described primers to amplify

a 320 bp PCR product from the AMT domains of all tested hepatotoxic

species and bloom samples. In adittion, these primers can be used for

distinguished between toxic and non toxic populations of cyanobacteria that

coexist simultaneously in a single ecosystem and are indistinguishable by

microscopy.

The lack of visual confirmation emphasizes the need for molecular

analysis to detect potentially toxic cyanobacteria in low concentration prior

to formation of blooms with elevated toxin levels. Sometimes microscopic

examination revealed few cyanobacteria at several sites. This might be a

reflection of low cell abundance and phycological sampling technique in

area corresponding to high sediment loading and water mixing (Hotto et al.,

0222).

Tigris River usually affected by agricultural and industrial eutrification

as well as the sewage effluent, high turbidity, river discharge or by

agricultural runoff which provide suitable environment of cyanobacteria

growth and potential microcystins production.

The results by Rantala et al. (0222) and Bittencourt-Oliveira et al.

(0211), suggested that eutrophication increased the co occurrence of

potentially microcystins producing cyanobacterial genera, raising the risk of

toxic-bloom formation.

The presence of potentially hepatotoxic species in water bodies used for

drinking purpose is a cosmopolitan problem documented to have caused

several incidences of human and cattle poisoning. Nationwide actions are

required and need to be unified behind modern tools to sustainably manage

the water bodies with the aim of protecting both human health and

biodiversity.

Tigris River is one of two main sources of drinking water for Iraq,

serving population approximately seven million people settled in Baghdad

city. The River suffers from eutrofication and contamination from industrial

and domestic discharge, resulting in endemic water-borne diseases.

There is a critical important of water monitoring authorities to rapidly

detect potentially toxic of cyanobacterial blooms. The most commonly

occurring cyanobacterial toxins are the hepatotoxins.

Indeed, the results revealed that all species related to dominant genera

which are isolated from studied stations were toxic species produce

microcystins. This might be related to the capability of these species to

highly competition to remain dominant utilizing all environmental

conditions such as high temperature, optical density and abundance of

nutrients (eutrification), all these factors allowed to form the blooming and

can affect microcystin production rates and this lead to increase the

probability of producing the microcystins. However, the factors those

influnce microcystin productions are largely unknown, as is the function of

this peptide in the organism itself.

Kearns and Hunter (0221) attributed the presence of these toxins as

allelopathic effect over algal competitors.

Not all strains belonging to toxic cyanobacteria are producer for

microcystins, although contained all genes for microcystin synthetase, this

might be due to gene inactivation and that another small peptide could

functionally substitute this toxin. The occurrence of these inactive

microcystin genotypes is rare and little understood, but this should not be a

significant limitation to the applicability of molecular detection (Dittmann

and Bӧrner, 5002). The conditions that cause cyanobacteria to produce

cyanotoxins are not well understood. Some species with the ability to

produce toxins may not produce it under all conditions. These species are

often members of the common bloom-forming genera. Both non-toxic and

toxic varieties of most of the common toxin-producing cyanobacteria exist,

and it is impossible to tell if a species is toxic or not toxic by looking at it.

Also, even when toxin-producing cyanobacteria are present, they may not

actually produce toxins. Furthermore, some species of cyanobacteria can

produce multiple types and variants of cyanotoxins. Molecular tests are

available to determine if the cyanobacteria, Microcystis for example, carry

the toxin gene; quantitative cyanotoxin analysis is needed to determine if the

cyanobacteria are actually producing the toxin. Water contaminated with

cyanobacteria can occur without associated taste and odor problems (FEPA,

0210).

Morphological identification is time consuming and it requires high

expertise. Accurate identification can be complicated by the deficiency and

plasticity of morphological characteristics. In fact, morphological features

used for the identification of species such as colonial form, mucilage

patterns and cell arrangement in the colony is frequently variable and

dependent on the environment (Otsuka et al., 0222). Furthermore, the

requirement for detailed identification is illustrated by the co-occurrence of

toxin producing and non-producing cells that are morphologically

indistinguishable (Janse et al., 0222; Dittmann and Wiegand, 0222).

Therefore, the use of PCR assay for targeting toxin-producing

cyanobacteria was to replace laborious and time-consuming microscopic

techniques for early detection of potentially toxic species that could be

useful to companies responsible for the surveillance of drinking water allows

these companies to implement appropriate measures for preventing the

growth of these organisms, such as artificial destratification or the

application of water – cleansing procedures.

No references have been reported dealing with such specific subject on

Tigris River. However, this technique is very significant to be considered in

our country particularly for water resources. In addition to that this

technique will help for the early warning of toxic cyanobacteria blooms in

freshwater lakes and rivers in Iraq.

Summary

The quality of drinking water may be significantly reduced by the

presence of cyanobacteria capable of producing toxins.

from September 0211 to August 0210, samples of water were taken

monthly from three drinking water treatment stations (Sharek Dijla, Al-

Wathba and Al-Rasheed) located on Tigris River in Baghdad area at three

sites included river intake, sedimentation tank (phytoplankton) and walls of

sedimentation tank (periphyton) .

A total of 022 algal taxa were identified from all collected samples from

the studied stations, 121 taxa belonged to Bacillariophyceae (diatoms), 22

taxa to chlorophyceae and 32 taxa to cyanophyceae. The total count of

attached cyanophaceae (periphyton) was the hgihest in Al-Wathba and Al-

Rasheed stations compard with Bacilariophyceae, while total count of

cyanophyceae in sedimentation tank was the lowest.

Seven species of blue-greens were isolated from the river intake of the

studied stations which are: Microcystis aeruginosa, Lyngbya sp., Microcystis

flos- aquae, Chroococcus turigidus, Westiellopsis prolifica, Oscillatoria

limnetica and Nostoc carneum which belonged to four cyanobacterial orders:

Oscillatoriales, Chroococales, Stigonematales and Nostocales. These genera

were dominated in three stations in most of the study period. Westiellopsis

prolifica was identified as new record species in Iraq belonged to the order

of Stigonematales.

Two sets of primer were used in molecular analysis for detection of

cyanobacteria and microcystin producing isolates. The first set of primers

(PCβF/PCαR) confirmed the presence of cyanobacterial DNA from isolates

collected from fresh water of studied stations and amplified a 222 bp gene

fragment from the phycocyanin that shared by all cyanobacteria.

The second set of primer (HEPR/HEPF) belonged to myc E gene was

successfully amplified and showed 320 bp fragments in gel electrophoresis

from all tested hepatotoxic species.

This study was aimed to detect the toxigenic cyanobacteria in three

drinking water treatment stations by using traditional and molecular

analysis.

Conclusion

Reviewing the result of this study it can be concluded that:-

1- All stations showed significant effect of water temperature and turbidity on

cyanobacterial total cell count during study period while other

physiochemical parameters varied in their effect according to the studied

station.

0- There were seven dominant toxigenic cyanobacterial species were isolated

from the studied station.

4- There were varied results as to the dominancy of algae according to samples

collection sites.

3- The total count of attached cyanophaceae (periphyton) was the hgihest in Al-

Wathba and Al-Rasheed stations compared with attached Bacillariophyceae

(periphyton) , while total count of cyanophyta in sedimentation tank was the

lowest.

2- PCR technique targeting phycocyanin and mycrocystin genes found to be a

rapid and sensitive test for detecting cyanobacteria and potentially toxic

populations of cyanobacteria isolated from three drinking water treatment

stations located on Tigris River.

2- Westiellopsis prolifica was identified as new record species in Iraq belonged

to the order of Stigonematales.

Recommendations

1. The governmental procedures for treating the Tigris River water for

drinking purposes need to take into consideration the presence of

these potentially toxic cyanobacteria.

0. Prevention of the industrial and agricultural effluents and the sewage

to be discharged in the river and treatment of them by using active

procedures to reducing the pollution which lead to the harmful algal

bloom.

4. Using conventional PCR technique for targeting microcystin

biosynthesis genes for detecting toxic cyanobacteria in fresh water,

water supplies and blooming.

3. Using real-time PCR for detecting and quantitating the toxigenic

cyanobacteria in water samples. Because of the specificity of the PCR

for amplifying cyanobacterial DNA, water and sediment samples were

able to be analyzed directly for the presence of these microorganisms

among many other bacteria, protozoa, and algae.

2. Using microarray technology for diagnosing of cyanobacteria that can

detect and differentiate toxic genotypes in complex samples.

2. Boosting the detection of toxigenic cyanobacteria by using

biochemical analyses.

2. Studying other cyanotoxins in Iraqi freshwater.

2. Study the suitable methods to treat or prevent the formation of

cyanobacterial blooms.

الخالصخ ى ا رخفط ػخ ب اششة ثصسح حظخ ثجد اطحبت اخعشاء اضسلخ

از ب امبثخ ػى ازبط اس.

اى شش اة ػب 0211جؼذ اؼبد ف افزشح ازذح شش اي ػب

ششب صالس حطبد زمخ ب اششة )حطخ ششق دجخ حطخ اششذ حطخ 0210

اصجخ ( االؼخ ػى ش دجخ ف ذخ ثغذاد لذ جؼذ صالس الغ ف احطخ رزع

زشست )وبئبد جبرخ( جذسا احاض ازشست )غحبت زصمخ(. )أخز اش حض ا

( سرجخ رصفخ طحبت جغ الغ جغ اؼبد حطبد اذسسخ 022 (صذخ ش

سرجخ رصفخ رؼد طحبت اخعشاء )22(سرجخ رصفخ رؼد ذازبد ) 121(وب بن

اطحبت اخعش اضسلخ. ا اؼذد اى طحبت اخظشاء سرجخ رصفخ رشجغ اى )32(

اضسلخ ازصمخ وب االػى ف حطز اصجخ اششذ مبسخ ثبذازبد ازصمخ ثب اؼذد

االغأ. اى طحبت ثصسح ػبخ ف حض ازشست وب

ضذ سجغ ااع أخز اشحطبد ش خصذ اطحبت اخعشاء اضسلخ ػ

.Microcystis aeruginosa Lyngbya sp اذسسخ ازوس اػال ز االاع 5

Microcystis flos-aquae Chroococcus turigidus Westiellopsis prolifica

Oscillatoria limnetica Nostoc carneumز رؼد السثغ سرت 5. ا

Oscillatoriales Chroococales Stigonematales Nostocales ز .

اطحت صخ ش االاع وبذ سبئذح غاي فزشاح اذساسخ ف جغ الغ جغ اؼبد.

Westiellopsis prolifica اؼبئذ اى سرجخ اؼشاق ص سبثمب فشخ وع جذذ

Stigonematales .

اسزخذ ف ز اذساسخ صج اجادئ ف اطشائك اجضئخ ىشف ػ ػضالد

( microcystin) اىشف ػ س ابىشسسز (cyanobacteria)اطحبت اخعش اضسلخ

ف اؼضالد ازجخ زا اس.

زأوذ جد ابدح اساصخ اذب خذاسز (PCβF/PCαR)اضط االي اجادئ

اب اؼزثخ حطبد اذسسخ ره ثزعخ لطؼخ اؼضخ طحبت اخعشاء اضسلخ

. طحبت اخعشاء اضسلخ اج اؼبئذ فبىسب ازي رشزشن ف و ا (bp 222)حجب

ف رعخ ثجبح ر myc Eاؼبئذ اى ج HEPF/HEPR)اضط اضب اجادئ )

ف اال اشح (bp 320)و اؼضالد ازجخ س اىجذخ ار اظش لطؼخ عخخ حجب

وشثبئب.

س ف صالس حطبد زمخ ب ذفذ اذساسخ اى وشف اؼضالد اسبخ ازجخ

ازمذخ اجضئخ. اششة ثأسزخذا اطشق

References

Abed, R.M.M.; Dobrestov, S.; Al-Kharusil, S.; Schramm, A.; Jupp, B and

Solubic, G. (5077). Cyanobacterial Diversity and Bioactivity of Inland

Hypersaline Microbial Mats from a Desert Stream in the Sultanate of Oman.

Fottea; 11(1): 012-003.

Adamovský, O. (0212). Bioaccumulation and Effects of Cyanotoxins in the

Aquatic Environment. Ph.D thesis to Faculty of Science/Masaryk

University,Czech.

Al-Dulaimi, L.M.(0222). Treatment of Algae in Water Purification Tanks

Using Barley Straws Infusion and Titanium Dioxide. M.Sc. thesis to College

of Science / University of Al-Mustansiriyah. (In Arabic).

Al-Janabi, Z.Z. (0211). Application of Water Quality Indices for Tigris

River within Baghdad City- Iraq. M.Sc. thesis to College of Science for

Women / University of Baghdad. (In Arabic)

Al-Janabi, Z.Z.; Al-Kubaisi, A.A. and Al-Obaidy, A.M.J. (0210).

Assessment of Water Quality of Tigris River by Using Water Quality Index

(CCME WQI). J. Al-Nahrain University; 12(1): 112-102.

Al-Kubaisi, A.A .( 1222). An ecological Study on Plankton and Gut

Content Food of Some Fishes in Mid Iraq. M.Sc. thesis to College of

Education (Ibn-Al-Haitham)/University of Baghdad. (In Arabic).

Al-Lami, A.A. (8991).The Environmental Effects of Al-tharthar Arm on Tigris

River before Interring Baghdad City. Ph.D thesis to Collage of Science /

University of AL-Mustansiriah.

Allen, M. (1222). Simple Conditions for the Growth of Unicellular Blue-

Green Algae on Plates. J. Phycol.; 3: 1-3.

Al- Maliki, M.A.S. (0222).Assessment of Pollutants of Air, Water and Soil

in Baghdad by Using Geographical Informational System. Ph.D thesis to

College of Science / University of Baghdad. (In Arabic).

Al-Nimma, B.A. (1220). A study on the Limnology of the Tigris and

Euphrates Rivers. M. Sc. thesis to University of Salahulddin.

Al-Sarraf, M.A. (0222). Ecological and Taxanomical Study for

Phytoplankton in Al-Adaim and Diyala Tributaries and their Effects on

Tigris River. Ph.D thesis to College of Science for Women / University of

Baghdad. (In Arabic)

Al-Taai, M.A. (0222). Study of the Quality for Some Wells and Superficial

water in Baghdad City. M.Sc. thesis to College of Education (Ibn-Al-

Haitham)/University of Baghdad. (In Arabic).

Al-Temimi, A.A. (0222). Using Alagae as Bioindicators for Organic

Pollution in the Lower Part of Diyala River. Ph.D thesis to College of

Science / University of Baghdad. (In Arabic).

Al-Tebrineh, J.; Gehringer, M.M.; AKcaelon,R. and Neilan, B.A.(0211). A

new Quantative PCR assay for the Detection of Hepatotoxigenic

Cyanobacteria. Toxicon; 225232-223.

APHA, American Public Health Association. (1222). Standard Methods for

the Examination for Water and Waste Water .12th

Edition, American Public

Health Association 1212 fifteen Street, N.W., Washington DC.0222 pp.

Arima, H.; Horiguchi, N.; Takaichi, S.; Kofuji, R.; Ishida, K.; Wada, K. and

Sakamoto, T. (0210). Molecular Genetic and Chemotaxonomic

Characterization of the Terrestrial Cyanobacterium Nostoc commune and Its

Neighboring Species. FEMS Microbiol. Ecol.; 22(1): 43-32.

Azevedo, S.M.F.; Carmichael, W.W.; Jochimsen, E.M.; Rinehart, K.L.; Lau,

S.; Shaw, G.R. and Eaglesham, G.k. (0220). Human Intoxication by

Microcystins during Renal Dialysis Treatment in Caruaru-

Brazil.Toxicology; 1215331-332.

Baron-Sola, A.; Ouahid,Y. and delCampo,F.F. (0210). Detection of

Potentially Producing Cylindrospermopsin and Microcystin Strains in Mixed

Populations of Cyanobacteria by Simultaneous Amplification of

Cylindrospermopsin and Microcystin Gene Regions. Ecotoxicology and

Environmental Safety; 22:120-122.

Bellinger, E.G and Sigee, D.C. (0212). Freshwater Algae Identification and

Use as Bioindicator. John Wiley and Sons.London. pp. 0-32.

Beltrán, E.; Ibáñez, M.; Sancho, J.V. and Hernández, F. (0210).

Determination of Six Microcystins and Nodularin in Surface and Drinking

Waters by on-line Solid Phase Extraction-Ultra High Pressure Liquid

Chromatography Tandem Mass Spectrometry. J Chromatogr A.; 1022521-2.

Bittencourt-Oliveira, M.C.; Oliveira, M.C. and Pinto, E. (0211). Diversity

of Microcystin-producing Genotype in Brazilian Strains of Microcysis

(Cyanobacteria). Braz.J.Bio.;21(1):022-012.

Bolch, C. J.; Blackburn S. I.; Neilan, B. A. and Grewe, P. M. (1222).

Genetic Characterization of Strains of Cyanobacteria Using PCR-RFLP of

the cpcBA Intergenic Spacer and Flanking Regions. J. Phycol.; 40 (4): 332-

321.

Boyd, C.E. (0222). Water Quality an Introduction. Kluwer Acadamic

Publishers, Boston, USA, pp 442.

Brookes, J. D.; Daly, R.; Regel, R. H.; Burch, M.; Ho, L. and Newcombe,

G. (0222). Reservoir Management Strategies for Control and Degradation

of Algal Toxins. Denver, Colorado, USA: American Water Works

Association Research Foundation. pp. 034.

Callow, M. E and Callow, J.A (0220). Marine Biofouling: a Sticky

Problem. Biologist; 32: 1-2.

Canter, L.W. (1222). Environmental Impact Assessment. 0nd

Edition,

Mcgraw- Hill Inc., New York, USA, pp 222.

Chellappa, N.; Câmara, F. and Rocha, O.B. (0222). Phytoplankton

Community: Indicator of Water Quality in the Armando Ribeiro Gonçalves

Reservoir and Pataxó Channel. Rio Grande Do Norte, Brazil. Braz. J. Biol.;

22(0): 031-021.

Chorus, I. and Bartram, J. (1222). Toxic Cyanobacteria in Water: A guid to

their Public Health Consequences, Monitoring and Management. 1st Edition

. E and FN Spon on behalf of WHO. London.

Chorus, I. (0221). Cyanotoxins: Occurrence, Causes Consequences.

Springer, Tokyo.

Christiansen, G.; Fastner, J.; Erhard, M.; Bӧrner, T. and Dittmann, E.

(0224). Microcystin Biosynthesis in Planktothrix: Genes, Evolution, and

Manipultion. J. Bact.; 122(0): 223-220.

Codd, G.A; Morrison, L.F.; and Metcalf, J.S. (0222). Cyanobacterial Toxin:

Risk Management for Health Protection. Toxicology and Applied

Pharmacology; 0245023-020.

Dash, A.K. and Mishra, P.C. (1222). Growth Response of Blue-Green Alga

Westiellopsis prolifica in Sewage Enriched Paper Mill Waste

Water.Rev.Int.Contam. Ambient; 12(0):22-24.

Desikachary, T. V. (1222). Cyanophyta. Indian Council of Agricultural

Research, New Delhi, pp 222.

Detay, M. (1222). Water Wells–Implementation, Maintenance and

Restoration. John Wiley and Sons, London, pp 422.

Dittmann, E. and Bӧrner, T. (0222).Genetic Contributions to the Risk

Assessment of Microcystin in the Environment. Toxicology and Applied

Pharmacology; 024(4): 120-022.

Dittmann, E. and Wiegand, C. (0222). Cyanobacterial Toxins Occurrence

Biosynthesis and Impact on Human Affairs. Mol. Nutr. Food Res; 22: 2-12.

Doyle, J.J and Doly, J.L. (1222). A rapid Total DNA Preparation Procedure

for Fresh Plant Tissue. Focus; 10:14-12.

Drobac, D. Tokodi, N.; Simeunovic, J.; Baltic, V.; Stanic, D. and Svircev,

Z. (0214). Human Exposure to Cyantoxins and their Effects on Health. Arh.

Hig. Rada. Toksikol.; 235422-412.

Dwaish, A.S. (0210). Ecological Study of Phytoplankton in Tigris River

through Baghdad City in Field and Laboratory. Ph.D thesis to College of

Science / University of Baghdad.

Falconer, I.R. (0222) Cyanobacterial Toxins of Drinking Water Supplies:

Cylindrospermopsins and Microcystins. CRC Press, New York, pp 022.

Falconer, I.R. and Humpage, A.R. (0222). Health Risk Assessment of

Cyanobacterial (Blue-green Algal) Toxins in Drinking Water. International

Journal of Environmental Research and Public Health; 0: 34-22

Farkha,T.J.K. (0222). A Study of the Distribution of Phytoplankton and

Aquatic Fungi in the Lotic Water in Baghdad District and the Effect of

Environmental Factors. Ph.D thesis to College of Science/Al-Mustansiryia

University. (In Arabic).

Fastner, J.; Erhard, M. and Von Dӧhern,H. (0221). Determination of

Oligopeptide Diversity within A natural Population of Microcystis

spp.(Cyanobacteria) by Typing Single Colonies by Matrix-assisted Laser

Desorption Ionization- Time of Light Mass Spectrometry. Appl. Environ.

Microbiol.; 22: 2222-2222.

FEPA, Federal Environment protection Agency. (0210). Cyanobacteria and

Cyanotoxins: Information for Drinking Water Systems. Office of Water,

USA.

Figueiredo, D.R.; Azeiteiro, U.M.; Esteves, S.M.; Goncalves, F.J.M. and

Pereira, M.J. ( 0223). Microcystin-Producing Blooms. A serious Global

Public Health Issue. Ecotoxicology and Environmental Safety; 22: 121-124.

Fiore, M. F.; Genuario, D.B.; da Silva, C.S., Shishido, S.K.; Moraes, L.A.;

Neto, R.C. and Silva-Stenico, R. (0222). Microcystin Production by a

Freshwater Spring Cyanobacterium of the Genus Fischerella. Toxicon; 24:

223-221.

Furet, J.E. and Benson- Evans, K. (1220). An Evaluation of the Time

Required to Obtain Complete Sedimentation of Fixed Algal Particles Prior

to Enumeration. Br. Phycol. J.; 12: 024-022.

Ghosh ,S.K.; Das, P.K. and Bagchi, S.N.(0222). PCR- Based Detection of

Microcystin-Producing Cyanobacterial Blooms from Central India. Indian

Journal of Experimental Biology; 32: 22-22.

Goldberg, J.; Huang, H.; Kwon, Y.; Greengard P.; Nairn, A.C. and Kuriyan,

J. (1222). Three-Dimensional Structure of the Catalytic Subunit of Protein

Serine/Threonine Phosphatase-1. Nature;( 422):232-224.

Goldman, C.R. and Horne, A.J. (1224). Limnology. McGraw-Hill Int. B.

Co. London. pp 323.

Govin, A.; Tran, T.H.; Guyonnet, R.; Grosseau, P.; Lors, C.; Damidot, D.;

Deves, O. and Ruot (0214) . Ability in Biofouling by Klebsormidium

Flaccidum of Mortars: Influence of the Intrinsic Characteristics. First

International Conference on Concrete Sustainability (ICCS), Tokyo: Japan.

Gugger, M.; Lyra, C.; Henriksen, P.; Coute, A.; Humbert, J.F. and Sivonen,

K. (0220). Phylogenetic Comparison of the Cyanobacterial Genera

Anabaena and Aphanizomenon. Int. J. Syst. Evol. Microbiol.; 20(2): 1222-

1222.

Harada, K. I.; Nakano, T.; Fujii, K. and Shirai, M. (0223). Comprehensive

Analysis System Using liquid Chromatography-Mass Spectrometry for the

Biosynthetic Study of Peptides Produced by Cyanobacteria. J.

Chromatography; 1244: 122-114.

Hardy, J. (0222). Washinton State Recreational Guidance for Microcystins

(Provisional) and Anatoxin-a (Interim/Provisional). Washinton State

Department of Health.

Heath, M. (0222). Mat Forming Toxic Benthic Cyanobacteria in New

Zealand. MS.c to Science of Biological Science/Victoria University at

Welington, NewZealand.

Hem, J.D. (1222) Study and Interpretation of the Chemical Characteristic

of Natural Water. 4rd

Edition Publisher by Dept. of the Interior, U.S.

Geological Survey, pp 024.

Henning, M.; Rohrlack, T. and Kohl, J.G. (0221). Response of Daphinia

galeata Fed with Microcystins. In: Cyanotoxins-Occurrence, Causes,

Consequece. Springer, Berlin, pp022-022.

Hernandez, J.M.; Lopez-Rodas, V. and Costas, E. (0222). Microcystins

from Tap water could be a Risk Factor for Liver and Colorectal Cancer: A

risk Intensified by Global Change. Med. Hypotheses 2, 242-232.

Hisbergues, M.; Christiansen, G.; Rouhianen, L.; Sivonen, K. and Bӧrner,T.

(0224). PCR-bsed Identification of Microcystin-producing Genotypes of

Different Cyanobacteria Genera. Arch. Microbiol.; 122: 320-312.

Hitzfeld, B.; Lampert, C.; Spa¨th, N.; Mountfort, D.; Kaspar, H. and

Dietrich, D. (0222). Toxin Production in Cyanobacterial Mats from Ponds

on the McMurdo Ice Shelf, Antarctica. Toxicon; 42: 1241-1232.

Hotto, A.M.; Satchwell, M.F. and Boyer,G.L. (0222). Molecular

Charaterization in Lake Ontario Embayments and Nearshore Waters. Appl.

Environ. Microbiol.; 24(13):3222-3222.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Janse%2C+W.+E.+A.+Kardinaal%2C+M.+Meima%2C+J.+Fastner%2C+P.+M.+Visser+and


Huq, M. F.; Hadi, R. A. and Al-saadi, H. A. (1222). Preliminary Studies on

Phytoplankton of North-West Arab Gulf .II .Phytoplankton Population

Dynamics .Bangladesh, J. Bot.; 2 ( 0)5122-101.

Huq, M. F.; Al-Saadi, H. A. and Hadi, R. A. (1222). Preliminary Studies on

The primary Production of North-West Arab Gulf during Post Monsoon

Period. J. Oceangr. Soc. Japan.; 43 (0): 22-22.

Hustedt, F. (1242). Die Susswasser Flora Mitteleuropas. Heft 12. 0nd

Edition. Bacillariophyta (Diatomeae). A. Pascher. Verlag von Gustav

Fischer, Germany, pp 322.

Hustedt, F. (1222). The Pennate Diatoms. A Translation of Hustedt´SDie

Kieslalgen. with Supplement by Norman G. Jensen. Printed in Germany By

Strauss and Cramer Gmbh, pp 212.

Hutchinson, G.E. (1222). A Treatise on Limnology. Vol. II. Introduction to

Lake Biology and the Limno Plankton. John Wiley and Sons, Inc., New

York, pp 1112.

Janse, I.; Kardinaal, W.E.; Meima, M.; Fastner, J.; Visser, P.M. and Zwart,

G. (0222).Toxic and Nontoxic Microcystis Colonies in Natural Populations

Can Be Differentiated on the Basis of rRNA Gene Internal Transcribed

Spacer Diversity. Appl. Environ. Microbiol.; 22(2):4222-22.

Jawad, A. L. (1220) Interactions Between Cyanobacteria and Other

Microorganisms Ph.D Thesis to Liverpool University, pp104-102.

http://www.ncbi.nlm.nih.gov/pubmed?term=Janse%20I%5BAuthor%5D&cauthor=true&cauthor_uid=15240273

http://www.ncbi.nlm.nih.gov/pubmed?term=Kardinaal%20WE%5BAuthor%5D&cauthor=true&cauthor_uid=15240273

http://www.ncbi.nlm.nih.gov/pubmed?term=Meima%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15240273

http://www.ncbi.nlm.nih.gov/pubmed?term=Fastner%20J%5BAuthor%5D&cauthor=true&cauthor_uid=15240273

http://www.ncbi.nlm.nih.gov/pubmed?term=Visser%20PM%5BAuthor%5D&cauthor=true&cauthor_uid=15240273

http://www.ncbi.nlm.nih.gov/pubmed?term=Zwart%20G%5BAuthor%5D&cauthor=true&cauthor_uid=15240273

http://www.ncbi.nlm.nih.gov/pubmed?term=Zwart%20G%5BAuthor%5D&cauthor=true&cauthor_uid=15240273


John, D.M.; Whitton, B.A. and Brook, B.A. (0220). The Fresh Water Algal

Flora of the British Isles. Camberdge, UK, Camberdge University Press, pp

220.

Johnk, K.D; Huisman, J.; Sharples, J.; Sommeijer, B.; Visere, P. M. and

Stroom, J.M. (0222). Summer Heatwaves Promote of Harmeful

Cyanobacteria. Global Change Biology; 13: 322-210.

Jungblut, A.D. and Neilan, B.A. (0222). Molecular Identification and

Evolution of the Cyclic Peptide Hepatotoxins, Microcystin and Nodularin,

Synthetase Genes in Three Orders of Cyanobacteria. Arch. Microbiol.; 122:

122-113.

Kaebernick, M.; Rohrlack,T. ; Christofferssen, K and Neilan, B.A. (0221).

A spontaneous Mutant of Microcystin Biosynthesis: Genetic

Characterization and Effect on Daphina. Environ. Microbiol.; 45222-222.

Kassim, T.I.; AL-Saadi H. and Salman, N.A. (1222). Production of Some

Phytoplankton and Zooplankton and their Use as Live Food for Fish Larva.

Iraqi J. Agric. Proc. of 0nd

Sci. Confer.; 3(2): 122-021.

Katirciogola, H.; Akin, B.S. and Atici, T. (0223). Microalgal Toxin(s):

Characteristics and Importance. African J. Biotech.; 4 (10):222-223.

Kearns, K.D. and Hunter, M.D. (0221). Toxin-producing Anabaena flos-

aquae Induces Settling of Chlamydomaonas Reinhardttii a Competing

Motile Algae. Microb. Ecol.; 30(1): 22-22.

Kurmayer, R. and Christiansen, G. (0222). The Genetic Baisis of Toxin

Production in Cyanobacteria. Freshwater Review; 0: 41-22.

Langmuir, D. (1222). Aqueous Environmental Geochemistry. Prentice

Hall, USA, pp 222.

Lee, J.A.; Cho, K. J.; Known O. S. and Chung, I. K. (1224). A Study on

the Environmental Factors in Naktong Estuarine Ecosystem. J. Phycol.;

2(1): 02-42.

Lee, J.J. (1553). Removal of Microcystin-LR from Drinking Water Using

Adsorption and Membrane Processes. Ph.D to Graduate School/ The Ohio

State University,USA.

Li, P.C.H.; H, S. and Lam, P.K.S. (1333). Development of A capillary Zone

Electrophoretic Method for the Rapid Separation and Detection of

Hepatotoxic Microcystins. Marine Pollution Bulletin; 332115-111.

Lind, O.T. (1222). Hand book of Common Methods in Limnology. C. V

Mosby, St. Louis, pp 122.

Lyra, C.; Hantula, J.; Vainio, E.; Rapala, J.; Rouhiainen, L. and Sivonen, K.

(1222). Characterization of Cyanobacteria by SDS-PAGE of Whole-Cell

Proteins and PCR/RFLP of the 12S rRNA Gene. Arch. Microbiol.; 122:

122-123.

Maitland, F.S. (1222). Biology of Fresh Waters. Black and Son Limited,

Glasgow, pp 033.

Maniatis, T.; Fritsch, E. and Sambrook, J. (1220). Molecular Cloning: a

Laboratory Manual. Cold Spring Harbor Laboratory. N.Y.

Martins, A. and Vasconcelos, V. (0211).Use of Qpcr for the Study of

Hepatotoxic Cyanobacteria Population Dynamics. Arch. Microbiol.;

1245212-202.

Matehkolaei, A.R; Makimura, K.; Shidfar, M.R.; Zaini, F.; Eshraghian,

M.R.; Jalaizand, N.; Sisakht, S.N.; Hosseinpour, L. and Merhendi, H.(0210).

Use of Single-enzyme PCR-restriction Digestion Barcode Targeting the

Internal Transcribed spacers (ITS rDNA) to Identify Dermatophyte Species.

Iran. J. Publ. Hea.; 31(4): 20-23.

Mathys, W. and Surholt, B. (0223). Analysis of Microcystins in Freshwater

Samples Using High Performance Liquid Chromatography and An Enzyme-

linked Immunosorbent Assay. International Journal of Hygiene and

Environmental Health; 022: 221-222.

Maulood, B.K. and Toma, J. J. (0223). Check list of Algae in Iraq. J.

Babylon; 2( 4): 12.

McElhiney, J.; Drever, M.; Lawton, L.A. and Porter, A.J. (0220). Rapid

Isolation of A single-chain Antibody against the Cyanobacterial Toxin

Microcystin-LR by Phage Display and its Use in the Immunoaffinity

Concentration of Microcystins from Water. Appl. Environ. Microbiol.;

2252022-2022.

McElhiney, J. and Lawton, L.A. (0222). Detection of the Cyanobacterial

Hepatotoxins Microcystins. J. Toxicolgy and Applied Pharmacology; 024:

012-042.

McKenzie, J.M.; Siegel D.I.; Patterson, W. and McKenzie, D.J. (0221). A

Geochemical Survey of Spring Water from the Main Ethiopian Rift Valley,

Southern Ethiopia: Implications for Well-Head Protection. Hydrogeology J.;

25022-020.

Meriluoto, J. A. O.; Kincaid, B.; Smyth, M.R. and Wasberg, M. (1222).

Electrochemical Detection of Microcystins, Cyanobacterial peptide

Hepatotoxins, Following High-performance Liquid Chromatography. J.

Chromatogr.; 2125002-042.

Meriluoto, J. A. O. and Codd, G. A. (0222). Toxic: Cyanobacteria

Monitoring and Cyanotoxin Analysis. Abo Academi University press

(Turku), ISBN 221-222-022-4. pp 132.

Mikhailov,A. ; Härmälä, A. ; Polosukhhina, E.; Hanski, A. ; Wahlsten, M.;

Sivonen, K. and Eriksson, J. (0221). Production and Specificity of

Monoclonal Antibodies against Nodularin Conjugated Through N-

methyldehyrobutyrine. Toxicon; 42: 1324-1322.

Moffitt, M.C. and Neilan, B.A. (0221). On the Presence of Peptide Synthase

Genes in the Cyanobacterial Genes Nodularia. FEMS Microbiology Letters;

122: 022-013.

Moffitt, M.C. and Neilan, B.A. (0223). Characterization of the Nodularin

Synthtase Gene Cluster and Cyanobacterial Hepatotoxins. Appl. Environ.

Microbiol.; 22(11): 2424-2420.

Mohamed, Z.A. (0222). Toxic Cyanobacteria and Cyanotoxins in Public

Hot Springs in Saudi Arabia.Toxicon; 21: 12-02.

Msagati, T.A; Siame, B.A; and Shushu, D.D. (0222). Evaluation of

Methods for the Isolation, Detection and Quantification of Cyanobacterial

Hepatotoxins. Aquatic Toxicology; 22: 420-422.

Mullin, J. B., and P. Riley. (1222). The Calorimetric Determination of

Silicate with Special Reference to Sea and Natural Waters. Anal. Chim.

Acta.; (10): 120-122.

Neilan, B.A.; Jacobs, D. and Goodmann, A. (1222). Genetic Diversity and

Phylogeny of Toxic Cyanobacteria Determined by DNA Polymorphisms

within the Pycocyanin Locus. Appl. Environ. Microbiol.; 21(11): 4222-

4224.

Neilan, B.A.; Jacobs, D.; Del Dot, T.,; Blackall, L. L.; Hawkins, P. R.; Cox,

P. T. and Goodman, A.E. (1222). rRNA Sequences and Evolutionary

Relationships Among Toxic and Nontoxic Cyanobacteria of the Genus

Microcystis. Int. J. Syst. Bacteriol.; 32: 224-222.

Neilan, B.A.; Dittman, E.; Rouhianien, L.; Bass, R.A.; Schaub, V.; Sivonen,

K. and Borner, T. (1222). Nonribosomal Peptide Synthesis and Toxigenicity

in Cyanobacteria. J. Bacteriol.; 121: 3222-3222.



Neilan, B.A.; Pearson, L.A.; Muenchhoff, J.; Moffitt, M.C. and Dittmann,

E. (0214). Environmental Conditions that Influence Toxin Biosynthesis in

Cyanobacteria. Environmental Microbiology; 12(2), 1042-1024.

Nicholson, B.C. and Burch, M.D. (0221). Evaluation of Analytical Methods

for Detection and Quantification of Cyanotoxins in Relation to Australian

Drinking Water Guidelines. National Health and Medical Research Council

of Australia, the Water Services Association of Australia, and the

Cooperative Research Centre for Water Quality and Treatment, Australia, pp

22.

Oberholster, P.J.; Botha, A.M. and Cloete, T.E. (0222). An Overview of

Toxic Freshwater Cyanobacteria in South Africa with Special Reference to

Risk, Impact and Detection by Molecular Marker Tools. Biokemistri;

12(10): 22-21.

Oinam, G.; Tiwari, O.N. and Sharma, G.D. (0211). PCR Based Molecular

Characterization of Cyanobacteria with Special Emphasis on Non-

Heterocystous Filamentous Cyanobacteria. Assam University Journal of

Science and Technology; 2(1): 121-114.

Otsuka, S.; Suda, R. H. Li; Matsumoto, S. and Watanabe, M. M. (0222).

Morphological Variability of Colonies of Microcystis Morphospecies in

Culture; J. Gen. Appl. Microbiol.; 32, 42-22.

Paerl, H.W. and Huisman, J. (0222). Climate Change: A Catalyst for Global

Expansion of Harmful Cyanobacterial Blooms. Environmental Microbiology

Reports; 1: 02-42.

Parsons, T.R.; Maita, Y. and Lalli C.M. (1223). A manual for Chemical and

Biological Methods for Seawater Analysis. Pergamon Press, New York, NY.

Pearson, L.A. and Neilan, B.A. (0222). The Molecular Genetics of

Cyanobacteria Toxicity as A basis for Monitoring Water Quality and Public

Health Risk. Current Opinion in Biotechnology; 125021-022.

Pearson, L.A., Moffitt, M.C. and Ginn, H.P. (0222). The Molecular

Genetics and Regulation of Cyanobacterial Peptide Hepatotoxin

Biosynthesis. Crit. Rev. Toxicol.; 42(12): 232-222.

Peterson, C.G. and Stevenson R.J. (1222). Seasonality in River

Phytoplankton: Multivariate Analyses of Data from the Ohio River and Six

Kentucky Tributaries. Hydrobiologia; 120(0): 22-113.

Pfandl, K.; Chatzinotas, A. and Dyal, P. (0222). SSU rRNA Gene Variation

Resolves Population Heterogeneity and Ecophysiological Differentiation

within A Morphospecies (Stramenopiles, Chrysophyceae). Liminology and

Oceanography; 23: 121-121.

Prescott, G.W. (1223). The alga: A review. Houghton Mifflin comp.

Boston, pp 342.

Prescott, G.W. (1224). Algae of the Western Great Lakes Area. OHO

Koeltz. Science publishers. Germany.

Prescott, G. W. (1222). How to Know the Freshwater Algae. Wm. C.

Brown, Dubuque, IA.

Prescott, G.W .(1220). Algae of the Western Great Lakes Area.

Koenigstein, West Germany, pp 222.

Pyo, D.; Lee, J. and Choi, E. (0222). Trace Analaysis of Microcystin in

Water Using Enzyme-linked Imminosorbent Assay. Microhem. J.; 225122-

122.

Rajaniemi, P.; Hrouzek, P,; Kastovska, K.; Willame, R.; Rantala, A.;

Hoffmann, L.; Komárek, J. and Sivonen, K. (0222). Phylogenetic and

Morphological Evaluation of the Genera Anabaena, Aphanizomenon,

Trichormus and Nostoc (Nostocales, Cyanobacteria). Int. J. Syst. Evol.

Microbiol.; 22(1): 11-02.

Ramsing, N.B.; Ferris, M.J. and Ward. D.M. (0222). Highly Ordered

Vertical Structure of Synechococcus Populations Within the One-millimeter-

thick Photic Zone of a Hot Spring Cyanobacterial Mat. Appl. Environ.

Microbiol., 22(4): 1242-1232.

Rantala, A.; Fewer, D.P.; Hisbergues, M.; Rouhiainnen, L. ; Vaitomaa, J. ;

Bӧrner, T. and Sivonen, K.(0223). Phylogenetic Evidence for the Early

Evolution of Microcystin Synthesis. Proceedings of the National Academy

of Sciences of the United States of America; 121(0): 222-224.

Rantala, A.; Wacklin, P.R.; Lyra, C.; Lepisto, L.; Rintala, J.; Boczek, J.M.

and Sivonen, K. (0222). Detection of Microcystin-producing Cyanobacteria

in Finnish Lakes with Genes-specific Microcystin Synthetase Gene E

(mcyE) PCR and Associations with Environmental Factors. Appl. Environ.

Microbiol.; 20(2): 2121-2112.

Rascher, U.; Lakatos, M.; Budel, B. and Luttge, U.(0224).Photosynthetic

Field Capacity of Cyanobacteria of A tropical Inselberg of the Guiana

Highlands. Eur. J. Phycol; 42: 032-022.

Reid, G.K. (1221). Ecology of Inland Waters and Eusteries. Van Nostrand

Rein hold Publishing Co. New York 422 pp.

Renaud, S.L; Pick, F.R and Fortin, N. (0211). Effect of Light Intensity on

the Relative Dominance of Toxigenic and Nontoxigenic Strains of

Microcystis aeruginosa. Appl. Environ. Microbiol.; 22(12): 2212-2200.

Reynolds, C. S. (8911). The ecology of Freshwater Phytoplankton.

Cambridge University Press. London. New York, pp 338.

Rinehart, K.L.; Namikoshi, M. and Choi, B.W. (1223). Structure and

Biosynthesis of Toxins from Blue-Green Algae (Cyanobacteria). J. App.

Phycol. (2): 122-122.

Robarts, R.D. and Zohary, T. (1222). Temperature Effect on Photosynthesis

Capacity, Respiration and Growth- Rates of Bloom-Forming Cyanobacteria.

Z.J.Mar.Fresw.; 015421-422.

Robillot, C.; Vinh, J.; Puiseux-Dao, S. and Hennion, M.C. (0222).

Hepatotoxin Production Kinetics of the Cyanobacterium Microcystis

aeruginosa PCC 2202, as Determined by HPLC-Mass Spectrometry and

Protein Phosphatase Bioassay. Environ. Sci. Technol.; 43: 4420-4422.

Rodgers, J.H. (0222). Algal Toxins in Pond Aquaculture. SRAC publication

No.3222.

Rouhiainen, L.; Vakkilanen,T.; Siemer, B.L.; Buikema,W.; Haselkorn,R.

and Sivonen, K.(0223). Genes Coding for Hepatotoxic Heptapeptides

(Microctstins) in the Cyanobacterium Anabaena Strain 22. Appl. Environ.

Microbiol.; 22(0): 222-220.

Saad, M.A. and Antoine, S.E. (1222). Limnological Studies on the Tigris

River, Iraq II. Seaasonal Variation of Nutrient. Int. Revue. Ges.

Hydrobiologia; 24 (2): 222-212.

Saadala, H. A. (1222). Ecological Study on the Effect of Saklawia

Irrigation Drainage on Tigris River in Baghdad, M.Sc. thesis to College of

Education (Ibn-Al-Haitham)/University of Baghdad. ( In Arabic )

Sabri, A.W.; Moulood, B.K. and Sulaiman, N.I. (1222). Limnological

Studies on River Tigris: Some Physical and Chemical Characters. J. Biol.

Scie. Res.; 02(4): 222-222.

Saker, M.L.; Vale, M.; Kramer, D. and Vasconcelos, V.M. (0222).

Molecular Techniques for the Early Warning of Toxic Cyanobacteria

Blooms in Freshwater Lakes and Rivers. Appl. Microbiol. Biotechnol.;

225331-332.

Sigee, D.C. (0223). Freshwater Microbiology: Diversity and Dynamic

Interactions of Microorganisms in the Aquatic Environment. Chichester,

UK, John Weily and Sons, pp 203.

Stein, J.R. (1224). Handbook of Phycological Methods: Culture Methods

and Growth Measurements. Cambridge University Press. Cambridge.

Stewart, I.; Webb, P. M.; Schluter, P. J. and Shaw, G. R. (0222).

Recreational and Occupational Field Exposure to Freshwater Cyanobacteria-

A review of Anedotal and Case Reports, Epidemiologic Assement.

Environment Health: A global Access Science Source; 252.

Stewart, I.H. (0211). Development of Real-Time PCR to Identify

Cyanobacteria Populations in Lakes. Ph.D Thesis to the Faculty of the

Graduate School / The University of North Carolina at Greensboro.USA.

Sunda, W.G. (0222). Positive Feedback and the Development and

Persistence of Ecosystem Distruptive Algae Blooms. J. Phycol.; 30: 223-

223.

Tang, E.P.Y.; Tremblay, R. and Vincent, W.F. (1222). Cyanobacterial

Dominance of Polar Freshwater Ecosystem: Are High-Latitude Mat-Formers

Adapted to Low Temperate. J. Phycol.; 44:121-121.

Tang, E.P.Y. and Vincent, W.F. (0220). Strategies of Thermal Adaptation

by High-latitude Cyanobacteria. New Phytologist; 130: 412-404.

Teneva, I.; Stoyanov, P.; Mladenov, R. and Dzhambazov, B. (0210).

Molecular and Phylogenetic Characterization of Two Species of the Genus

Nostoc (Cyanobacteria) Based on the cpcB-IGS-cpcA Locus of the

Phycocyanin Operon. J. BioSci. Biotech.; 1(1): 2-12.

Tiwari, O. N.; Singh, B. V.; Mishra, U.; Singh, A. K.; Dahar, D.W. and

Sangh, B. K. (0222). Distribution and Physiological Characterization of

Cyanobacteria Isolated from Arid Zones of Rajasthan. Tropical Ecology;

32(0): 122-121.

Tsuji, K.; Masui, H.; Uemura, H.; Mori, Y. and Harada, K. (0221). Analysis

of Microcystins in Sediments Using MMPB Method. Toxicon; 425222-220.

Tuchman, N. (7993). The role of Heterotrophy in Algae. In Stevenson, R.J.

Algal Ecology New York, USA, Academic Press, pp 022-412.

Vaitomaa, J.; Rantala, A.; Halinen, K.; Rouhiainen, L.; Tallberg, P.;

Mokelke, L. and Sivonen, K. (0224). Quantitative Real-Time PCR for

Determination of Microcystin Synthetase E Copy Numbers for Microcystis

and Anabaena in lakes. Appl. Environ. Microbiol., 22 (10):2022-2022.

Varis, O. (1224). Cyanobacteria Dynamics in A restored Finnish Lake:A

long Term Stimulation Study. Hydrobiologia; 0225102-32.

Vasconcelos, V. (0222). Eutrification, Toxic Cyanobacteria and

Cyanobacteria and Cyanotoxins: When Ecosystem Cry to Help. Limnetica;

02(1-0): 302-340.

Villareal ,T.A and Carpenter, E.J. (0224). Buoyancy Regulation and the

Potential for Vertical Migration in the Oceanic Cyanobacterium

Trichodesmium. Microb. Ecol.; 32(1):1-12.

http://www.ncbi.nlm.nih.gov/pubmed?term=Villareal%20TA%5BAuthor%5D&cauthor=true&cauthor_uid=12481233

http://www.ncbi.nlm.nih.gov/pubmed?term=Carpenter%20EJ%5BAuthor%5D&cauthor=true&cauthor_uid=12481233

http://www.ncbi.nlm.nih.gov/pubmed/12481233

Walsby, A.E.; Schan, F. and Schmid, M. (0222). The Burgundy-bloo

Phenomenon: A model of Buoyancy Change Explains Autumnal Water

Blooms by Planktothrix rubescens in Lake Zürich. New Phytologist; 122(1):

122-100.

Welker, M. ; Christiansen, G. and Van Dӧhren, H. (0223). Diversity of

Coexisting Planktothrix (Cyanobacteria) Chemotypes Dedused by Mass

Spectral analysis of Microsystins and Other Oligopeptides. Arch. Microbiol.;

120(3):022-22.

WHO. (0224). Algae and Cyanobacteria in Freshwater. In: Guidelines for

Safe Recreational Water Environments. Vol. 1: Costal and Freshwaters

World Health Organization, Geneva, Switzerland, pp 142-122.

Wu, Z.; Shi, J.; Lin, S. and Li, L. (0212). Unraveling Molecular Diversity

and Phylogeny of Aphanizomenon (Nostocales, Cyanobacteria) Strains

Isolated from China. J. Phycol.; 32(2): 1232-1222.

Table 1: Statystical analysis to the count of cyanophyta in stations during

study period.

Cyanophyta

Periods

1

0

4

3

1: October, November and December 0: January, February and March.

4. April, May and June. 3. July, August and September.

* p≤ 2.22

Table 3: Statystical analysis of physiochemical paramerters in station during

study period.

Cell ×123 /ml

Stasions

Mean±SE

(T-test)

River Intake

S. Dijla

2.22±2.21

(2.02)

2.22±2.21

(2.34)

2.13±2.24

(2.00)

2.12±2.24

(2.12*)

Al-

Wathba

2.22±2.20

(2.22)

2.22±2.21

(0.2)

2.14±2.21

(2.20)

2.02±2.22

(1.22)

Al-

Rasheed

2.22±2.21

(1.22)

2.22±2.11

(0.1)

2.12±2.24

(2.23)

2.43±2.23

(0.22)

Sedimentation

Tank

S. Dijla

2.22±2.24

(2.21)

2.22±2.23

(2.34)

2.24±2.21

(1.42*)

2.12±2.22

(2.22*)

Al-

Wathba

2.22±2.22

(2.4)

2.11±2.22

(2.22)

2.1±2.22

(2.02)

2.32±2.02

(2.22)

Al-

Rasheed

2.22±2.21

(2.2)

2.10±2.22

(2.22)

2.10±2.22

(1.22)

2.01±2.12

(2.2)

Attached

Algae

S. Dijla

2.1222.22

(2.02)

2.1222.22

(2.20*)

1.221.13

(2.22)

2.2222.31

(2.20*)

Al-

Wathba

2.04±2.12

(2.22)

2.43±2.02

(2.42)

4.22± 0.24

(2.22)

2.42±0.24

(2.24)

Al-

Rasheed

2.00±2.21

(2.44)

2.32±2.43

(2.2*)

3.0220.43

(1.23)

3.1221.23

(1.222)

Parameters

Periods

1

0

4

3

Stasions

Mean±SE

(T-test)

S. Dijla

12±0.23

(2.12)

13±2.22

(2.42)

02±0.22

(2.42)

02.44±2.22

(2.02)

Temperature

Al-

Wathba

12±4.12

(2.22)

14.22±2.22

(1.22)

03±1.24

(2.24)

02±1.22

(1.22)

Al-

Rasheed

12.22±0.22

(2.22)

12±1.12

(1.22)

02.22±1.32

(2.02)

02±1.24

(2.0)

Turbidity

S. Dijla

12.44±2.14

(2.22)

04.44±2.22

(2.04)

22.44±04.22

(2.23)

30±0.21

(2.24)

Al-

Wathba

04.22±2.22

(2.23)

02.22±2.44

(2.24)

22±02.22

(1.02)

34.44±0.24

(0.02)

Al-

Rasheed

04.44±2.22

(2.20)

02±2.42

(2.02)

22±04.24

(2.2)

22±1.12

(0.22)

pH

S. Dijla

2.2222.21

(2.24**)

2.2222.21

(1.24)

222.21

(2.22**)

2.2222.21

(2.24)

Al-

Wathba

2.20±2.00

(0.22*)

2.14±2.22

(1.22)

2.12± 2.20

(0.23)

2.23±2.22

(2.22)

Al-

Rasheed

2.22±2.23

(2.32)

2.24±2.22

(1.1)

2.2222.22

(2.23*)

2.2222.22

(2.300*)

Conductivity

S. Dijla

222232

(0.22)

230±00

(1.20)

233203

(2.22)

222213

(2.1**)

Al-

Wathba

222±22

(0.42)

211±20

(1.02)

222± 00

(1.22)

222±02

(3.24*)

Al-

Rasheed

224±22

(2.42)

212±22

(2.11)

222242

(2.21)

223234

(2.24)

Ca++

S. Dijla

20±4.32

(3.22**)

20.222.22

(1.22*)

2020.32

(0.30)

2020.32

(10.22**)

Al-

Wathba

123±2.22

(2.122)

21.2±11.02

(2.23)

24± 4.23

(2.02)

110±4.22

(2.20)

Al-

Rasheed

120±2.12

(3.11*)

20.02±11.22

(1.22*)

2222.22

(0.11)

12223.22

(2.20**)

S. Dijla

02.22±1.0

(0.12)

02.422.44

(2.32**)

02.422.22

(0.00)

22.421.32

(1.21)



Mg++

Al-

Wathba

41.44±1.2

(2.42)

44.4±2.44

(1.23*)

02± 1.22

(2.22)

0221.22

(1.12)

Al-

Rasheed

42.22±1.4

(0.04)

42.22±1.44

(2.2*)

0221.22

(1.42)

0222.22

(0.22)

NO0

S. Dijla

2.222±2.221

(3.03*)

2.222±2.220

(2.34)

2.222±2.221

(2.30)

2.222±2.222

(2.22*)

Al-

Wathba

2.223±2.221

(1.10)

2.222±2.224

(2.0)

2.222±2.223

(2.03)

2.223±2.221

(0.22)

Al-

Rasheed

2.222±2.221

(2.00)

2.21±2.221

(2.22)

2.21±2.221

(1.13)

2.222±2.222

(4.22*)

NO4

S. Dijla

2.32±2.22

(1.32)

2.23±2.22

(2.31)

1.11±.213

(2.34)

2.22±2.10

(2.23)

Al-

Wathba

2.22±2.13

(1.22*)

2.22±2.41

(2.22)

1.12±2.22

(2.22)

2.22±2.22

(2.22)

Al-

Rasheed

2.32±2.22

(2.12)

1.20±2.22

(1.20)

1.22±2.22

(2.22)

2.22±2.22

(1.12)

Silicate

S. Dijla

4.24±2.42

(1.21)

3.22±2.22

(1.23)

2.02±2.32

(0.2*)

2.22±2.22

(1.43)

Al-

Wathba

0.22±2.02

(1.32)

4.24±2.42

(2.21)

3.22±2.02

(0.22)

2.22±2.10

(2.30)

Al-

Rasheed

0.02±2.32

(0.23)

3.04±2.41

(1.12)

4.24±2.22

(3.2*)

2.22±2.42

(1.30)

* p≤ 2.22 ** p≤ 2.221

Table 3: Statystical analysis of physiochemical paramerters between

months in studied stations.

Parameters

Stations

F-test

S. Dijla Al-Wathba Al-Rasheed

Temperature 13.23** 10.03** 12.04**

Turbidity 3.23* 3.02* 3.12*

pH 0.22 2.30* 2.22

Conductivity 0.43 3.12* 0.33

Ca++

3.3* 2.42* 0.22

Mg++

0.23 3.42* 4.22

NO0 2.20 1.22 0.42

NO4 2.23* 0.22 14.42**

Silicate 0.22 2.34* 2.01** * p≤ 2.22 ** p≤ 2.221

Table 3: Statystical analysis of the effect physiochemical paramerters on

cyanophyta cell count in studied stations.

Parameters

Stations

F-test


Temperature 2.22** 3.24* 14.41**

Turbidity 02.30** 2.42* 3.22*

pH 2.22 4.22 2.42

Conductivity 2.22 2.42 1.33

Ca++

2.22 2.23 0.22

Mg++

1.13 2.20** 0.20

NO0 1.13 1.02 1.43

NO4 2.42 2.33 2.22

Silicate 2.41 1.21 2.22 * p≤ 2.22 ** p≤ 2.221

Appendix 1

Table 1. Identified algae in studied stations

Al-Wathba Station: September 1511

River intake Cell/l

Attached Algae Cell/l

Sedimentation Tank Cell/l

Class: Chlorophyceae Class: Chlorophyceae Class: Chlorophyceae

Chlamydomonas angides 212 /l Scenedesmus quadricauda 222

/ l

Chlamydomonas cienkowskii 20/l

Chlorella vulgaris 1221/l Chlorella vulgaris 223 /l Dictyosphaerium ehrenbergianum103/l

Chlamydomonas epipatie 222/l Spirogyra aequinoctialis 222 /l Monoraphidium contortum 20/l

Cosmarium sp. 42/l Mougeotia scalaris 212 /l Chlorella vulgaris 122/l

S c e n e d e s m u s

q u a d r i c a u d a112/ l

Pediastrum simplex 20/l

Class: Cyanophyceae Class: Cyanophyceae Class: Cyanophyceae

Blue-green filament 122/l /l Oscillatoria pseudogeminata 212/l Blue-green filaments 21/l

Oscillatoria sp. 42/l Oscillatoria limnetica 223 /l Oscillatoria limnetica 212/l

Oscillatoria limnetica 122/l Oscillatoria peronata 401 /l Lyngbya sp. 42/l

Lyngbya sp. 42/l Oscillatoria curviceps 124 /l Microcystis aeurginosa 122/l

Microcystis aeurginosa 104/l Oscillatoria princeps 213 /l Chroococcus minor 222/l

M i c r o c y s t i s f l o s - a q u a e

22/ l

Lyngbya spirulinoides 234 /l Chroococcus turigidus 22/l

Westiellopsis prolifica 221/ l Microcystis flos-aquae 222/l

Westiellopsis prolifica 221/ l

Microcystis aeurginosa 22/l Nostoc carneum 22/l

Lyngbya sp

232/l

Westiellopsis prolifica 1211/l

Phormidium tenue 223 /l

Spirulina sp. 403 /l

Class:Bacillariophyceae Class:Bacillariophyceae Class:Bacillariophycaee

Syndra tabulata 202/l Syndra ulna 222 /l Nitzschia gracilis 20/l

Navicula sp. 33/l Navicula grimmei 401 /l Surirella ovata 20/l

Cyclotella comta 422/l Navicula brekkaensis 222 /l Melosira granulata 122/l

Syndra rumpens 33/l Nitzschia vermicularis 000 /l

Caloneis bacillum 33/l Cyclotella meneghiniana 434 /l

Cymbella ventricosa 22/l Nitzschia commutate 022 /l

Mastogloia smithii 33/l Navicula trivialis 223 /l Navicula seminulum 33/l Cymatoptopleura solea 100

/ l

Nitzschia sp. 33/l

Cocconeis plasentula 33/l

Surirella sp. 122/l

Al-Rasheed Station: September 1511

River intake Cell/l




Ankistrodesmus falcatus 03/l Spirogyra novae-angliae 40/l Chlorella vulgaris 122/l

Monoraphidium sp. 40/l Monoraphidium sp. 33/l Dictyosphaerium sp. 41/l

Chlorella vulgaris 24/l Pandorina sp. 122/l M o u g e o t i a s p .

41/ l

Scenedesmus dimorphus 22/l


Blue-green filament 432//l Oscillatoria curviceps 222/l Blue-green filament 41/l

Chroococcus turigidus 122/l Oscillatoria limosa 432/l Anabaena fertilissima 20/l

Oscillatoria tenuis 22/ l Oscillatoria limnetica 1104/l Nostoc carneum 343/l

Lyngbya gardneri 102/l Westiellopsis prolifica 1122/l Spirulina laxissima 41/l

Microcystis aeurginosa 122/l Chroococcus turigidus 332/l Microcystis aeurginosa 122/l

Westiellopsis prolifica 101/l Oscillatoria tanganyikae222/l Chroococcus turigidus 022/l

Chroococcus turigidus 223/l Lyngbya connectens 444/l Westiellopsis prolifica 000/l

Oscillatoria princeps 213 /l Microcystis aeurginosa

1043/l

Class:Bacillariophyceae Class:Bacillariophyceae Class:Bacillariophyceae

Cocconeis plasentula 22/l Cyclotella meneghiniana 234/l Melosira granulata 120/l

Pinnularia molaris 43 l Navicula lanceolate 440/l Nitzchia liongissima 20/l

Diatoma hiemale 43/l Navicula radiosa 240/l Stephanodiscus sp. 131/l

Pinnularia gracillima 43/l Nitzschia acicularis 33/l Fragilaria intermedia 21/l

Navicula cymbula 43/l Cymbella ventricosa 23/l Nitzchia linearis 21/l

Cyclotella comata 042/l Stephanodiscus teuuis 11/l Diatoma elongatum 32/l

Melosira ambigua 43/l Amphora ovalis 44/l Navicula clementis 32/l

Nitzschia romana 43/l Diatoma vulgare 22/l Cyclotella meneghiniana 030/l

Nitzschia hantzschiana 43/l Cocconeis plasentula 400/l Navicula capitatoradiata 21/l

Nitzschia acicularis 43/l Hantzschia amphioxys 021/l

Rhoicosphenia marina 22/l Rhoicosphenia marina 402/l

Gyrosigma acuminatum 002/l

Cymbell naviculiformis 22/l

Rhopalodia parallela 22/l

S. Dijla Station: September 1511

River intake Cell/l




Ankistrodesmus falcatus 022/l Cosmarium sp. 22/l Chlamydomonas cienkowskii 20/l

Chlorella vulgaris 022/l Pandorina sp. 022/l Chlorella vulgaris 122/l

Monoraphidium sp. 122/l Pediastrum simplex 022/l

Kirchneriella obesa 123/l Scenedesmus quadricauda 123/l

Chlamydomonas angulosa 122/l Monoraphidium contortum 20/l

Pediastrum boryanum 20/l Coelastrum astroideum 123/l

Oedogonium globosum 123/l

Pediastrum duplex 20/l


Blue-green filament 312/l Oscillatoria curviceps 122/l Blue-green filaments 20/l

Oscillatoria limnetica 1104/l O s c i l l a t o r i a l i m o s a

133/ l

Chroococcus turigidus 022/l

Chroococcus turigidus 022/l Oscillatoria subbrevis 122/l Microcystis aeurginosa 122/l

Microcystis aeurginosa 143/l Phormidium sp. 142/l Lyngbya gardneri 102/l

Westiellopsis prolifica 000/ l Oscillatoria agardhii 122/l Oscillatoria limnetica 1104/l

Microcystis sp. 140/l N o s t o c c a r n e u m

234/ l

Pandorina sp. 044/l Westiellopsis prolifica 000/ l

Haematococcus lacustris 432/l


Class:Bacillariophyceae Class:Bacillariophycaee Class:Bacillariophyceae

Navicula brekkaensis 123/l Nitzschia palea 333/l Melosira granulata 222/l

Fragilaria construens 042/l Pinnularia borealis 232/l Mastogloia smithii 20/l

Cyclotella meneghiniana 20/l Cymbella cistula 222/l Nitzschia romana 123/l

Nitzchia acicularis 022/l Rhoicosphenia marina 122/l Navicula rostelata 20/l

Melosira ambigua 20/l Anomoeoneis vitrea 022/l Cyclotella meneghiniana 20/l

Syndra tabulate 444/l Diatoma elongatum 20/l

Caloneis ventricosa 332/l Nitzschia longissima 20/l

Stephanodiscus sp. 400/l


Navicula halophila 122/l

Gomphonema olivaceum 222/l

Diatoma elongatum 000/l

Cymbella ventricosa 233/l


Nitzchia acicularis 332/l

Cyclotella comata 222/l

Nitzchia subcapitellata

220/l

Al-Wathba Station: October 1511

River intake Cell/l




Chlamydomonas angulosa 212/l Spirogyra novae-angliae 201/l Ankistrodesmus falcatus 42/l

Chlorella vulgaris 1221/l M o n o r a p h i d i u m s p .

22/ l

Chlamydomonas angulosa 42/l

Chlamydomonas epipat iea

222/ l

Pandorina sp. 441/l Chrysidiastrum sp. 42/l

Scenedesmus quadricauda 112/l


Blue-green filament 120/l Oscillatoria curviceps 221/l Blue-green filament 42/l

Microcystis aeurginosa 102/ l Oscillatoria limosa 344/l Oscillatoria limnetica 42/l

Oscillatoria sp. 42/l Oscillatoria limnetica 110/l Nostoc carneum 22/l

Oscillatoria limnetica 122/l Oscillatoria sp. 120/l Oscillatoria tenuis 22/l

Lyngbya sp. 42/l Oscillatoria tanganyikae 223/l Aphanocapsa endophytica 42/l

Nostoc carneum 122/l Lyngbya connectens 014/l Haematococcus lacsustris

42/l

Westiellopsis prolifica 142/l Microcystis aeurginosa 1022/l Westiellopsis prolifica 002/l

Nostoc linckia 040/l Microcystis a aeurginosa 1022/l

Nostoc carnum 222/l

Westiellopsis prolifica 222/ l

Class:Bacillariophyceae Class:Bacillariophyecae Class:Bacillariophyceae

Syndra tabulata 202/l Cyclotella meneghiniana 222/l Cocconeis plasentula 422/l

Navicula sp. 33/l Navicula lanceolata 222/l Gomphonema angustatum 33/l Cyclotella comata 422/l Navicula radiosa 233/l Gomphonema bohemicum 141/l

Synedra rumpens 33/l Nitzschia acicularis 004/l Diatoma vulgare 33/l Caloneis bacillum 33/l Cymbella ventricosa 022/l Diatoma elongatum 22/l

Cymbella ventricosa 22/l Stephanodiscus teuuis 044/l Cyclotella ocellata 141/l Mastogloia smithii 33/l Amphora ovalis 222/l Cymbella affinis 33/l

Navicula seminulum 33/l Diatoma vulgare 440/l Pinnularia subcapitata 33/l

Nitzschia sp. 33/l Cocconeis plasentula 232/l Fragilaria construens 33/l Cocconeis plasentula 33/l Hantzschia amphioxys 30/l Syndra acus 33/l Surirella ovata 122/l Rhoicosphenia marina 004/l

Gyrosigna acuminatum 232/l



Al-Rasheed Station: October 1511

River intake Cell/l




Ankistrodesmus falcatus 40/l Pediastrum simplex 232/l Oedogonium pretense 122/l

Monoraphidium sp 40/l Monoraphidium contortum 140/l Scenedesmus quadricauda 022/l

Chlorella vulgaris 24/l Coelastrum microporum 22/l Ankistrodesmus falcatus 20/l

Spirogyra subsalsa 332/l Selenastrum gracile 20/l

Mougeotia scalaris 22/l


Blue-green filament 422/l Blue-green filament

033/l

Blue-green filament 410/l

Oscillatoria tenuis 22/l Oscillatoria limosa 002/l Lyngbya sp 42/l

Lyngbya gardneri Oscillatoria peronata 222/l Oscillatoria limnetica 402/l

102/l Microcystis aeurginosa 102/l Oscillatoria proteus 222/l Microcystis aergenasa 102/l

Chroococcus turigidus 22/l Oscillatoria curviceps 132/l Chroococcus turigidus 112/l

Nostoc carneum 22/l Microcystis sp. 42/l Nostoc carneum 112/l

Oscillatoria limnetica

044/l

Lyngbya spirulinoides 140/l




Cocconeis plasentula 22/l Navicula halophila 220/l Cyclo t e l la m enegh in iana

244/ l

Pinnularia molaris 43/l Navicula mutica 443/l Cyclotella comata 244/l

Diatoma hiemale 43/l Cymbell aspera 112/l Nitzschia minutula 20/l

Pinnularia gracillima 43/l Nitzschia gracilis 222/l Rhopalodia parallela 133/l

Navicula cymbula 43/l Firgallares virescens 222/l Nitzschia clausii 133/l

Cyclotella comata 042/l Diatoma elongatum 104/l Melosira ambigua 20/l

Melosira ambigua 43/l Cymbella helvetica 22/l Diatoma hiemale 422/l Nitzschia romana 43/l Pinnularia borealis 040/l Nitzschia intermedia 012/l

Nitzschia hantzschiana 43/l Cocconeis plasentula 12/l Rhoicosphenia curvata 20/l Nitzschia acicularis 43/l Nitzschia obtusa 20/l Nitzschia communis 133/l Rhoicosphenia marina 22/l Nitzschia communis

420/l


Cyclotella meneghiniana

100/l

Cymatoptopleura solea 20/l

Nitzschia romana 012/l

Nitzschia palea 20/l

Navicula cymbula 133/l


Syndra ulna 20/l Syndra rumpens 20/l

Nitzschia sigmoidea 133/l

S. Dijla Station: October 1511

River intake Cell/l




Chlorella vulgaris 02/l Ulothrix aeqalis 00/l Ankistrodesmus falcatus 20/l

Chlamydomonas cienkowskii 02/l Pandorina sp. 42/l Chlamydomonas angulosa 123/l

Chrysidiastrum sp. 02/l Pandorina sp. 14/l


Blue-green filaments 14/l Oscillatoria sancta 422/l Oscillatoria limnetica 20/l

Westiellopsis prolifica 22/l Oscillatoria amoena 122/l Microcystis sp. 02/l

Microcystis sp. 02/l Oscillatoria proboscidea 22/l Chroococcus turigidus 112/l

Oscillatoria subbrevis 02/l Phormidium mucicola 22/l Lyngbya lagerheimii 121/l

Chroococcus turigidus 112/l Westiellopsis prolifica 121/l Westiellopsis prolifica 221/l

Lyngbya gardneri 22/l Chroococcus turigidus 1112/l Nostoc carneum 112/l

Lyngbya gardneri

1104/l

Microcystis sp. 022/l


Cyclotella meneghiniana 23/l Cocconeis plasentula 043/l Nitzchia acicularis 20/l

Cocconeis plasentula 20/l G o m p h o n e m a

a n g u s t a t u m120/ l

Navicula brekkaensis 123/l

Navicula clementis 12/l Nitzchia vitrea 022/l Pinnularia borealis 20/l

Cymbella affinis 12/l Nitzchia parvula 220/l Cyclotella meneghiniana 20/l

Nitzschia dissipate 23/l Nitzchia apiculata 140/l

Cymbella helvetica 12/l Cyclotella meneghiniana

402/ l

Melosira granulata 42/l Fragilaria construens 22/l

Gomphonema olivaceum 42/l Navicula trivialis 22/l

Diatoma elongatum 42/l Diatoma elongatum 23/l

Fragilaria construens 20/l Cymbella cymbiformis 104/l

Rhoicosphenia curvata 110/l

Nitzchia obtusa 422/l

Cymbella affinis 143/l

Nitzchia rostellata 42/l


Al-Wathba Station: November 1511

River intake Cell/l




Chlorella vulgaris 44/l Spirogyra novae-angliae 21/l Chlamydomonas sp. 0/l

Chlamydomonas sp. 3/l Monoraphidium sp. 10/l Chlorella vulgaris 00/l

Pandorina sp. 44/l Pandorina sp 42/l Pediastrum simplex 1/l


Blue-green filament 2/l Oscillatoria curviceps 11/l Blue-green filament 1/l

Westiellopsis prolifica 102/l O s c i l l a t o r i a l i m o s a

34/ l Chroococcus minor 4/l

Chroococcus turigidus 0/l Oscillatoria limnetica 14/l Oscillatoria limnetica 33/l

Chroococcus minor 4/l Oscillatoria tanganyikae 12/l Microcystis aeurginosa 12/l

Microcystis aeurginosa 4/l Lyngbya connectens 12/l Chroococcus turigidus 43/l

Microcystis aeurginosa 12/ l W e s t i e l l o p s i s p r o l i f i c a

122/ l


Cymbella affinis 20/l Cyclotella meneghiniana

22/ l

Cocconeis placentula 322/l

Fragilaria construens 133/l Navicula lanceolata 24/l Gomphonema angustatum 22/l Gomphonema longiceps 20/l Navicula radiosa 34/l Gomphonema bohemicum 122/l

Nitzschia palea 20/l Nitzschia acicularis 22/l Diatoma vulgare 22/l Achnanthes hungarica 133/l Cymbella ventricosa 42/l D i a t o m a e l o n g a t u m

112/ l

Nitzschia minutula 20/l Stephanodiscus sp. 24/l Cyclotella ocellata 122/l

Amphora ovalis 40/l Cymbella affinis 22/l Diatoma vulgare 02/l Pinnularia subcapitata

22/l

Cocconeis plasentula 22/l Fragilaria construens 22/l

Hantzschia amphioxys 04/l Syndra acus 22/l

Rhoicosphenia marina 24/l

Gyrosignma acuminatum42/l



Al-Rasheed Station: November 1511

River intake Cell/l




Chlorella vulgaris 222/l Spirogyra aequinoctialis 342/l Chlorella vulgaris 1324/l

Chlamydomonas cienkowskii 20/l Scenedesmus quadriqadi 44/l Chlamydomonas cienkowskii 20/l

Kirchneriella subsolitaria123/l Mougeotia scalaris 34/l Pandorina morum 42/l

Chlorella vulgaris 22/l


Westiellopsis prolifica 122/l Oscillatoria pseudogeminata 043/l Blue-green filament 022/l

Chroococcus minor 123/l Oscillatoria limnetica 22/l Chroococcus minor 122/l

Microcystis sp. 14/ l Oscillatoria peronata 4/l Microcystis sp. 44/l

Lyngbya connectens 12/l Oscillatoria curviceps 42/l Lyngbya connectens 02/l

Oscillatoria proboscidea 42/l Oscillatoria princeps 33/l Oscillatoria proboscidea 33/l

Lyngbya spirulinoides 42/l Westiellopsis prolifica 122/l Microcystis sp. 04/ l Phormidium tenue 22/l


C y c l o t e l l a m e n e g h i n i a n a

122/ l

Syndra ulna 32/l Pinnularia leptosoma 12/l

Cocconeis plasentula 12/l Navicula grimmei 22/l Cymbell leptoceros 12/l

Navicula tuscula 12/l Navicula brekkaensis 10/l Cocconeis plasentula 42/l

Diatoma vulgare 12/l Nitzschia vermicularis 22/l Rhopalodia parallela 12/l

Diatoma elongatum 12/l Cyclotella meneghiniana 42/l Navicula pseudolanceolata 42/l

Fragilaria intermedia 12/l Nitzschia clementis 30/l

Fragilaria virescens 12/l Nitzschia trivialis 22/l

F r a g i l a r i a c o n s t r u e n s

24/ l

C y m a t o p t o p l e u r a s o l e a

42/ l

Gomphonema bohemicum 12/l


Gyrosigma sp. 42/l

S. Dijla Station: November 1511

River intake Cell/l




Chlorella vulgaris 02/l Ulothrix aequalis 03/l Ankistrodesmus falcatus 02/l

Chlamydomonas cienkowskii 00/l Pandorina sp. 22/l Chlorella vulgaris 02/l

Cladophroa sp. 02/l Pandorina sp. 14/l

Pandorina sp. 14/l


Blue-green filaments 14/l Blue-green filement 02/l Microcystis sp. 02/l

Microcystis sp. 02/l Oscillatoria amoena 22/l Westiellopsis prolifica 142/l

Oscillatoria subbrevis 02/l Oscillatoria proboscidea 02/l Microcystis aeurginosa 14/l

Westiellopsis prolifica 22/l Oscillatoria sancta 43/l Lyngbya connectens 02/l

Microcystis sp. 12/l Oscillatoria proboscidea 02/l

Phormidium mucicola 14/l


Cyclotella meneghiniana 23/l Cocconeis plasentula 02/l Cocconeis plasentula 02/l

Cocconeis plasentula 20/l Gomphonema angustatum12/l Cyc lo t e l la m enegh in iana

12/ l

Navicula clementis 12/l Nitzchia vitrea 21/l Navicula peregrina 13/l

Cymbella affinis 12/l Nitzchia parvula 02/l Nitzschia dissipate 02/l

Nitzschia dissipate 23/l Nitzchia apiculata 42/l Cymbella affinis 12/l

Cymbella helvetica 12/l Cyclotella meneghiniana 42/l Nitzschia linearis 12/l

Melosira granulata 42/l Fragilaria construens 33/l Achnanthes microcephala 02/l

Gomphonema olivaceum 42/l Navicula trivialis 00/l Pinnularia tabellaria 12/l

Diatoma elongatum 42/l Diatoma elongatum 01/l

Fragilaria construens 20/l Cymbella cymbiformis 02/l


Nitzchia obtusa 02/l


Nitzchia rostellata 42/l

Gomphonema olivaceum

22/ l

Diatoma vulgare 02/l

Al-Wathba Station: December 1511

River intake Cell/l




Chlorella vulgaris 1322/l Spirogyra rhizobrachialis 32/l Chlamydomonas sp . 0/ l

Chlamydomonas sp. 30/l Oedogonium capillare 33/l Chlorella vulgaris 00/l

Coelastrum microporum 34/l Pediastrum simplex 1/l


Blue-green filament 23/l Oscillatoria limnetica 24/l Blue-green filament 1/l

Oscillatoria limnetica 421/l Oscillatoria formosa 22/l Chroococcus minor 1/l

Chroococcus minor 102/l Oscillatoria subbrevis 23/l Oscillatoria limnetica 1/l

Oscillatoria sp. 30/l Oscillatoria ornata 22/l Microcystis aeurginosa 42/l

Microcystis aeurginosa 44/l Lyngbya connectens 30/l Westiellopsis prolifica 42/l

Chroococcus minor 00/l

Microcystis aeurginosa 42/l


Class:Bacillariophycaee Class:Bacillariophyceae Class:Bacillariophyceae

Cocconeis plasentula 404/l Diatoma elongatum 302/l Cyclotella meneghiniana 030/l

Nitzschia linearis 202/l Cymbella affinis 444/l Nitzschia acicularis 21/l


202/l

Cymbella sp. 330/l Pinnularia viridis 323/l

Syndra tabulata 21/l N a v i c u l a r a d i o s a

210/ l

Nitzschia romana 222/l

Melosira italica 121/l Fragilaria construens 240/l Nitzschia dissipate 1101/l

F r a g i l a r i a c o n s t r u e n s

1424/ l

Fragilaria virescens 02/l Eunotia pectinalis 030/l

Cymbella affinis 21/l Diatoma vulgare 110/l Nitzschia linearis 222/l

Gomphonema tergestinum 121/l Nitzschia gracilis 223/l Diatoma elongatum 404/l

Caloneis amphisbaena 121/l Nitzschia intermedia 20/l Navicula neoventricosa 21/l

Fragilaria intermedia 1242/l Nitzschia romana 342/l Cymbella affinis 404/l

Cymbella aspera 222/l Melosira dickiei 33/l Navicula radiosa 121/l

Nitzschia dubia 21/l Cyclotella meneghiniana 23/l Nitzschia stagnorum 21/l

Navicula enigmatica 121/l Cyclotella comata 22/l Cymbella caespitosa 030/l

Navicula cymbula 21/l Nitzschia apiculata 420/l Fragilaria construens 21/l

Nitzschia minutula 21/l Rhoicosphenia marina 220/l Achnanthes microcephala 2 22/l

Navicula radiosa 121/l Cocconeis plasentula 401/l Peronia fibula 222/l

Nitzschia fruticosa 21/l Nitzschia linearis 340/l Syndra ulna 030/l

Gyrosigma peisonis 21/l Navicula enigmatica 000/l Diatoma vulgare 121/l Gomphonema angustatum 21/l Gomphonema bohemicum 220/l Hantzschia amphioxys 030/l

Cymatoptopleura solea 121/l Navicula sp. 121/l

Diatoma elongatum 21/l Gomphonema olivaceum323/l

Achnanthes microcephala 404/l

All-Rasheed Station: December 1511

River intake Cell/l




Chlorella vulgaris 022/l Chlamydomonas sp. 332/l Chlorella vulgaris 221/l

Spirogyra aequinoctialis 40/l Spirogyra rhizobrachialis 440/l C h l a m y d o m o n a s s p .

40/ l


Blue-green filament 110/l Blue-green filament 30/l Blue-green filament 24/l

Oscillatoria limnetica 122/l Anabaena sp. 44/l Chroococcus minor 122/l

Chroococcus minor 22/l Oscillatoria formosa 442/l Oscillatoria limnetica 122/l

Nostoc lincka 120/l Spirulina major 20/l Microcystis sp. 321/l

Microcystis sp. 121/l Chroococcus minor 221/l Oscillatoria agardhii 20/l

Oscillatoria agardhii 40/l Oscillatoria limnetica 102/l Lyngbya connectens 22/l

Nostoc lincka 440/l


Oscillatoria agardhii 20/l

Lyngbya connectens

222/l



Cyclotella meneghiniana 422/l Nitzchia acicularis 223/l Syndra acus 02/l

C o c c o n e i s p l a c e n t u l a

143/ l

Navicula grimmei 440/l Navicula hungarica 2/l

Peronia fibula 100/l Nitzschia umbonata 104/l Diatoma elongatum 2/l

Nitzschia acicularis 22/l Gomphonema angustatum113/l Cyclotella meneghiniana 42/l

G yr o s ig m a a cu min a t u m

22/ l

Cymbella tumida 311/l Cymbella leptoceros 2/l

Nitzschia linearis 122/l Cyclotella meneghiniana 020/l Cymbella affinis 2/l

Diatoma elongatum 020/l Navicula rostellata 420/l Nitzschia fruticosa 24/l

Navicula cymbula 22/l Cymbella affinis 331/l Navicula radiosa 2/l

Navicula rostellata 102/l Rhoicosphenia marina 441/l Amphora ovalis

14/l

Fragilaria brevistriata

112/l

Achnanthes affinis 000/l Nitzschia acicularis 2/l

Achnanthes microcephala

122/ l

Cymbella cistula 40/l Syndra tabulata 2/l

Anomoeoneis vitrea 122/l


S, Dijla Station: December 1511

River intake Cell/l




Chlorella vulgaris 222/l Spirogyra scrobiculata 334/l Chlorella vulgaris 221/l

Chlamydomonas sp. 102/l Oedogonium sp. 30/l Kirchneriella lunaris 30/l

Pandorina sp. 110/l Chlorella vulgaris 20/l Chlamydomonas sp. 30/l

Coelastrum microporum 22/l


Oscillatoria limnetica 30/l Blue-green filament 22/l Microcystis aergenasa 102/l

Chroococcus minor 22/l Oscillatoria limnetica 222/l Chroococcus minor 22/l

Microcystis sp. 343/l Oscillatoria formosa 30/l Microcystis sp. 321/l

Oscillatoria agardhii 33/l Oscillatoria curviceps 20/l Oscillatoria agardhii 00/l

Lyngbya connectens 22/l Oscillatoria agardhii 23/l Lyngbya connectens 22/l

Phormidium mucicola 22/l


Westiellopsis prolifica 143l


Diatoma vulgare 22/l Cocconeis plasentula 022/l Cyclotella comata 012/l

Achnanthes hungarica 24/l Gomphonema angustatum 142/l Nitzschia linearis 012/l

Nitzschia linearis 112/l Nitzchia acicularis 000/l Eunotia pectinalis 022/l

Fragilaria brevistriata 044/l Cymbella helvetica 112/l Cocconeis placentula 20/l

Cyclo t e l la menegh in iana

122/ l

Nitzchia apiculata 430/l D i a t o m a e l o n g a t u m

022/ l

Achnanthes microcephala 122/l Cyclotella meneghiniana 110/l Cyclotella meneghiniana 012/l

Syndra ulna 23/l Fragilaria construens 20/l Nitzschia gracilis 20/l

Cocconeis placentula 22/l Navicula trivialis 011/l Peronia fibula 20/l

Cyclotella comata 112/l Diatoma vulgare 402/l Nitzschia dissipate 133/l

Nitzschia palea 223/l Cymbella cymbiformis 302/l

Gomphonema tergestinum 22/l Rhoicosphenia curvata 22/l

Nitzschia acicularis 22/l Firgallares brevistriata 322/l

Cymbella cistula 30/l

Navicula brekkaensis 43/l

G o m p h o n e m a o l i v a c e u m

20/l

Melosira dickiei 20/l


Navicula enigmatica 44/l

Achnanthes affinis 30/l

Al-Wathba Station: January 1511

River intake Attached Algae Sedimentation Tank

Cell/l Cell/l Cell/l

Class: Chlorophycea Class: Chlorophyceae Class: Chlorophyceae

Chlorella vulgaris 322/l Cladophroa sp. 32/l Ulothrix sp. 30/l

Ulothrix sp. 30/l Vaucheria sp. 20/l Chlorella vulgaris 442/l

Chlorella ellipsoidea 222/l Chlamydomonas cienkowskii 3320/l Chlamydomonas cienkowskii 30/l

Chlorella vulgaris

042/l



Lyngbya lagerheimii 22/l Microcystis aeurginosa 1022/l Westiellopsis prolifica 22/l

N o s t o c l i n c k a

002/ l

Oscillatoria subbrevis 1102/l Oscillatoria tenuis 444/l

O s c i l l a t o r i a t e n u i s

102/ l

Oscillatoria formosa 102/l Microcystis aeurginosa 122/l

Chroococcus minor 22/l Lyngbya connectens 1022/l Westiellopsis prolifica 221/l

Microcystis flos-aquae 44/l Nostoc carneum 1111/l Nostoc carneum 422/l Microcystis aeruginasa 102/l Oscillatoria princeps 222/l Lyngbya lagerheimii 22/l

W e s t i e l l o p s i s p r o l i f i c a

102/ l

Oscillatoria tenuis 220/l Oscillatoria limnetica 222/l

Westiellopsis prolifica 222/l Chroococcus turigidus 22/l


Nitzschia sigmoidea 222/l Cyclotella meneghiniana 342/l Gyrosigma acuminatum 20/l

Cymbella cistula 133/l Cyclotella comata 222/l Nitzschia sigmoidea 212/l

Achnanthes microcephala 20/l Nitzschia linearis 442/l Melosira ambigua 20/l

Cymbella tumida 012/l Nitzschia palea 221/l Nitzschia dissipate 022/l Gyrosigma attenuatum 20/l Cocconeis plasentula 032/l Cymbella laevis 133/l

Nitzschia sigma 422/l Cymbella caespitosa 224/l Cyclotella meneghiniana 422/l

Diatoma vulgare 20/l Cymbella affinis 223/l Diatoma vulgare 212/l

Cyclotella meneghiniana 20/l Surirella ovata 230/l Gyrosigma attenuatum 33/l

D i a t o m a e l o n g a t u m

12221/ l

Nitzschia obtusa 422/l Navicula radiosa 022/l

Synedra ulna 20/l Nitzschia tryblionella 232/l Nitzschia apiculata 022/l

Navicula radiosa 422/l Gomphonema olivaceum 1130/l Achnanthes lanceolata 133/l

Nitzschia fruticosa 1132/l Cymbella leptoceros 231/l Fragilaria producta 422/l

Cocconeis placentula 20/l Pinnularia biceps 222/l Cocconeis placentula 022/l

N i t z s c h i a p a l e a

012/ l

Cyclotella ocellata 22/l Melosira granulata 012/l

Nitzschia communis 20/l Navicula grimmei 22/l

Stephanodiscus sp. 122/l Cyclotella comata 133/l


Al-Rasheed Station: January 1511

River intake Cell/l




Chlorella vulgaris 102/l Spirogyra novae-angliae 22/l Chlorella vulgaris 304/l

Chlamydomonas sp. 30/l C h l o r e l l a v u l g a r i s

332/ l

Chlamydomonas sp. 22/l

Chlamydomonas sp.

000/l



34/l Westiellopsis prolifica Nostoc linckia 412/l L yngbya sp. 340/l

C h r o o c o c c u s t u r i g i d u s

132/ l

Oscillatoria limnetica 222l Microcystis aeruginosa 22/l

Lyngbya connectens

102/l

Oscillatoria curviceps 222/l Westiellopsis prolifica 223/l

Oscillatoria limnetica 111/l Oscillatoria foreaui 111/l Oscillatoria limnetica 011/l

Golenkinia paucispina 22/l Spirulina major 223/l Nostoc linckia 412/l

Oscillatoria tenuis 22/l Lyngbya connectens

201l/l


041/ l

Nostoc linckia 00/l Westiellopsis prolifica 22/l

M i c r o c y s t i s a e r u g i n o s a

122/ l



Cyclotella ocellata 02/l Fragilaria construens 100/l Navicula enigmatica 22/l

Diatoma elongatum 2/l E u n o t i a t e n e l l a

233/ l


Nitzschia sigmoidea 41/l Cyclotella meneghinian 121/l Diatoma elongatum 22/l

Nitzschia romana 2/l Cymbella caespitosa 013/l Fragilaria producta 112/l

Cymbella amphicephala 2/l Cymbella affinis 243/l Peronia fibula 22/l

Syndra ulna 2/l Pinnularia appendiculata 30/l Gyrosigma attenuatum 22/l

Nitzschia dissipate 12/l Nitzchia acicularis 222/l Achnanthes microcephala

22/l

Cyclotella meneghiniana 14/l Nitzschia palea 322/l Nitzschia palea 22/l

Cocconeis plasentula 2/l Navicula schroeteri 000/l

Cymbella leptoceros 14/l Fragilaria intermedia 220/l

Peronia fibula 2/l 002/l Rhoicosphenia marina

Gomphonema constrictum 14/l Melosira dickiei 222/l

Amphiplrora alata 2/l Fragilaria producta 040/l

Fragilaria intermedia 14/l Diatoma elongatum 234/l

S. Dijla Station: January 1511

River intake Cell/l




Chlorella vulgaris 011/l Chlamydomonas cienkowskii 023/l Chlorella vulgaris 421/l

Chlamydomonas cienkowskii 30/l Chlamydomonas cienkowskii 20/l

Monoraphidium contortum 22/l Monoraphidium contortum 112/l



Lyngbya lagerheimii 22/l Oscillatoria curviceps 310/l Microcystis aeruginosa 102/l

Oscillatoria limnetica 22/l Oscillatoria limnetica 234/l Westiellopsis prolifica 232/l

Microcystis aeruginosa 102/l Microcystis aeruginosa 123/l Oscillatoria limnetica 30/l

Westiellopsis prolifica 032/l Anabaena sp. 32/l Lyngbya lagerheimii 21/l

Chroococcus turigidus 140/l Westiellopsis prolifica 232/l Chroococcus turigidus 334/l

Nostoc linckia 22/l Nostoc linckia 333/l Nostoc linckia 403/l


Fragilaria intermedia 321/l Cymbella caespitosa 222/l Nitzchia palea 122/l

Nitzschia sigmoidea 224/l Cymbella affinis 234/l Diatoma elongatum 020/l

Rhoicosphenia curvata 1222/l Navicula schroeteri 320/l Cyclotella meneghiniana 044/l

Syndra ulna 142/l Fragilaria construens 30/l Nitzchia fruticosa 044/l

Cocconeis plasentula 142/l Nitzschia clausii 222/l Stephanodiscus sp. 122/l

Navicula trivialis 224/l Navicula fruticosa 340/l Gomphonema angustatum 22/l


142/l

Diatoma elongatum 111/l Navicula radiosa 122 /l

Pinnularia molaris 020/l Cyclotella meneghiniana 430/l Cymbella cesatii 12/l

Bacillaria paxillifer 1432/l Stephanodiscus sp. 222/l Peronia fibula 22/l

Cymbella caespitosa 442/l Cocconeis plasentula 401/l Cocconeis plasentula 22/l

Cymbella leptoceros 442/l Pinnularia biceps 222/l Nitzschia sigmoidea 112/l

Cymbella tumida 020/l Gomphonema angustatum 402/l Rhoicosphenia curvata 112/l

Diatoma vulgare 0221/l Nitzschia palea 222/l Cymbella caespitosa 224/l

Surirella ovate 22/l Nitzchia dissipate 302/l

Fragilaria roduct 323/l

Rhopalodia curvata 412/l

Nitzschia vermicularis 310/l

Nitzschia apiculata 401/l

Al-Wathba Station: February 1511

River intake Cell/l




Chlorella vulgaris 0024/l Monoraphidium sp. 22/l C h l o r e l l a v u l g a r i s

221/ l

C h l a m y d o m o n a s s p .

30/ l

Vuscheria sp. 24/l Chlorella ellipsoidea 102/l



Blue-green f i lement 22/ l Blue-green filament 22/l Chroococcus minor 122/l

Oscillatoria limnetica 22/l Microcystis aeurginosa 014/l Microcystis sp. 321/l

Chroococcus minor 022/l Oscillatoria subbrevis 421/l Oscillatoria agardhii 33/l

Microcystis sp. 21/l Oscillatoria limnetica 022/l Nostoc linckia 22/l

Oscillatoria agardhii 33/l Nostoc linckia 22/l Lyngbya sp. 24/l

Microcystis aeurginosa 14/l Lyngbya sp. 22/l

Class:Bacillariophyceae Class:Bacillariophyceae Class:Bacillariophycaee

Syndra tabulata 020/l Cyclotella meneghiniana 23/l F r a g i l a r i a b r e v i s t r i a t a

122/ l

Nav icu la cryp tocepha la

112/ l

Cyclotella comata 40/l Cocconeis disculus 22/l

Cymbella affinis 020/l Rhoicosphenia curvata 23/l Navicula radiosa 112/l

Cymbella lanceolata 112/l Diatoma vulgare 22/l Navicula gracilis 112/l

Diatoma vulgare 044/l Gyrosigma acuminatum 22/l Cyclotella atomus 22/l

C o c c o n e i s p l a c e n t u l a

244/ l

Cymbella caespitosa 22/l Nitzschia acicularis 22/l

Navicula graciloides 22/l Amphora ovalis 22/l

Peronia fibula 020/l Surirella ovata 034/l

Syndra acus 020/l Nitzschia fruticosa 011/l

Nitzschia linearis 020/l Nitzschia linearis 22/l

Navicula phyllepta 020/l Gomphonema olivaceum 22/l

Navicula radiosa 112/l Cymbella leptoceros 43/l

Gyrosigma acuminatum

22/ l

Navicula radiosa 022/l

Syndra delicatissima 020/l Neidium iridis 43/l

Navicu la cryp tocepha la

112/ l

Navicula fragilarioides 22/l


Cymbella lanceolata 112/l



Navicula graciloides 22/l Peronia fibula 020/l

Al-Rasheed Station: February 1511

River intake Cell/l




Chlorella vulgaris 243/l Oedogonium capillare 40/l Chlorella vulgaris 233/l

Oedogonium crassum 30/l Pandorina sp. 30/l


Blue-green filament 022/l B l u e - g r e e n f i l a m e n t

412/ l

B l u e - g r e e n f i l a m e n t

22/ l

Chroococcus minor 011/l Oscillatoria tenuis 122/l Chroococcus minor 022/l

Oscillatoria limnetica 22/l Oscillatoria limnetica 300/l Oscillatoria limnetica 023/l

Chroococcus turigidus 30/l Microcystis aeurginosa 20/l Microcystis aeurginosa 122/l

Anabaena sp. 30/l Microspora loefgrenii 23/l Lyngbya connectens 102/l Nostoc lincka 30/l Nostoc linckia 22/l Oscillatoria subbrevis 102/l

Nostoc carneum 30/l Lyngbya sp. 22/l Aphanocapsa endophytica 30/l

Lyngbya lagerheimii 30/l


Syndra ulna 22/l Fragilaria virescens 132/l Anomoeoneis vitrea 22/l

Diatoma elongatum 322/l Melosira granulata 22/l Syndra tabulata 22/l

Nitzschia sigma 222/l Cyclotella eneghiniana

024/l


Nitzschia dissipate 020/l Surirella ovata 120/l Diatoma vulgare 020/l

Cymatoptopleura solea 322/l Cymbella caespitosa 122/l Gomphonema olivaceum 112/l

Cyclotella meneghiniana 322/l Diatoma vulgare 40/l Diatoma elongatum 422/l

Rhoicosphenia curvata 1244/l Nitzchia fruticosa 422/l Navicula radiosa 112/l

Pinnularia appendiculata 122/l Neidium iridis 22/l Melosira dickiei 322/l

Cymbella helvetica 122/l Cymbella cistula 122/l Fragilaria brevistriata 22/l

Cocconeis plasentula 1244/l F r a g i l a r i a i n t e r m e d i a

022/ l


Nitzschia dubia 112/l Rhoicosphenia marina

122/l

Diatoma vulgare 322/l Surirella subsalsa 22/l

Cyclotella comata 112/l Nitzchia tryblionella 23/l

Achnanthes affinis 020/l Diatoma elongatum 012/l

Navicula dicephala 122/l

Melosira granulata 020/l

Surirella ovate 322/l


S. Dijla Station: February 1511

River intake Cell/l




Chlorella vulgaris 322/l Ulothrix tenerrima 23/l Chlorella vulgaris 224/l

Chlamydomonas cienkowskii 22/l Mougeotia scalaris 123/l Chlamydomonas cienkowskii 22/l

Cosmarium sp. 34/l


Blue-green filament 022/l Blue-green filament 022/l Chroococcus minor 30/l

Chroococcus minor 22/l Oscillatoria tenuis 023/l Lyngbya connectens 12/l

Microcystis aeurginosa 12/l Oscillatoria limnetica 122/l Phormidium tenue 141/l

Lyngbya connectens 122/l Microcystis aeurginosa 122/l Microcystis aeurginosa 132/l

Phormidium tenue 101/l Lyngbya connectens 122/l

Phormidium tenue 121/l


Cymbella leptoceros 112/l Cymbella brehmii 122/l Cymbella parva 142/l

Stephanodiscus sp. 112/l Cymbella affinis 013/l Navicula schroeteri 22/l

Nitzschia sigmoidea 322/l Navicula schroeteri 023/l Gomphonema angustatum 22/l

Cymbella cistula 112/l Fragilaria producta 013/l Cocconeis placentula 020/l

Cocconeis placentula 044/l Nitzschia clausii 011/l Surirella ovata 22/l

Navicula rostellata 22/l Cymbella cistula 122/l Rhoicosphenia curvata 142/l

Amphora veneta 22/l Diatoma elongatum 122/l Pinnularia appendiculata 22/l

Cyclotella meneghiniana 122/l Cyclotella meneghiniana 122/l Cyclotella meneghiniana 142/l

Achnanthes hungarica 112/l Cymbella aspera 022/l Diatoma elongatum 142/l

Diatoma vulgare 22/l Cocconeis plasentula 122/l Cymbella leptoceros 022/l

Gyrosigma acuminatum 122/l Cymbella caespitosa 122/l Fragilaria brevistriata 22/l

Fragilaria intermedia 122/l Gomphonema lanceolatum 124/l Syndra ulna 020/l

Syndra tabulata 112/l Stauroneis anceps 123/l Cymbella cistula 21/l

Cyclotella ocellata 112/l Nitzchia dubia 120/l Amphora veneta 22/l

Achnanthes microcephala 122/l Fragilaria brevistriata 121/l Achnanthes hungarica 22/l

Navicula grimmei 044/l Rhopalodia parallela 122/l Diatoma vulgare 22/l Peronia fibula 112/l Gomphonema bohemicum 122/l Nitzschia linearis 22/l

Rhoicosphenia curvata 112/l Nitzschia apiculata 120/l Nitzschia sigmoidea 22/l

Nitzschia linearis 112/l

Gomphoneis olivaceaum 112/l

Pinnularia viridis 112/l

Al-Wathba Station: March 1511

River intake Cell/l




Chlorella vulgaris 011/l Mougeotia scalaris 122/l Chlorella vulgaris 011/l

Chlorella ellipsoidea 122/l Chlamydomonas cienkowskii 202/l Chlorella ellipsoidea 30/l

Chlamydomonas cienkowskii 023/l Chlamydomonas sp. 22/l

Oedogonium capillare 30/l


Tetradesmus wisconsinense 30/l Blue-green filament 20/l Blue-green filament 30/l

Oscillatoria subbrevis 30/l Microcystis aeruginosa 40/l Chroococcus minor 102/l

Chroococcus minor 102/l Oscillatoria formosa 22/l Microcystis sp. 30/l

Microcystis aeruginosa 30/l Oscillatoria tenuis 30/l Westiellopsis prolifica 102/l

Oscillatoria formosa 30/l Oscillatoria limnetica 011/l Microcystis flos-aquae 42/l Nostoc lincka 40/l

Westiellopsis prolifica 00/l Oscillatoria subbrevis 01/l





Cyclotella meneghiniana 030/l Nitzschia linearis 20/l Nitzschia linearis 022/l

Syndra tabulate 121/l C o c c o n e i s p l a c e n t u l a

30/ l

Syndra radians 20/l

Nitzschia dissipate 21/l Cyclotella meneghiniana 122/l Nitzschia dubia 20/l

Diatoma elongatum 323/l Fragilaria construens 40/l Caloneis bacillum 20/l

Navicula enigmatica 21/l Cymatoptopleura solea 01/l Syndra tabulate 20/l

Nitzschia linearis 121/l Diatoma vulgare 40/l Cyclotel la meneghiniana

133/ l

Navicula halophila 21/l Gyrosigma acuminatum 22/l

Eunotia lunaris 21/l Cymbella caespitosa 22/l

Cymbella gracilis 21/l Fragilaria virescens 40/l

Cyclotella comata 121/l Surirella ovata 24/l

Cymbella affinis 121/l Peronia fibula 020/l

Cocconeis placentula 232/l Syndra acus 020/l


Pinnularia borealis 21/l

Stephanodiscus sp. 21/l Navicula radiosa 121/l

Al-Rasheed Station: March 1511

River intake Cell/l





Chlorella ellipsoidea 221/l Oedogonium capillare 01/l Chlorella ellipsoidea 023/l

Cladophora sp. 30/l Chlorella vulgaris 142/l Chlamydomonas sp. 30/l

Mougeotia scalaris 30/l Cladophora crispate 102/l

Pandorina sp. 30/l



Microcystis sp 122/l Oscillatoria subbrevis 122/l Microcystis sp. 22/l

Merismopedia sp 22/l Oscillatoria formosa 122/l Chroococcus minor 30/l

Chroococcus minor 122/l Oscillatoria tenuis 22/l Aphanocapsa endophytica 30/l

Oscillatoria limnetica 22/l Oscillatoria linckia 122/l Gloeocapsa aeruginosa 30/l Gloeocapsa aeruginosa 122/l Lyngbya connectens

01/l Merismopedia sp. 30/l

Aphanocapsa endophytica 122/l Microcystis aeruginosa 22/l Westiellopsis prolifica 131/l

Microcystis aeruginosa 22/l Chroococcus minor 40/l




Diatoma vulgare 223/l Cyclotella meneghiniana 11/l Navicula radiosa 22/l

Rhoicosphenia curvata 341/l Surirella ovata 122/l Nitzschia palea 22/l

Nitzschia acicularis 133/l Fragilaria virescens 40/l B a c i l l a r i a p a x i l l i f e r

212/ l

Gomphonema intricatum 133/l Fragilaria construens 40/l Diatoma elongatum 020/l

Cocconeis plasentula 4042/l Diatoma elongatum 11/l Nitzschia linearis 044/l

Nitzschia sigma 422/l Nitzschia linearis 01/l Nitzschia hungarica 044/l

Fragilaria intermedia 133/l Syndra tabulate 01/l Nitzschia minutula 112/l

Diatoma elongatum 012/l Rhoicosphenia curvata 40/l Diatoma vulgare 112/l

Cyclotella meneghiniana 012/l Navicula radiosa 20/l Cocconeis plasentula 122/l

Nedium iridis 133/l Cymbella affinis 30/l Nitzschia sigma 112/l

Syndra acus 133/l Navicula schroeteri 112/l Nitzschia acicularis 112/l

Nitzschia acicularis 133/l Gomphonema gracile 22/l Cymbella affinis 22/l

Cymbella affinis 133/l Cocconeis placentula 20/l Rhoicosphenia curvata 22/l Epithemia sp . 133/l Cymbella gracilis 22/l Syndra tabulate 422/l

Melosira granulate 012/l Amphora ovalis 22/l Gomphonema olivaceum 22/l

Cyclotella comata 20/ l Cyclotella meneghiniana 112/l

Bacillaria paxillifer 223/l Gyrosigma attenuatum 22/l


S. Dijla Station: March 1511

River intake Cell/l




Chlorella vulgaris 1411/l Chlamydomonas cienkowskii122/l Chlorella vulgaris 220/l

Chlamydomonas sp 22/l Spirogyra scrobiculata 20/l Pandorina sp. 11/l




Blue-green filament 22/l Blue-green filament 24/l Blue-green filament

22/ l

Chroococcus minor 102/l Oscillatoria tenuis 122/l Wes t i e l l ops i s pr o l i f i ca

002/ l

Nostoc lincka 01/l Oscillatoria limnetica 24/l Nostoc lincka 11/l Lyngbya connectens 24/l Oscillatoria sp. 23/l Lyngbya connectens 44/l

Microcystis aeurginosa 40/l Oscillatoria formosa 24/l Microcystis aeurginosa 33/l Oscillatoria ornata 24/l

Oscillatoria subbrevis 40/l

Microcystis aeurginosa 20/l

Nostoc lincka 01/l

Lyngbya connectens 24/l Chroococcus minor 11/l


Nitzschia linearis 202/l Rhoicosphenia curvata 20/l Melosira granulata 044/l

Diatoma vulgare 112/l Navicula radiosa 30/l Fragilaria brevistriata 112/l Peronia fibula 112/l Nitzschia linearis 30/l Cyclotella meneghiniana 22/l

Cymbella affinis 22/l Navicula schroeteri 30/l Nitzschia vitrea 22/l

Nitzschia dissipate 122/l Cymbella cymbiformis 30/l Cocconeis placentula 1222/l

Gomphonema olivaceum 112/l Cymbella cistula 24/l Gomphonema olivaceum 22/l

Cocconeis placentula

020/ l

Gomphonema lanceolatum 01/l Nitzschia dissipate 22/l

Rhoicosphenia curvata 22/l Cocconeis placentula 41/l

Diatoma elongatum 4212/l Cymatoptopleura solea 122/l

Cyclotella comaa 22/l Surirella ovata 142/l

Achnanthes delicatula 112/l Cyclotella meneghiniana 122/l

Nitzschia palea 112/l Nitzschia dissipate 01/l

Cymbella leptoceros 122/l Diatoma elongatum 01/l

Cyclotella meneghiniana 322/l Diatoma vulgare 01/l

Nitzschia palea 40/l

Syndra acus 01/l

Mastogloia smithii 01/l



Al-Wathba Station: April 1511

River intake Cell/l




Oedogonium capillare 102/l Chlorella vulgaris 2430/l Chlorella vulgaris 0222/l

Chlorella vulgaris 0113/l Oedogonium crassum 211/l Chlorella ellipsoidea 243/l

Chlorella ellipsoidea 1022/l C h l a m y d o m o n a s s p .

300/ l

Oedogonium capillare 30/l

Cladophora crispate 102/l Monoraphidium contortum 010/l

Scenedesmus quadricauda 102/l Cladophora crispate 102/l

Mon ora ph id i um co n tor t um

102/ l




Chroococcus minor 010/l Blue-green filament 022/l Nostoc carneum 30/l


22/ l

Lyngbya gardneri 300/l Oscillatoria subbrevis 122/l

Oscillatoria formosa 102/l Oscillatoria perornata 1423/l Oscillatoria limnetica 023/l

Oscillatoria tenuis 023/l Chroococcus minor 4121/l Chroococcus minor 122/l

Oscillatoria limnetica 010/l Chroococcus turigidus 202/l Microcystis aeruginosa 22/l

Lyngbya connectens 30/l Phormidium tenue 243/l Aphanocapsa endophytica 30/l

Microcystis aeruginosa 102/l Oscillatoria limnetica 412/l Anabaena sp. 30/l

Westiellopsis prolifica 140/ l Oscillatoria formosa 232/l Phormidium tenue 122/l Microcystis aeruginosa 202/l Oscillatoria formosa 22/l

Oscillatoria subbrevis 1022/l Lyngbya connectens 102/l Westiellopsis prolifica 122/ l Lyngbya lagerheimii 102/l Oscillatoria limosa 022/l

Oscillatoria princeps 22/l



Syndra ulna 034/l Diatoma elongatum 412/l Bacillaria paxillifer 031/l

Fragilaria construens 121/l Nitzschia linearis 412/l Fragilaria virescens 121/l

Nitzschia sigmoidea 121/l Surirella ovalis 202/l Fragilaria construens 034/l

Diatoma elongatum 222/l Cyclotella meneghiniana 202/l Cyclotella meneghiniana 030/l

Diatoma vulgare 232/l Cocconeis plasentula 412/l Cocconeis plasentula 122/l

Navicula radiosa 1222/l Cymbella affinis 232/l Gyrosigma sp. 121/l

Eunotia tenella 034/l Cymbella cistula 223/l Nitzschia palea 030/l

Pinnularia leptosoma 320/l Cymbella leptoceros 222/l Nitzschia linearis 232/l

Cocconeis plasentula 323/l Gomphonema acuminatum 232/l Diatoma elongatum 320/l

Rhoicosphenia curvata 404/l Amphora holsatica 222/l Diatoma vulgare 400/l

Nitzschia linearis 404/l Pinnularia leptosoma 124/l

Nitzschia recta 121/l Melosira dickiei 21/l

Gyrosigma attenuatum 122/l



Surirella ovalis 030/l


Cymbella cistula 030/l

Cymbella leptoceros 122/l

Gomphonema acuminatum 034/l

Amphora holsatica 032/l

Amphora commutata 122/l

Al-Rasheed Station: April 1511

River intake Cell/l





Chlorella ellipsoidea 243/l Oedogonium capillare 011/l Chlorella ellipsoidea 242/l

Mougeotia scalaris 30/l Pandorina sp 412/l


Blue-green filament 022/l Oscillatoria subbrevis 0230/l Blue-green filament 102/l /l

Oscillatoria tenuis 30/l Oscillatoria limosa 1220/l Gloeocapsa aeruginosa 30/l Westiellopsis prolifica 22/l Oscillatoria limnetica 243/l Microcystis aeruginosa 102/l

Chroococcus minor 22/l Oscillatoria tenuis 1222/l Oscillatoria limnetica 442/l

Microcystis aeruginosa 102/l Spirulina major 011/l Oscillatoria subbrevis 442/l

Phormidium tenue 22/l Microcystis aeruginosa 1120/l Spirulina major 30/l

Nostoc carneum 22/l Lyngbya connectens 300/l Westiellopsis prolifica 144/l

Gloeocapsa aeruginosa 22/l Phormidium tenue 011/l Aphanocapsa endophytica 30/l

Oscillatoria limnetica 22/l Oscillatoria princeps 243/l

Lyngbya sp. 30/l Nostoc carneum 011/l

Westiellopsis prolifica 122/l Westiellopsis prolifica 1002/l


Surirella ovata 20/l Nitzschia linearis 412/l Cymbella affinis 404/l

Cocconeis placentula 422/l Nitzschia sigmoidea 300/l Nitzschia linearis 121/l

Achnanthes affinis 133/l Navicula radiosa 300/l Syndra tabulata 323/l

Achnanthes minutissima 022/l Cocconeis plasentula 202/l Diatoma elongatum 222/l

Achnanthes microcephala 133/l Melosira granulata 011/l Nitzschia sigmoidea 121/l

Achnanthes hungarica 20/l Cyclotella meneghiniana 011/l Navicula radiosa 121/l

Gomphonema olivaceum 133/l Mastogloia smithii 011/l Rhoicosphenia curvata 21/l

Rhoicosphenia curvata 232/l Pinnularia borealis 011/l Cymbella aspera 21/l

Cymbella affinis 422/l Cymbella affinis 011/l Diatoma vulgare 21/l Cyclotella meneghiniana 012/l Gomphonema olivaceum 011/l

Nitzschia linearis 20/l Diatoma elongatum 412/l

Syndra tabulata 20/l Fragilaria construens 412/l

Navicula radiosa 133/l Surirella ovata 011/l

Nitzschia sigma 220/l Diatoma vulgare 011/l


Nitzschia communis 20/l

Nitzschia dissipate 20/l




Cymbella amphicephala 20/l

S. Dijla Station: April 1511

River intake Cell/l





Chlorella ellipsoidea 222/l Spirogyra sp. 042/l Chlorella ellipsoidea 222/l

Scenedesmus dimorphus 102/l Chlamydomonas sp. 412/l Monoraphidium contortum 30/l

Chlorella vulgaris 304/l Scenedesmus quadricauda 22/l

Pandorina morum 011/l Chlamydomonas cienkowskii 22/l


Blue-green filament 102/l Microcystis sp. 122/l Microcystis aeruginosa 22/l

Chroococcus turigidus 22/l Oscillatoria limnetica 243/l Chroococcus minor 30/l

Chroococcus minor 012/l Oscillatoria limosa 011/l Oscillatoria subbrevis 30/l

Microcystis aeruginosa 023/l Anabaena sp. 412/l Westiellopsis prolifica 42/l

Gloeocapsa aeruginosa 22 /l Oscillatoria subbrevis 412/l

Oscillatoria subbrevis 22/l Microcystis aergenasa 231/l

Oscillatoria perornata 30/l Oscillatoria perornata 304/l

Oscillatoria tenuis 412/l

Merismopedia elegans 011/l

P a n d o r i n a m o r u m

011/ l





Nitzschia gracilis 121/l Cymbella affinis 304/l Nitzschia sigma 121/l

Cymbella affinis 121/l C y m b e l l a t u m i d a

011/ l


Fragilaria virescens 21/l Navicula halophila 122/l Cymbella affinis 121/l

Cyclotella meneghiniana 034/l Syndra acus 122/l Navicula schroeteri 21/l

Rhoicosphenia curvata 21/l Nitzschia ignorata 011/l Cyclotella meneghiniana 21/l

Cocconeis placentula 21/l Nitzschia intermedia 412/l Gomphonema olivaceum 21/l

Nitzschia intermedia 121/l Nitzschia linearis 231/l Cyclotella comata 21/l

Stauroneis sp. 121/l Cocconeis placentula 231/l Melosira granulata 21/l

Cyclotella comata 21/l Diatoma elongatum 122/l Navicula radiosa 121/l

Navicula schroeteri 121/l Rhoicosphenia curvata 122/l Gyrosigma sp. 21/l

Nitzschia sigma 121/l S t e p h a n o d i s c u s s p .

011/ l

Nitzschia linearis 121/l Fragilaria construens 232/l

Nitzschia dissipate 21/l G o m p h o n e m a o l i v a c e u m 011/ l




Al-Wathba Station: May 1511

River intake Cell/l




Chlamydomonas sp. 011/l Chlorella vulgaris 0113/l Chlorella vulgaris 222/l

Chlorella vulgaris 304/l Oedogonium crassum 234/l Mougeotia sp. 102/l

Chlorella ellipsoidea 30/l Chlamydomonas sp. 430/l Scenedesmus quadricauda

023/ l

Kirchneriella subsolitaria 442/l Kirchneriella subsolitaria 22/l

Scenedesmus dimorphous 122/l

Monoraphidium contortum 102/l

Oedogonium sp. 22/l


Chroococcus minor 210/l Blue-green filament 022/l Nostoc carneum 30/l

Microcystis sp. 30/l Lyngbya gardneri 0113/l Oscillatoria subbrevis 102/l

Oscillatoria subbrevis 334/l Oscillatoria tenuis 102/l Oscillatoria limnetica 24/l

Oscillatoria tenuis 023/l Oscillatoria limnetica 2022/l Chroococcus minor 22/l

Oscillatoria limnetica 1102/l Oscillatoria formosa 1222/l Microcystis aeruginosa 30/l

Lyngbya connectens 330/l Oscillatoria subbrevis 4121/l Westiellopsis prolifica 33/l

Microcystis aeruginosa 30/l Microcystis aeruginosa 122/l

Westiellopsis prolifica 202/l Chroococcus minor 4121/l


Nostoc carneum 1222/l



Cyclotella meneghiniana 021/l Diatoma elongatum 0113/l Stephanodiscus sp. 20/l

Cocconeis plasentula 121/l Nitzschia linearis 122 /l Cocconeis plasentula 20/l

Nitzschia linearis 122/l S u r i r e l l a o v a l i s

4121/ l


Gomphonema angustatum121/l Cyclotella meneghiniana 1222/l Fragilaria construens 20/l

Pinnularia globiceps 122/l Cyclotella comata 0113/l Nitzschia sigma 022/l

Navicula radiosa 22/l Cymbella affinis 0113/l Cyclotella comata 100/l

Cymbella affinis 122/l Fragilaria virescens 22/l Nitzschia linearis 31/l

Melosira granulata 121/l P i n n u l a r i a l e p t o s o m a

4121/ l

Fragilaria virescens 100/l

Fragilaria virescens 121/l Gomphonema acuminatum0113/l Pinnularia globiceps 332/l

Nitzschia dissipate 121/l Amphora holsatica 0113 /l Cyclotella meneghiniana 032/l

Navicula schroeteri 1222/l Cymbella affinis 100/l

Navicula halophila 0113/l Syndra acus 122/l

Navicula trivialis 4121/l Diatoma elongatum 20/l

Navicula mutica 4121/l

Gomphonema lanceolatum30/l

Al-Rasheed Station: May 1511

River intake Cell/l




Chlamydomonas cienkowskii 01/l Monoraphidium sp. 1222/l Mougeotia scalaris 023/l

Mougeotia scalaris 122/l Chlorella vulgaris 12222/l Chlorella vulgaris 122/l

Chlorella vulgaris 24/l Chlamydomonas sp. 1222/l Chlamydomonas cienkowskii 01/l

Cosmarium sp. 1222/l


Blue-green filaments 1102/l Blue-green filament 1222/l/l B l u e - g r e e n f i l a m e n t s

01/ l

Westiellopsis prolifica 444/ l Oscillatoria princeps 4121/l Chroococcus minor 41/l

Microcystis aeruginosa 20/l O s c i l l a t o r i a f o r m o s a

0113/ l

Microcystis aeruginosa 40/l

Chroococcus minor 01/l Oscillatoria limosa 3121/l Oscillatoria limnetica 102/l

Oscil latoria l imosa 30/ l Oscillatoria subbrevis 3002/l Oscillatoria subbrevis 302/l

Oscillatoria limnetica 1132/l Oscillatoria limnetica 2022/l Oscillatoria princeps 1121/l

Westiellopsis prolifica 1421/l Oscillatoria formosa 013/l


Lyngbya gardneri 0223/l


202/ l



Melosira granulata 223/l Nitzschia sigma 4122/l Diatoma elongatum 322/l

Cocconeis plasentula 421/l Navicula neoventricosa 4121/l Nitzschia palea 31/l

Rhoicosphenia curvata 420/l Nitzschia linearis 0113/l Cyclotella meneghiniana 100/l

Cyclotella meneghiniana 320/l Nitzschia acicularis 4121/l Nitzschia intermedia 22/l

Amphora normani 122/l Surirella ovata 4121/l Gyrosigma attenuatum 100/l

Pinnularia gracillima 121/l M a s t o g l o i a s m e t h i i

0113/ l Melosira granulata 212/l

Cyclotella comata 122/l Navicula brekkaensis 1222/l Navicula cryptocephala 20/l

Nitzschia sigmoidea 420/l Navicula radiosa 1223/l Cyclotella comata 22/l

Diatoma elongatum 420/l Cymbella affinis 0122/l Stephanodiscus sp. 31/l

Nitzschia dissipate 122/l Cocconeis plasentula 4121/l Syndra tabulata 022/l

Syndra tabulata 123/l G o m p h o n e m a

a c u m i n a t u m4121/ l Cymbella affinis 31/l

Nitzschia umbonata 22/l Gyrosigma sp. 0113/l Cocconeis plasentula 20/l

Nitzschia intermedia 121/l Pinnularia leptosoma 2022/l Nitzschia sigmoidea 100/l

Syndra acus 122/l Cymbella caespitosa 1222/l Pinnularia gracillima 22/l

Gyrosigma attenuatum 320/l Amphora commutata 0113/l

Gomphonema acuminatum 02/1 Rhoicosphenia curvata 4121/l

Cymbella affinis 122/l Nitzschia dissipate 0113/l

Pinnularia borealis 021/l Diatoma elongatum 0113 /l

Nitzschia closterium 22/l Syndra acus 2022/l

Cyclotella meneghiniana1222/l

S. Dijla Station: May 1511

River intake Cell/l





Chlorella vulgaris 223/l Chlamydomonas cienkowskii 0113/l Chlorella ellipsoidea 32/l

Chlorella ellipsoidea 243/l Mougeotia scalaris 32/l



Monoraphidium contortum 01/l



Microcystis aeruginosa 24/l Nostoc carneum 0113/l Chroococcus minor 32/l

Aphanizomenon sp. 01/l Lyngbya connectens 2022/l Microcystis aeruginosa 24/l

Chroococcus minor 322/l Westiellopsis prolifica 222/l Oscillatoria limnetica 01/l

Oscillatoria limnetica 1001/l Chroococcus minor 0113/l Oscillatoria subbrevis 01/l

Oscillatoria formosa 021/l Chroococcus turigidus 4121/l Westiellopsis prolifica 133/l

Westiellopsis prolifica 422/l Spirulina laxa 0113/l

Oscillatoria perornata 3002/l

Oscillatoria formosa 4121/l

Oscillatoria subbrevis 0113/l

Oscillatoria tenuis 4121/l

Oscillatoria limnetica 0113/l Oscillatoria ornata 4121/l

Anabaena sp. 1222/l Microcystis aeruginosa 20/l


Nitzschia dissipate 22/l Nitzschia dissipate 3002/l Cyclotella meneghiniana123/l

Diatoma elongatum 22/l Nitzschia acicularis 3002/l Melosira granulata 123/l

Syndra tabulata 22/l Nitzschia linearis 4121/l C y c l o t e l l a c o m a t a

100/ l

Mastogloia elliptica 22/l Gyrosigma attenuatum 0113/l Gomphonema gracile 31/l Cyclotella ocellata 021/l Navicula radiosa 0113 /l Cocconeis plasentulal 31/l

Navicula pusilla 121/l Cymbella affinis 2022/l Gomphonema acuminatum 31/l

Achnanthes delicatula 22/l Diatoma elongatum 4121/l Cymbella affinis 31/l

Cyclotella meneghiniana 122/l Pinnularia borealis 4121/l

Melosira granulata 22/l Cocconeis plasentula 2322/l

Cyclotella comata 122/l Mastogloia elliptica 2022/l

Pinnularia borealis 320/l Gomphonema acuminatum 2022/l

Achnanthes microcephala 122/l Cyclotella meneghiniana 0113/l

Cymbella affinis 22/l Cymbella tumida 2022/l

Navicula grimmei 121/l Navicula brekkaensis 3002/l

http://www.google.iq/search?q=Aphanizomenon&spell=1&sa=X&ei=1DcGUvaPJsKlO8LfgNgF&ved=0CCMQvwUoAA&biw=1252&bih=572

Rhoicosphenia curvata 22/l C y c l o t e l l a c o m a t a

1222/ l

Nitzschia sigmoidea 122/l Rhoicosphenia curvata 4121/l

Amphora ovalis 3002/l

Al-Wathba Station: June 1511

River intake Cell/l




Chlorella vulgaris 011/l Chlorella vulgaris 1222/l Chlorella vulgaris 322/l

Cladophora crispate 102/l Ch la myd o mo n a s c i en kowsk i i

102/ l

Pediastrum simplex 22/l




Chroococcus minor 30/l Lyngbya lagerheimii 4121/l Tetraedron minimum 30/l

Microcystis aeruginosa 011/l Nostoc carneum 4121/l Microcystis aeruginosa 30/l

Oscillatoria subbrevis 222/l Oscillatoria formosa 2322/l Oscillatoria limnetica 22/l

Oscillatoria limnetica 322/l Oscillatoria subbrevis 14230/l Gloeocapsa aeruginosa 30/l Oscillatoria princeps 102/l Oscillatoria tenuis 13222/l Westiellopsis prolifica 22/l

Anabaena sp. 011/l Oscillatoria limnetica 12222/l

Lyngbya connectens 102/l Microcystis aeruginosa 4121/l Phormidium tenue 442 /l Anabaena sp. 4121/l

Aphanocapsa endophytica 022/l Chroococcus minor 2213/l

Gloeocapsa aeruginosa 122/l Westiellopsis prolifica 1422/l


Nitzschia dissipate 31/l Navicula radiosa 1222/l Melosira granulata 140/l

Gomphonema angustatum 31/l Cyclotella meneghiniana 0113/l Bacillaria paxillifer 41/l

Cymbella affinis 31/l Nitzschia linearis 0113/l Cyclotella comata 02/l

Cyclotella meneghiniana 032/l Diatoma elongatum 1222/l Diatoma elongatum 12/l

Rhoicosphenia curvata 31/l Diatoma vulgare 4121/l Stephanodiscus sp. 41/l

Melosira granulata 210/l Cocconeis plasentula 4121/l Amphora veneta 2/l

Bacillaria paxillifer 023/l Pinnularia acuminata 4121/l Syndra tabulata 02/l

Diatoma elongatum 100/l Nitzschia dissipate 0113/l Gomphonema angustatum 14/l

Stephanodiscus sp. 023/l Cymbella affinis 1222/l Cyclotella meneghiniana 32/l

Syndra tabulate 023/l Navicula schroeteri 1222/l Pinnularia acuminata 12/l

Amphora veneta 023/l Rhoicosphenia curvata 2430/l Nitzschia sigmoidea 3/l

Melosira granulata 4121/l Cocconeis plasentula 00/l

Gomphonema olivaceum 4121/l Rhoicosphenia curvata 3/l Gyrosigma attenuatum 3/l



Al-Rasheed Station: June 1511

River intake Cell/l




Chlamydomonas cienkowskii 22/l M o n o r a p h i d i u m s p .

4121/ l



Chlorella vulgaris 304/l Chlamydomonas sp. 1222/l Chlamydomonas cienkowskii 01/l

Oedogonium capillare 30/l Scenedesmus dimorphus 4121/l Oedogonium capillare 30/l

Scenedesmus dimorphus 023/l

Monoraphidium sp. 22/l


Blue-green filaments 102/l Blue-green filament 12222/l Chroococcus minor 102/l

Oscillatoria subbrevis 22/l Oscillatoria princeps 1222/l Oscillatoria limnetica 102/l

Oscillatoria limnetica 102/l Oscillatoria formosa 4121/l Microcystis aeruginosa 102/l

Chroococcus minor 102/l Oscillatoria limnetica 2322/l Lyngbya spirulinoides 30/l

Microcystis aeruginosa 22/l Oscillatoria subbrevis 12214/l Westiellopsis prolifica 104/l

Nostoc lincka 22/l Chroococcus minor 0113/l

Anabaena sp. 22/l Haematococcus lacustris 0113/l

Lyngbya spirulinoides 102/l Spirulina major 02422/l


Anabaena sp. 0113/l



Lyngbya spirulinoides 4012/l


Cymbella affinis 320/l Nitzschia sigma 4134/l Nitzschia sigma 024/l

Nitzschia sigma 224/l Navicula neoventricosa 1222/l Bacillaria paxillifer 024/l

Stephanodiscus sp. 421/l Nitzschia linearis 0113/l Navicula radiosa 22/l

Diatoma elongatum 121/l Nitzschia acicularis 4122/l Melosira granulata 222/l

Diatoma vulgare 320/l Surirella ovata 4041/l Cymbella affinis 002/l

Amphora veneta 122/l Mastogloia smethii 0113/l Nitzschia gracilis 221/l

Melosira granulata 1222/l Navicula brekkaensis 1222/l Gyrosigma attenuatum 221/l

Bacillaria paxillifer 320/l Navicula radiosa 4043/l

Cocconeis placentula 121/l Cymbella affinis 41222/l

Gyrosigma attenuatum 122/l Cocconeis plasentula 4121/l

Gomphonema acuminatum 2022/l

Gyrosigma sp. 4143/l

Pinnularia leptosoma 4121/l

Cymbella caespitosa 1222/l

Amphora commutata 0113/l




Syndra acus 2022/l

Cyclotella meneghiniana 1222/l

S. Dijla Station: June 1511

River intake Cell/l




Chlorella vulgaris 222/l Chlamydomonas c ienkowski i

403/ l Mougeotia scalaris 30/l

Chlamydomonas cienkowskii 22/l Oedogonium capillare 104/l Chlorella vulgaris 022/l

Mougeotia scalaris 102/l Chlorella vulgaris 403/l Chlamydomonas c ienkowski i

22/ l



Blue-green filament 022/l Oscillatoria limnetica 102/l Blue-green filament 22/l l

Microcystis aeruginosa 023/l Oscillatoria subbrevis 403/l Chroococcus minor 102/l

Chroococcus minor 122/l Oscillatoria formosa 140/l Microcystis aeruginosa 011/l

Westiellopsis prolifica 000/ l O s c i l l a t o r i a t e n u i s

234/ l


Oscillatoria lmosa 403/l Oscillatoria limnetica 02/l

Lyngbya connectens 304/l






Nitzschia linearis 040/l Cyclotella meneghiniana 224/l Nitzschia gracilis 122/l

Melosira granulata 340/l Surirella ovata 122/l Cymbella aspera 22/l

Cocconeis plasentula 122/l Fragilaria virescens 043/l Nitzschia dissipate 121/l

Navicula radiosa 032/l Fragilaria construens 130/l Nitzschia linearis 22/l

Nitzschia dissipate 101/l Diatoma elongatum 410/l Navicula radiosa 124/l

Diatoma elongatum 403/l Nitzschia linearis 022/l Diatoma elongatum 122/l

Cyclotella comata 014/l Syndra tabulate 234/l Surirella ovata 22/l

Fragilaria intermedia 302/l Rhoicosphenia curvata 242/l Cocconeis plasentula 22/l

Bacillaria paxillifer 034/l Navicula radiosa 243/l Fragilaria intermedia 224/l

Cyclotella meneghiniana 121/l Cymbella affinis 342/l Bacillaria paxillifer 22/l

Melosira granulata 034/l Navicula schroeteri 112/l Cyclotella meneghiniana 022/l

Rhoicosphenia curvata 004/l Gomphonema gracile 130/l Melosira granulata 021/l

Cocconeis placentula 20/l Rhoicosphenia curvata 22/l Cymbella gracilis 22/l

Amphora ovalis 22/l

Al-Wathba Station: July 1511

River intake Cell/l




Chlorella vulgaris 022/l Chlorella vulgaris 1222/l Chlorella vulgaris 221/l

Scenedesmus dimorphus 022/l Scenedesmus dimorphus 4121/l Scenedesmus dimorphus 442/l

Pediastrum simplex 011/l Pediastrum simplex 30/l

Pediastrum duplex 30/l Pediastrum duplex 30/l

Eremosphaera viridis 30/l


Blue-green filament 022/l Nostoc carneum 3404/l Blue-green filament 102/l

Oscillatoria limnetica 102/l Lyngbya lagerheimii 4121/l Oscillatoria limnetica 22/l

Oscillatoria subbrevis 22/l Oscillatoria subbrevis 12220/l Oscillatoria subbrevis 22/l

Chroococcus minor 22/l Oscillatoria formosa 2222/l Oscillatoria formosa 102/l

Microcystis aeruginosa 442/l O s c i l l a t o r i a t e n u i s

12340/ l

Nostoc lincka 30/l

Westiellopsis prolifica 04/l Oscillatoria princeps 1322/l Microcystis aeruginosa 42/l

Oscillatoria limnetica 12001/l

Microcystis aergenasa 3011/l

Anabaena sp. 4121/l


Haematococcus lacustris 0113/l



Melosira granulata 12232/l Navicula radiosa 1222/l Syndra tabulate 002/l

Diatoma elongatum 422/l Cyclotella meneghiniana 4010/l Melosira granulata 2432/l

Fragilaria intermedia 1142/l Nitzschia linearis 4014/l Fragilaria intermedia 422/l

Cyclotella meneghiniana 422/l Diatoma elongatum 1222/l Nitzschia longissima 22/l

Syndra tabulata 2012/l Diatoma vulgare 4121/l Diatoma elongatum 114/l

Nitzschia palea 114/l Cocconeis plasentulal 4121/l Cocconeis placentula 114/l

Fragilaria construens 2432/l Pinnularia acuminata 4121/l Navicula radiosa 002/l

Navicula schroeteri 0202/l Nitzschia dissipate 0113/l Mastogloia smithii. 22/l Cymbella affinis 114/l Cymbella affinis 1222/l Gyrosigma attenuatum 114/l

Diatoma vulgare 121/l Navicula schroeteri 1222/l

Syndra tabulate 0202/l Rhoicosphenia curvata 2430/l




Mastoglaoi smethii 0113 /l

Al-Rasheed Station: July 1511

River intake Cell/l




Chlorella vulgaeis 30/l Monoraphidium sp. 4121/l Monoraphidium contortum 22/l

Mougeotia scalaris 102/l Chlorella vulgaris 4121/l C h l o r e l l a v u l g a r i s

011/ l

Chlamydomonas angulosa 22/l Chlamydomonas sp. 1222/l Kirchneriella obesa 30/l Scenedesmus dimorphus 4121/l Actinastrum gracilmum 22/l

Cosmarium sp 30/l


Blue-green filament 023/l B l u e - g r e e n f i l a m e n t

022/ l Blue-green filament 30/l

Lyngbya lagerheimii 22/l Lyngbya gardneri 0113/l Chroococcus minor 30/l

Oscillatoria subbrevis 30/l Oscillatoria tenuis 102/l Oscillatoria subbrevis 30/l

Oscillatoria limnetica 011/l Oscillatoria limnetica 12221/l Oscillatoria formosa 30/l

Oscillatoria formosa 22/l Oscillatoria formosa 1222/l Oscillatoria limnetica 30/l

Microcystis aeruginosa 30/l Oscillatoria subbrevis 4001/l Oscillatoria tenuis 122/l

Haematococcus lacustris 30/l Microcystis aeruginosa 4122/l Chroococcus minor 0121/l

Westiellopsis prolifica 34/l Chroococcus minor 2213/l C h r o o c o c c u s t u i r g i d u s

202/ l

Haematococcus lacustri 0113/l Westiellopsis prolifica 04/l Chroococcus turigidus 12021/l




Nitzschia longissima 122/l D i a t o m a e l o n g a t u m

0413/ l


Rhoicosphenia urvata 122/l Nitzschia linearis 122/l Nitzschia linearis 122/l

Melosira granulata 0021/l Surirella ovalis 4021/l Cymbella affinis 122/l

Syndra ulna 220/l Cyclotella meneghiniana1222/l Anomoeoneis vitrea 122/l

Nitzschia palea 22/l Cyclotella comata 4033/l Syndra acus 021/l

Cymbella affinis 122/l Cymbella affinis 0113/l Nitzschia multiseries 122/l

Cyclotella meneghiniana 22/l Mastogloia smethii 0113/l Nitzschia longissima 122/l

Anomoeoneis vitrea 421/l Navicula brekkaensis 1222/l Cyclotella meneghiniana 22/l

Diatoma elongatum 420/l Navicula radiosa 4223/l Diatoma elongatum 121/l

Fragilaria virescens 021/l Cymbella affinis 4212/l


S. Dijla Station: July 1511

River intake Cell/l





Chlamydomonas cienkowskii 30/l O e d o g o n i u m c a p i l l a r e

124/ l


Monoraphidium contortum 22/l Chlorella vulgaris 303/l


P e d i a s t r u m d u p l e x

22/ l


Blue-green filament 30/l O s c i l l a t o r i a l i m n e t i c a

3102/ l

Blue-green filament 30/l

Nostoc carneum 30/l Oscillatoria subbrevis 1403/l Lyngbya connectens 22/l Chroococcus minor 023/l Oscillatoria formosa 1240/l Microcystis aeruginosa 102/l

Microcystis aeruginosa 22/l Oscillatoria tenuis 2134/l Chroococcus minor 30/l

Oscillatoria limnetica 22/l Oscillatoria curviceps 203/l Oscillatoria subbrevis 30/l

Oscillatoria tenuis 102/l Lyngbya connectens 204/l Westiellopsis prolifica 104/l

Chroococcus turigidus 202/l Microcystis aeruginosa 004/l

Westiellopsis prolifica 124/l Chroococcus minor 214/l




Melosira granulata 0421/l Cyclo t e l la m en egh i n iana

324/ l

Cyclotella meneghiniana 422/l

Cyclotella comata 021/l Surirella ovate 012/l Melosira granulata 1202/l

Cyclotella meneghiniana 021/l Fragilaria virescens 243/l Cocconeis plasentula 22/l

Syndra tabulata 122/l Fragilaria construens 140/l Nitzschia acicularis 22/l

Cymbella ventricosa 021/l Diatoma elongatum 010/l Rhoicosphenia curvata 22/l Diatoma elongatum 122/l Nitzschia linearis 422/l Syndra tabulata 22/l

Rhoicosphenia curvata 121/l Syndra tabulata 334/l Navicula radiosa 22/l

Nitzschia palea 122/l Rhoicosphenia curvata 342/l

Surirella ovate 420/l Navicula radiosa 343/l

Gomphonema tergestinum 122/l Cymbella affinis 442/l

Navicula anglica 122/l Navicula schroeteri 012/l

Nitzschia linearis 121/l Gomphonema gracile 120/l Bacillaria paxillifer 224/l Cocconeis placentula 20/l

Stephanodiscus sp. 122/l Cymbella gracilis 22/l

Gyrosigma attenuatum 22/l Amphora ovalis 22/l

Al-Wathba Station: August 1511

River intake Cell/l




Chlorella vulgaris 022/l Chlorella vulgaris 1222/l Scenedesmus dimorphus 442/l

Chlorella ellipsoidea 322/l Pediastrum simplex 222/l

Chlamydomonas sp. 30/l Mougeotia scalaris 30/l

C o e l a s t r u m m i c r o p o r u m

102/ l

Scenedesmus quadricauda

304/ l



Blue-green filament 102/l Blue-green filament 01130/l Microcystis aergenasa 102/l

Microcystis aergenasa 422/l Lyngbya lagerheimii 4121/l Anabaena sp. 102/l

Chroococcus minor 122/l Nostoc carneum 4122/l Oscillatoria subbrevis 304/l

Nostoc carneum 22/l Oscillatoria formosa 2322/l Oscillatoria limnetica 322/l

Lyngbya spirulinoides 22/l Oscillatoria subbrevis 14230/l Oscillatoria princeps 011/l

Oscillatoria limnetica 102/l Oscillatoria tenuis 13222/l Oscillatoria formosa 023/l

Westiellopsis prolifica 104/l Oscillatoria limnetica 12222/l Westiellopsis prolifica 104/l

Microcystis aergenasa 4121/l Nostoc carneum 411/l

Anabaena sp. 4121/l

C h r o o c o c c u s m i n o r

2411/ l



Achnanthes affinis 30/l Navicula radiosa 1222/l Melosira granulata 022/l

Melosira granulata 12221/l Cyclotella meneghiniana 0113/l Nitzschia longissima 30/l

Cyclotella meneghiniana 222/l Nitzschia linearis 0113/l Bacillaria paxillifer 304/l

Cyclotella comata 222/l Diatoma elongatum 1222/l Syndra ulna 222/l

Syndra ulna 1022/l Diatoma vulgare 4121/l Caloneis permagna 22/l

Stephanodiscus sp. 232/l Cocconeis plasentula 4121/l Rhoicosphenia curvata 011/l Fragilaria construens 1224/l Pinnularia acuminata 4121/l Diatoma elongatum 102/l

Diatoma elongatum 1222/l Nitzschia dissipate 0113/l Syndra acus 232/l

Cocconeis plasentula 1424/l Cymbella affinis 1222/l Cyclotella comata 022/l

Caloneis permagna 243/l Navicula schroeteri 1222/l Stephanodiscus sp. 30/l

Stauroneis anceps 322/l Rhoicosphenia curvata 2430/l Cymbella affinis 102/l

Melosira granulata 4121/l Fragilaria construens 122/l


Al-Rasheed Station: August 1511

River intake Cell/l




Scenedesmus quadricauda 440/l Scenedesmus dimorphus 4121/l Chlorella vulgaris 102/l

Chlorella vulgaris 221/l Chlorella vulgaris 4121/l Pediastrum simplex 30/l



Blue-green filement 040/l Blue-green filament 12222/l Blue-green filament 102/l

Oscillatoria limnetica 023/l M i c r o c y s t i s f l o s - a q u a e

1440/ / l


Oscillatoria subbrevis 122/l Oscillatoria subbrevis 12214/l Anabaena sp. 30/l

Microcystis flos-aquae 011/l Oscillatoria princeps 1222/l Oscillatoria limnetica 122/l

Westiellopsis prolifica 4404/l Oscillatoria formosa 4121/l Westiellopsis prolifica 4404/l

Chroococcus minor 22/l Oscillatoria limnetica 2322/l Microcystis flos-aquae 011/l

Microcystis aeruginosa 42/l Chroococcus minor 0113/l Microcystis aeruginosa 42/l



Lyngbya lagerheimii 4302/l



Gyrosigma attenuatum 034/l Nitzschia sigma 4121/l Melosira granulata 3202/l

Rhoicosphenia curvata 124/l Navicula neoventricosa 1222/l Achnanthes hungarica 122/l

Fragilaria intermedia 232/l Nitzschia linearis 0113/l Pinnularia gracillima 24/l

Nitzschia gracilis 114/l Nitzschia acicularis 4121/l Diatoma elongatum 422/l

Melosira granulate 22/l Surirella ovata 4121/l Cyclotella meneghiniana 422/l

Diatoma vulgare 442/l Mastoglaoi smethii 0113/l Syndra ulna 021/l Navicula radiosa 22/l Navicula brekkaensis 1222/l Navicula radiosa 413/l

Navicula radiosa 4121/l Navicula schroeteri 122/l



Gomphonema acuminatum 2022/l Gyrosigma sp. 4121/l

S. Dijla Station: August 1511

River intake Cell/l




Ulothrix subconstrica 1023/l Chlamydomonas cienkowskii 403/l Ulothrix subconstricta 421/l

Pediastrum simplex 124/l Oedogonium capillare 104/l

Pediastrum duplex 30/l Chlorella vulgaris 403/l


Blue-green filament 122/l Oscillatoria limnetica 102/l Microcystis aeruginosa 442/l

Microcystis aeruginosa 42/l Oscillatoria subbrevis 403/l Oscillatoria limnetica 322/l

Microcystis flos-aquae 112/l Oscillatoria formosa 140/l Chroococcus minor 421/l

Chroococcus minor 422/l O s c i l l a t o r i a t e n u i s

234/ l

Chroococcus turigidos 22/l

Oscillatoria limnetica 442/l Oscillatoria lmosa 403/l Westiellopsis prolifica 404/l

Oscillatoria capillare 122/l Lyngbya connectens 304/l Microcystis flos-aquae 111/l

Westiellopsis prolifica 422/l Anabaena sp. 4121/l



Microcystis flos-aquae 441/l


Stephanodiscus sp. 1022/l Cyclotella meneghiniana 224/l Melosira granulata 223/l

Fragilaria intermedia 224/l Surirella ovata 122/l Stephanodiscus sp. 121/l

Navicula digitoradiata 22/l Fragilaria virescens 043/l Melosira dickiei 421/l

Fragilaria construens 22/l Fragilaria construens 130/l Stephanodiscus sp. 22/l

Melosira granulata 223/l Diatoma elongatum 410/l Nitzschia subcapitellata 22/l

Melosira dickiei 122/l Nitzschia linearis 022/l Fragilaria construens 421/l

Nitzschia dubia 121/l Syndra tabulata 234/l Fragilaria product 021/l

Tabellaria flocculosa 22/l Rhoicosphenia curvata 242/l Comphonema gracile 021/l

Cocconeis plasentula 121/l Gyrosigma attenuatum 22/l

Gyrosigma attenuatum 22/l

Appendix 1 Table 1: Statystical analysis of physiochemical parameters between

stations during study period.

Parameters

Periods

1

0

4

3

Stasions

Mean±SE

(T-test)

Temperature

S. Dijla

12±0.23

(2.12)

13±2.22

(2.42)

02±0.22

(2.42)

02.44±2.22

(2.02)

Al-

Wathba

12±4.12

(2.22)

14.22±2.22

(1.22)

03±1.24

(2.24)

02±1.22

(1.22)

Al-

Rasheed

12.22±0.22

(2.22)

12±1.12

(1.22)

02.22±1.32

(2.02)

02±1.24

(2.0)

Turbidity

S. Dijla

12.44±2.14

(2.22)

04.44±2.22

(2.04)

22.44±04.22

(2.23)

30±0.21

(2.24)

Al-

Wathba

04.22±2.22

(2.23)

02.22±2.44

(2.24)

22±02.22

(1.02)

34.44±0.24

(0.02)

Al-

Rasheed

04.44±2.22

(2.20)

02±2.42

(2.02)

22±04.24

(2.2)

22±1.12

(0.22)

pH

S. Dijla

2.2222.21

(2.24**)

2.2222.21

(1.24)

222.21

(2.22**)

2.2222.21

(2.24)

Al-

Wathba

2.20±2.00

(0.22*)

2.14±2.22

(1.22)

2.12± 2.20

(0.23)

2.23±2.22

(2.22)

Al-

Rasheed

2.22±2.23

(2.32)

2.24±2.22

(1.1)

2.2222.22

(2.23)

2.2222.22

(2.300)

Conductivity

S. Dijla

222232

(0.22)

230±00

(1.20)

233203

(2.22)

222213

(2.1**)

Al-

Wathba

222±22

(0.42)

211±20

(1.02)

222± 00

(1.22)

222±02

(3.24*)

Al-

Rasheed

224±22

(2.42)

212±22

(2.11)

222242

(2.21)

223234

(2.24)

Ca+0

S. Dijla

20±4.32

(3.22**)

20.222.22

(1.22*)

2020.32

(0.30)

2020.32

(10.22**)

Al-

Wathba

123±2.22

(2.122)

21.2±11.02

(2.23)

24± 4.23

(2.02)

110±4.22

(2.20)

Al-

Rasheed

120±2.12

(3.11)

20.02±11.22

(1.22)

2222.22

(0.11)

12223.22

(2.20)

Mg+0

S. Dijla

02.22±1.0

(0.12)

02.422.44

(2.32**)

02.422.22

(0.00)

22.421.32

(1.21)

Al-

Wathba

41.44±1.2

(2.42)

44.4±2.44

(1.23)

02± 1.22

(2.22)

0221.22

(1.12)

Al-

Rasheed

42.22±1.4

(0.04)

42.22±1.44

(2.2*)

0221.22

(1.42)

0222.22

(0.22)

NO0

S. Dijla

2.222±2.221

(3.03*)

2.222±2.220

(2.34)

2.222±2.221

(2.30)

2.222±2.222

(2.22*)

Al-

Wathba

2.223±2.221

(1.10)

2.222±2.224

(2.0)

2.222±2.223

(2.03)

2.223±2.221

(0.22)

Al-

Rasheed

2.222±2.221

(2.00)

2.21±2.221

(2.22)

2.21±2.221

(1.13)

2.222±2.222

(4.22*)

NO4

S. Dijla

2.32±2.22

(1.32)

2.23±2.22

(2.31)

1.11±.213

(2.34)

2.22±2.10

(2.23)

Al-

Wathba

2.22±2.13

(1.22*)

2.22±2.41

(2.22)

1.12±2.22

(2.22)

2.22±2.22

(2.22)

Al-

Rasheed

2.32±2.22

(2.12)

1.20±2.22

(1.20)

1.22±2.22

(2.22)

2.22±2.22

(1.12)

Silicate

S. Dijla

4.24±2.42

(1.21)

3.22±2.22

(1.23)

2.02±2.32

(0.2*)

2.22±2.22

(1.43)

Al-

Wathba

0.22±2.02

(1.32)

4.24±2.42

(2.21)

3.22±2.02

(0.22)

2.22±2.10

(2.30)

Al-

Rasheed

0.02±2.32

(0.23)

3.04±2.41

(1.12)

4.24±2.22

(3.2)

2.22±2.42

(1.30)


4. April, May and June. 3. July, August and September. * p≤ 2.22 ** p≤ 2.221

Table 1: Statystical analysis of physiochemical parameters between

months in studied stations.

Parameters

Stations

F-test


Temperature 13.23** 10.03** 12.04**

Turbidity 3.23* 3.02* 3.12*

pH 0.22 2.30* 2.22

Conductivity 0.43 3.12* 0.33

Ca+0

3.3* 2.42* 0.22

Mg+0

0.23 3.42* 4.22

NO0 2.20 1.22 0.42

NO4 2.23* 0.22 14.42**

Silicate 0.22 2.34* 2.01**

* p≤ 2.22 ** p≤ 2.221

Table 3: Statistical analysis for the effect of physiochemical parameters

on cyanobacterial total cell of count in studied stations.

Parameters

Stations

F-test


Temperature 2.22** 3.24* 14.41**

Turbidity 02.30** 2.42* 3.22*

pH 2.22 4.22 2.42

Conductivity 2.22 2.42 1.33

Ca++

2.22 2.23 0.22

Mg++

1.13 2.20** 0.20

NO0 1.13 1.02 1.43

NO4 2.42 2.33 2.22

Silicate 2.41 1.21 2.22

* p≤ 2.22 ** p≤ 2.221

Table 1: Statistical analysis of cyanobacterial total cell count from

different sites of stations during study period. 1: October, November and December 0: January, February and March.


* p≤ 2.22

Cyanophyta

Cell ×151 /ml

Periods

1

0

4

3

Stations

Mean±SE

(T-test)

River Intake

S. Dijla

2.22±2.21

(2.02)

2.22±2.21

(2.34)

2.13±2.24

(2.00)

2.12±2.24

(2.12*)

Al-

Wathba

2.22±2.20

(2.22)

2.22±2.21

(0.2)

2.14±2.21

(2.20)

2.02±2.22

(1.22)

Al-

Rasheed

2.22±2.21

(1.22)

2.22±2.11

(0.1)

2.12±2.24

(2.23)

2.43±2.23

(0.22)

Sedimentation

Tank

S. Dijla

2.22±2.24

(2.21)

2.22±2.23

(2.34)

2.24±2.21

(1.42*)

2.12±2.22

(2.22*)

Al-

Wathba

2.22±2.22

(2.4)

2.11±2.22

(2.22)

2.1±2.22

(2.02)

2.32±2.02

(2.22)

Al-

Rasheed

2.22±2.21

(2.2)

2.10±2.22

(2.22)

2.10±2.22

(1.22)

2.01±2.12

(2.2)

Attached

Algae

S. Dijla

2.1222.22

(2.02)

2.1222.22

(2.20*)

1.221.13

(2.22)

2.2222.31

(2.20*)

Al-

Wathba

2.04±2.12

(2.22)

2.43±2.02

(2.42)

4.22± 0.24

(2.22)

2.42±0.24

(2.24)

Al-

Rasheed

2.00±2.21

(2.44)

2.32±2.43

(2.2*)

3.0220.43

(1.23)

3.1221.23

(1.222)

Table 1: Numbers and percentage of phytoplankton species in the

studied stations.

Dijla Station

Al-Wathba Station

Al-Rashed Station

Bacillariophyta

Cyanophyta

Chlorophyta

Bacillariophyta

Cyanophyta

Chlorophyta

Bacillariophyta

Cyanophyta

Chlorophyta

Attached Algae

321

43.11

12.21

40.21

20.21

3.01

42.21

22.21

2.21

Sedimentation

Tank

321

02.21

03.41

22.01

04.21

121

24.31

41.31

12.01

River Intake

21.31

12.01

12.31

21.41

111

12.21

22.21

02.21

10.21

environmental and identification study of algae present in...

Documents