environmental mimics and the lvh type iva secretion system ... · infection and immunity, feb....

INFECTION AND IMMUNITY, Feb. 2007, p. 723–735 Vol. 75, No. 20019-9567/07/$08.00�0 doi:10.1128/IAI.00956-06Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Environmental Mimics and the Lvh Type IVA Secretion SystemContribute to Virulence-Related Phenotypes

of Legionella pneumophila�

Purnima Bandyopadhyay, Shuqing Liu,† Carolina B. Gabbai,‡Zeah Venitelli,§ and Howard M. Steinman*

Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York

Received 15 June 2006/Returned for modification 26 July 2006/Accepted 26 October 2006

Legionella pneumophila, the causative organism of Legionnaires’ disease, is a fresh-water bacterium andintracellular parasite of amoebae. This study examined the effects of incubation in water and amoeba encyst-ment on L. pneumophila strain JR32 and null mutants in dot/icm genes encoding a type IVB secretion systemrequired for entry, delayed acidification of L. pneumophila-containing phagosomes, and intracellular multipli-cation when stationary-phase bacteria infect amoebae and macrophages. Following incubation of stationary-phase cultures in water, mutants in dotA and dotB, essential for function of the type IVB secretion system,exhibited entry and delay of phagosome acidification comparable to that of strain JR32. Following encystmentin Acanthamoeba castellanii and reversion of cysts to amoeba trophozoites, dotA and dotB mutants exhibitedintracellular multiplication in amoebae. The L. pneumophila Lvh locus, encoding a type IVA secretion systemhomologous to that in Agrobacterium tumefaciens, was required for restoration of entry and intracellularmultiplication in dot/icm mutants following incubation in water and amoeba encystment and was required fordelay of phagosome acidification in strain JR32. These data support a model in which the Dot/Icm type IVBsecretion system is conditionally rather than absolutely required for L. pneumophila virulence-related pheno-types. The data suggest that the Lvh type IVA secretion system, previously thought to be dispensable, isinvolved in virulence-related phenotypes under conditions mimicking the spread of Legionnaires’ disease fromenvironmental niches. Since environmental amoebae are implicated as reservoirs for an increasing number ofenvironmental pathogens and for drug-resistant bacteria, the environmental mimics developed here may beuseful in virulence studies of other pathogens.

Legionnaires’ disease is a potentially fatal pneumonia ac-quired by inhalation of aerosols containing Legionella pneumo-phila from standing-water reservoirs of man-made origin (10,11, 47). L. pneumophila, the causative organism (58), is a fresh-water bacterium capable of entry and intracellular multiplica-tion in aquatic amoebae (38, 39). In response to environmentalstress, amoebae containing internalized bacteria can form cyststhat resist killing by water purification treatment (32, 39, 49,70). In this fashion, L. pneumophila housed within amoebacysts is proposed to enter domestic water supplies. Subsequentaerosolization and inhalation of encysted bacteria by suscepti-ble persons is proposed to lead to Legionnaires’ disease viaentry, intracellular multiplication, and killing of alveolar mac-rophages by L. pneumophila.

Virulence genes in L. pneumophila have been identified byscreening for defective phenotypes following infection of mac-

rophages and amoebae with bacteria cultured to stationaryphase in rich medium. This approach identified mutants in thedot/icm (defective organelle trafficking/intracellular multiplica-tion) genes (9, 12, 72, 96). Based on homology of dot/icm genesto plasmid conjugation genes and to the virB/virD genes of typeIV secretion systems (T4SSs) found in Agrobacterium tumefa-ciens, Helicobacter pylori, and other bacterial species (15, 18,24, 65, 102), the dot/icm genes were proposed to encode a T4SS(98). The L. pneumophila dot/icm T4SS, also found in Coxiellaburnetii, was designated a type IVB secretion system (SS) andthe virB/virD T4SSs was designated type IVA SS, reflectingdifferent chromosomal organizations of the genes and the factthat only four of 25 L. pneumophila dot/icm genes showedhomology to the more widely distributed virB/virD genes (26,76, 82, 98).

The DotA membrane protein (9, 71) and DotB ATPase (81)are considered essential for function of the Dot/Icm T4SS.Mutants in dotA or dotB are defective in entry, delay of acid-ification of L. pneumophila-containing phagosomes, intracellu-lar multiplication, and cytotoxicity toward host cells when sta-tionary-phase cultures are used for infection of host cells (3,6–8, 43, 48, 50, 71, 80, 81, 99). On this basis, the Dot/Icm T4SSis proposed to be essential for these virulence-related pheno-types. The virulence-related substrates of the Dot/Icm T4SSare effector proteins made by L. pneumophila whose translo-cation into host cells is proposed to be required for delay ofacidification of the L. pneumophila-containing phagosome, in-tracellular multiplication, and cytotoxicity to the host. Func-

* Corresponding author. Mailing address: Department of Biochem-istry, Albert Einstein College of Medicine, 1300 Morris Park Avenue,Bronx, New York 10461. Phone: (718) 430-3010. Fax: (718) 430-8565.E-mail: [email protected].

† Present address: Center for Proteomics and Mass Spectrometry,School of Medicine, Case Western Reserve University, Cleveland, OH.

‡ Present address: Program in Molecular Biology, Weill GraduateSchool of Medical Sciences, Cornell University, New York, NY.

§ Present address: Department of Surgery, Gastric and MixedTumor Service, Memorial Sloan-Kettering Cancer Center, NewYork, NY.

� Published ahead of print on 13 November 2006.

723

on January 26, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

tions of DotA, DotB, and other Dot/Icm proteins and of theknown effector proteins have been recently reviewed (62, 76).

Since L. pneumophila is an environmental pathogen found inassociation with aquatic amoebae (38, 39, 70), the effects ofnutrient limitation and coculture with amoebae on virulence-related phenotypes have been studied frequently. Virulence-related phenotypes of L. pneumophila were enhanced in sta-tionary-phase compared to exponential-phase broth cultures(16) and following intracellular multiplication in amoebae (27,28). These observations led to current models for the role ofnutrient limitation in the induction of dot/icm genes (41, 42)and the role of regulatory networks in the transition of bacteriafrom an intracellular replicative form to a transmissive formcapable of invading new host cells (37, 63, 75). In these studies,L. pneumophila with wild-type dot/icm genes was used, andnutrient limitation was achieved by growth of bacterial culturesto postexponential or stationary phase in rich medium.

Our laboratory is studying how virulence-related phenotypesof dot/icm mutants can be enhanced by mimicking environ-mental niches of L. pneumophila. Since dot/icm mutants aregenerally defective in virulence-related phenotypes, this ap-proach has the potential to identify new virulence factors thatfunction in the absence of a Dot/Icm T4SS and thus are dot/icmindependent (6, 48). We previously reported that incubatingstationary-phase cultures of dotA or dotB mutants of strainJR32 in buffered saline reversed the defective entry of themutants, restoring entry to the level of strain JR32, and impli-cated a tetratricopeptide repeat-containing protein in restora-tion of entry (6). Those studies led to the hypothesis thatculture conditions mimicking environmental reservoirs for Le-gionnaires’ disease play a critical role in determining whetherdotA and dotB and, by implication, the Dot/Icm T4SS or Dot/

Icm-independent factors are required for virulence-relatedphenotypes.

Here, we describe studies testing that hypothesis using ex-posure to water as a mimic of the aquatic milieu of L. pneu-mophila and encystment in the environmental amoeba Acanth-amoeba castellanii. Our data support a model in which adefective Dot/Icm T4SS can be functionally replaced by theLvh T4SS in entry, delay of phagosome acidification, and in-tracellular multiplication phenotypes under conditions mim-icking aquatic and amoeba-encysted niches of L. pneumophila.

MATERIALS AND METHODS

Bacterial strains and culture conditions. All L. pneumophila mutants werederived from serotype 1 strain JR32 (72, 100) (Table 1). Legionella strains wererevived from �70°C storage on charcoal-N-(2-acetamido)-2-aminoethanesulfonicacid (ACES)-buffered (pH 6.9) yeast extract agar (CAYE) plates and thencultured in ACES-buffered (pH 6.9) yeast extract (AYE) broth (36, 46) tostationary phase, with an optical density at 600 nm of �2.7 (16). When required,chloramphenicol, hygromycin sulfate, and gentamicin sulfate were present at 5,100, and 10 �g/ml, respectively. Recombinant constructions used Escherichia colistrain DH5�, cultured in Luria-Bertani medium (84) with chloramphenicol,hygromycin sulfate, and gentamicin sulfate present at 25, 150, and 5 �g/ml,respectively. All cultures were incubated at 37°C with aeration unless otherwiseindicated. Bacterial viability was determined with the Live/Dead BacLight tech-nique (Molecular Probes, Invitrogen, Carlsbad, CA).

WS treatment. WS (water stress)-treated cultures were prepared from station-ary-phase cultures that were grown overnight at 30°C or 37°C in 5 ml of AYEbroth in a 16- by 150-mm glass culture tube on a rotary shaker at 30 to 55 rpm.After overnight growth, the culture was centrifuged for 10 min at 3,000 � g at4°C; the supernatant was aspirated, and the pellet was resuspended in 5 ml ofautoclaved distilled, deionized water and then incubated for 18 to 19 h in an 16-by 150-mm glass culture tube in a rotary at 30 to 55 rpm at the same temperatureas the AYE broth culture.

Amoebae and macrophage lines and culture conditions. A. castellanii (ATCC30234) was cultured at 28°C in peptone yeast extract glucose (PYG) mediumin 25-cm2 or 75-cm2 tissue culture flasks containing 10 ml or 20 ml of PYG,

TABLE 1. Strains and plasmids

Strain or plasmid Relevant phenotype or description Reference or source

StrainsJR32 Wild type; sodium-sensitive; Philadelphia-1 Smr r� m�; lvh� dot/icm� 72dotA (LELA 3138) JR32 dotA::Tn903dIIlacZ 72dotB (LELA 2883) JR32 dotB::Tn903dIIlacZ 72�lvh JR32 �lvh with Gmr cassette in place of lvh locus (GS-28G) 77�lvh dotA JR32 dotA::Tn903dII lacZ �lvh This study�lvh dotB (LELA2883-28) JR32 dotB::Tn903dII lacZ �lvh 77�lvh icmE JR32 icmE::Tn903dII lacZ �lvh 77�lvh icmT JR32 icmT::Tn903dII lacZ �lvh This studyicmE (LELA 4432) JR32 icmE::Tn903dII lacZ 72icmF (LELA 1275) JR32 icmF::Tn903dII lacZ 72icmG JR32 icmG::Km MW635 67icmQ (LELA 3463) JR32 icmQ::Tn903dII lacZ 72icmR JR32 icmR::Km GS3012 43icmS JR32 icmS::Km GS3001 78icmT (LELA 4086) JR32 icmT::Tn903dIIlacZ 72

PlasmidspGFP-Hygro Hygromycin resistant 6plvh� lvh complementation vector; entire lvh region in pMMB207�b; Cmr (pGS-VBD-32) 77pGFP Cm pGS-GFP-04; gfp in pMMB207 43pGS-VBD-28-Gm-GR Vector for replacing the lvh region with a Gmr cassette by allelic exchange 77pGS-lac-01 Promoterless lacZ vector based on pMMB207 103pGS-lac-01::lvhB2 pGS-lac-01 LacZ reporter plasmid for lvhB2 This studypGS-lac-01::2Bhvl pGS-lac-01 LacZ reporter plasmid with lvhB2 cloned in direction opposite to

promoterless lacZThis study

724 BANDYOPADHYAY ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

respectively, as described earlier (3, 6, 43, 80). The HL-60 human leukemicmonocyte cell line was maintained in RPMI 1640 medium supplemented with 2mM L-glutamine (6, 43, 80); the MH-S BALB/c mouse alveolar macrophage line(ATCC CRL-2019) was maintained in RPMI 1640 medium with 2 mM L-glu-tamine, 10 mM HEPES, 1 mM sodium pyruvate, 0.25% glucose, and 0.05 mM2-mercaptoethanol (56); and the J774 BALB/c mouse peritoneal macrophageline was maintained in RPMI 1640 medium with 2 mM L-glutamine (21). All cellculture media contained 10% heat-inactivated fetal bovine serum and penicillin-streptomycin (PenStrep; 5,000 U/ml). All cell cultures were maintained at 37°Cin a humidified atmosphere containing 5% CO2.

Preparation of macrophages from mouse bone marrow. Bone marrow mac-rophages (BMMs) of 11- to 12-week-old female A/J mice (Harlan, Indianapolis,IN) were prepared as previously described (88) and maintained at 37°C in 5%CO2. Bone marrow exudates were maintained in alpha minimal essential me-dium, 15% fetal bovine serum, and 10,000 U/ml colony-stimulating factor 1 for7 days; samples were then washed and incubated overnight in RPMI medium,10% fetal bovine serum, and 10,000 U/ml colony-stimulating factor 1 prior tointracellular multiplication, entry, and phagosome acidification experiments onthe following day.

Plasmids. Transformation of L. pneumophila with green fluorescent protein(GFP), lvh complementation, or lacZ fusion plasmids (Table 1) was accom-plished by natural competence (64, 92) or by electroporation (6).

Construction of �lvh null mutants. The �lvh mutation, in which the lvh locusis replaced by a Gmr cassette, was introduced into dotA and dotB mutants byallelic exchange using the same allelic exchange plasmid previously used toconstruct �lvh dotB and �lvh icmE double mutants (77). As described previously

(5, 77), individual Gmr transformants obtained following electroporation werestreaked on CAYE-gentamicin–2% sucrose plates and Gmr Sucr Cms coloniesscreened by PCR to identify the desired allelic exchange double mutant.

Immunofluorescence assay for entry of Legionella into A. castellanii and mac-rophages. Amoebae (5 � 106 cells in A. castellanii buffer) (6) or macrophages(1.5 � 106 cells in tissue culture medium) were added in 0.5-ml aliquots to12-mm diameter glass coverslips in 24-well microtiter dishes. After 1 (amoebae)or 2 (macrophages) h, cell monolayers were washed and infected with L. pneu-mophila in fresh A. castellanii buffer or tissue culture medium without PenStrepand then centrifuged at 700 � g for 10 min at 25°C. In any given experiment, atleast two coverslips were infected for each strain/culture condition, and datafrom replicate coverslips were in agreement. Entry experiments with amoebaewere performed at 28°C with L. pneumophila cultured at 37°C. Macrophage entryexperiments were performed at 37°C with L. pneumophila cultured at 37°C. After30 min and 1 h, respectively, amoeba and macrophage monolayers were washedwith 20% DPBS (Dulbecco’s phosphate-buffered saline), formaldehyde fixed,and stained as previously described (43) with the following modifications. Mono-layers were incubated with rabbit anti-L. pneumophila serotype 1 antibody (m-Tech, Atlanta, GA) and then with Cy3-conjugated donkey anti-rabbit immuno-globulin G (IgG) (Jackson ImmunoResearch Laboratories, Inc., West Grove,PA); coverslips were then inverted and mounted onto microscope slides using 1�phosphate-buffered saline (pH 7.4)–0.1 M n-propyl gallate in 50% glycerol.

Immunofluorescence assay for acidification of Legionella-containing phago-somes in macrophages. J774 macrophages were resuspended to a concentrationof 2 � 105 cells/ml in tissue culture medium, without PenStrep and containing a1:20,000 dilution of LysoTracker Red DND 99 (Molecular Probes, Invitrogen,

FIG. 1. Reversal of defective entry into amoebae and macrophages by WS treatment. Stationary phase (Stat) or WS-treated (WS) cultures ofthe indicated L. pneumophila strains were used to infect A. castellanii trophozoites (A), J774 mouse macrophages (B), or primary cultures of bonemarrow macrophages from A/J mice (C) at an MOI of 2 at 28°C (A) or 100 at 37°C (B and C). At 30 min (A and C) or 60 min (B) postinfection,samples were fixed and stained, and entry of GFP-expressing Legionella was quantified by epifluorescence microscopy. Means and standarddeviations are shown. The number of independent experiments, i.e., experiments performed on separate days in addition to the replicatesperformed on a given day, in which the effect of WS treatment on entry was shown is three for dotA and five for dotB in panel A; seven for dotA,six for dotB, and two for all other dot/icm mutants in panel B, and three for dotA and three for dotB in panel C.

VOL. 75, 2007 Lvh TYPE IVA SECRETION SYSTEM OF L. PNEUMOPHILA 725


.org/D

ownloaded from

http://iai.asm.org/

Carlsbad, CA) at a concentration of 1 mM in dimethyl sulfoxide(97), and 0.5-mlaliquots were put into wells of a 24-well tissue culture plate containing glasscoverslips. After 2 h at 37°C, cell monolayers were washed with DPBS andinfected with L. pneumophila that had been cultured at 37°C, resuspended intissue culture medium lacking PenStrep, and then centrifuged at 700 � g for 10min at 25°C. In any given experiment, at least two coverslips were infected foreach strain/culture condition, and data from replicate coverslips were in agree-ment. After 1 h at 37°C cell monolayers were washed with DPBS, fixed withformaldehyde, stained, and mounted as described above for assay of entry.Acidification of L. pneumophila-containing phagosomes was scored as the colo-calization of GFP fluorescence with LysoTracker Red fluorescence in macro-phages.

Assay of intracellular multiplication by titer of L. pneumophila. Monolayers ofA. castellanii were infected at 28°C with L. pneumophila cultured to stationaryphase or WS-treated at 30°C, and intracellular multiplication was monitored bythe titer of bacteria in aliquots removed from the A. castellanii buffer infectionmedium, as described previously (3, 6). For the titer of bacteria internalized inmacrophages, washed macrophage monolayers were lysed by the addition of 0.5ml of 0.1% saponin in water and incubation at room temperature for 20 min (53).Monolayers of HL-60-derived macrophages, MH-S macrophages, J774 macro-phages, or BMMs were infected at 37°C with L. pneumophila cultured at 37°Cand resuspended in tissue culture medium lacking PenStrep, and intracellularmultiplication was monitored by titer, as described previously (5, 80). For eachtime point, titers were determined for three aliquots, and the mean � standarddeviation was plotted. Infections were performed in 24-well microtiter platescontaining 0.5 ml of 2.5 �105 A. castellanii cells or macrophages per well. In anygiven experiment, at least two wells were infected for each strain/culture condi-tion, and data from replicate wells were in agreement.

Amoeba encystment and intracellular multiplication in amoeba trophozoites.L. pneumophila cells were grown to stationary phase in AYE broth at 30°C,incubated in distilled, deionized water for 19 h at 30°C as described for WStreatment above, and then added at a multiplicity of infection (MOI) of 10 toadherent A. castellanii in 20 ml of A. castellanii buffer in 75-cm2 tissue cultureflasks. After 30 min at 28°C, external bacteria were removed by washing themonolayer five times, each with 20 ml of A. castellanii buffer. Then, 20 ml of freshA. castellanii buffer was added, and the flask was incubated at 4°C for conversionof amoeba trophozoites to amoeba cysts (B. S. Fields, personal communication).Monitored microscopically, the conversion to cysts was complete within 60 min.After 21 h at 4°C the cysts were pelleted by centrifugation for 10 min at 3,000 �g at 4°C and resuspended in A. castellanii buffer to a concentration of 5 � 105

cysts/ml at room temperature, where conversion to trophozoites was complete in20 min. Aliquots of 0.5 ml were added to glass coverslips placed in wells of24-well tissue culture plates. After 1 h at 28°C the coverslips were washed threetimes each with 0.5 ml of A. castellanii buffer, 0.5 ml of fresh A. castellanii buffer

was added, and then aliquots were periodically removed for titer of triplicatealiquots of L. pneumophila on CAYE plates as described in the precedingsection. In any given experiment, at least two coverslips were infected for eachstrain/culture condition, and data from replicate coverslips were in agreement.

Microscopic analysis of intracellular multiplication after encystment in amoe-bae. For these experiments, L. pneumophila expressing GFP was used. L. pneu-mophila culturing, A. castellanii infection, cyst formation, and conversion totrophozoites were performed as described in the preceding section. However, atthe point in the protocol when trophozoites were resuspended to a concentrationof 5 � 105/ml following 21 h at 4°C, 6 ml of this amoeba suspension was addedto a 60- by 15-mm petri dish containing 12 glass coverslips placed adjacent to oneanother (94). After 1 h at 28°C the coverslips were washed in the petri dish with6 ml of A. castellanii buffer, and 6 ml of fresh A. castellanii buffer was added. Atthat time and at each subsequent time point, at least two coverslips were re-moved from the petri dish for analysis, washed with 20% DPBS, and processedby fixation and staining as described for entry experiments. GFP-expressing L.pneumophila and the corresponding strains without GFP showed comparableintracellular multiplication by titer of released bacteria in the above infection andencystment protocol.

Fluorescence microscopy. Microscope slides with immunofluorescence sam-ples were observed at a magnification of �60 using a HiQ band pass fluoresceinisothiocyanate filter for GFP fluorescence and a tetramethyl rhodamine isothio-cyanate filter for rhodamine and Cy3 (Chroma Technology Corp., Brattleboro,VT) with Zeiss Axioskop epifluorescence microscopes. Bacteria within the hostcell are not accessible to the antibody. Internalized L. pneumophila organismswere scored as those within the confines of a host cell envelope that were greenwith the GFP filter and not visible with the rhodamine filter (6, 43, 97). Inimmunofluorescence assays for entry, 130 to 190 amoeba or macrophage hostcells containing zero, one, or more internalized bacteria were counted for eachstrain in each experiment (Fig. 1 and 2). In assays for acidification of Legionella-containing phagosomes, 90 to 100 macrophage host cells containing one or moreinternalized bacteria were counted for each strain in each experiment (Fig. 3). Inmicroscopic assays for intracellular growth after reversion of amoeba cysts totrophozoites, 90 to 120 amoeba host cells containing one or more internalizedbacteria were counted for each strain in each experiment except for some timezero and 1-h time points for �lvh dotA or �lvh dotB double mutants, where only50 to 60 amoebae could be counted because entry was very inefficient at the MOIused (see Fig. 6).

LacZ fusion measurements. The upstream 411 nucleotides and the first sevencodons of the lvhB2 gene were amplified by PCR and ligated into the EcoRI siteof the lacZ translational fusion vector pGS-lac-01 using EcoRI sites in the PCRprimers CGCTACCGAATTCCGATGTGGTACTGACCAAGGC and CGGTTCCGAATTCCTCCATCGTTTTAATTTGCTCATGGC. L. pneumophila strainsJR32, dotA::Tn903dIIlacZ, and dotB::Tn903dIIlacZ were transformed by elec-

FIG. 2. Reversal of defective entry by WS treatment requires the lvh locus. Entry into A. castellanii trophozoites (A) or J774 macrophages(B) was quantified as described in the legend of Fig. 1. Strains are the �lvh deletion mutant, the �lvh dotA dotB double mutants, or double mutantscomplemented with the lvh locus on a plasmid, plvh�. In panel A reference values for the dotA and dotB single mutants are 1.5 (stationary phase)and 50 (WS) and 11.2 (stationary phase) and 66 (WS), respectively, internalized bacteria/50 amoebae. Reference values in panel B for the dotAand dotB single mutants are, respectively, 7.9 (stationary phase) and 48 (WS) and 5.6 (stationary phase) and 34 (WS), respectively, internalizedbacteria/50 J774 macrophages. The number of independent experiments in which the effect of the �lvh mutation on entry and complementationof this effect were shown is two for �lvh dotA, two for �lvh dotA plvh�, and three for �lvh dotB in panel A and one for �lvh dotA and �lvh dotAplvh�, three for �lvh dotB, and one for �lvh dotB plvh� in panel B. Stat, stationary phase.



.org/D

ownloaded from

http://iai.asm.org/

troporation with plasmids containing the lvhB2 promoter region in the forwardand in the reverse orientation with respect to the lacZ open reading frame.Activity of -galactosidase was determined as described previously (4). To cor-rect for LacZ activity from the Tn903dIIlacZ insertions (72, 100), the Miller units(4, 59) were calculated as for the strain with lvhB2 promoter in the forwardorientation and corrected for the strain with lvhB2 promoter in the reverseorientation, cultured under identical conditions and for the same duration.

Statistical analyses. For entry experiments, the total data set from 130 to 190host cells was divided into three subgroups which were then used for calculationof means � standard deviations and P values by a two-sided t test. For phago-some acidification experiments and microscopic assay of intracellular multipli-cation, P values were calculated using a chi-square test to compare the entiredata set of host cells counted for each strain/culture condition. For these exper-iments a standard deviation is not appropriate because the input data are dis-continuous. A bacterium is either colocalized or not colocalized with Lyso-Tracker or an amoeba contains either 1 or �1 internalized Legionella bacteria.Thus, means are shown without standard deviations and P values are cited.

RESULTS

WS as a mimic of the aquatic milieu of L. pneumophila. Asa bacterium ubiquitous in fresh-water reservoirs, L. pneumo-phila is expected to replicate when nutrients are available,enter stationary phase when nutrients are depleted, and exist instationary phase in low osmolarity regions of the reservoir. Asa laboratory mimic of that aquatic milieu, L. pneumophila wasgrown to stationary phase in broth medium and then resus-pended overnight in distilled, deionized water, a treatmentnamed water stress (WS). Viability was not diminished by theWS mimic. L. pneumophila strain JR32 was 91% � 0.7% and91% � 1.4% viable in stationary-phase cultures and after WStreatment, respectively. Respective values for the dotA mutant

FIG. 3. Effect of WS treatment and the lvh locus on delay of phagosome acidification. Cultured J774 macrophages (A and C) or primarycultures of bone marrow mouse macrophages (B) were incubated with LysoTracker Red then infected with stationary phase (Stat) or WS-treated(WS) cultures of the indicated L. pneumophila strain at an MOI of 10 or 50 (A and C) or 100 (B) at 37°C. After 1 h, the samples were fixed andstained, and colocalization of GFP-expressing Legionella with LysoTracker was quantified by epifluorescence microscopy. (A and B) Thecolocalization of stationary-phase cultures was significantly different from that of the respective WS culture (P 0.001) for dotA, dotB, icmE, andicmF mutants of strain JR32. For these four strains colocalization of WS cultures was not significantly different from that of WS-treated strain JR32(P values of 0.12 to 0.84). Colocalization of the �lvh dotB double mutant was significantly different from that of the �lvh mutant for WS cultures(P � 0.02) and showed a trend to be different for �lvh dotB and �lvh Stat cultures (P � 0.12). (C) Colocalization with LysoTracker in J774macrophages for strain JR32 or the �lvh mutant containing no vector, vector pMMB207, or the complementing pMMB207 plasmid (plvh�) wasdetermined as in panel A. Following complementation, colocalization of stationary-phase �lvh mutant was significantly different from �lvh mutantstrains without vector or with pMMB207 (P 0.006). Colocalization for the WS-complemented �lvh mutant showed a trend to be different from�lvh strains with no vector or with pMMB207 (P values of 0.1 to 0.2). Colocalization of the JR32 strain with plvh� was not significantly differentfrom JR32 strains with no vector or with pMMB207 for stationary-phase or WS cultures (P � 0.6). The number of independent experiments inwhich the effect of WS on colocalization was as shown in panel A is nine for dotA, six for dotB, five for �lvh, three for icmG, two for icmE andicmF, and one for the �lvh dotB mutant. Reversal of defective colocalization in BMMs as in panel B was shown in two independent experimentsfor dotA and dotB. Complementation of the defective colocalization of stationary-phase or WS-treated �lvh mutant (C) was shown in twoindependent experiments.



.org/D

ownloaded from

http://iai.asm.org/

of strain JR32 were 89% � 2.1% and 92% � 1.2%, indicatingthat viability was not decreased in a strain lacking a functionalDot/Icm T4SS.

WS reverses the defective entry of dot/icm mutants intomacrophage and amoebae. Defective entry of dotA and dotBmutants of strain JR32 into A. castellanii amoebae (Fig. 1A),cultured J774 murine macrophages (Fig. 1B), and primarycultures of macrophages from bone marrow of A/J mice (Fig.1C, BMMs) was reversed by WS treatment. Defective entry ofthe dotA mutant into HL-60-derived macrophages was alsoreversed by WS treatment, increasing from 25% to 150% ofstrain JR32 (data not shown). WS treatment reversed defectiveentry into J774 murine macrophages for null mutants in icmF,icmQ, and icmT but not for icmR and icmS mutants (Fig. 1B).IcmQ, a substrate of the IcmR chaperone (30, 34), forms poresin lipid membranes and may be involved in pore formation inhost membranes (35). IcmT is required for egress from hostcells following intracellular multiplication (61). The functionsof IcmF and IcmS in the Dot/Icm type IVB SS are not welldefined (76).

Given the essentiality of DotA and DotB for function of theDot/Icm T4SS, the data in Fig. 1 suggest that the Dot/IcmT4SS is dispensable for entry when WS-treated Legionella in-fect amoebae, cultured human or murine macrophages, orprimary cultures of mouse bone marrow-derived macrophages.

The Legionella lvh locus encodes a type IVA secretion system.The above data demonstrating entry in the absence of a func-tional Dot/Icm T4SS suggest involvement of an alternativeT4SS. In fact, all three sequenced L. pneumophila strains andstrain JR32 used in this study contain the lvh (Legionella vir-ulence homolog) locus encoding a type IVA secretion system(19, 22, 73). In contrast to the dot/icm loci, the lvh type IVAlocus is highly homologous to the virB/virD loci of A. tumefa-ciens, H. pylori, and Bordetella pertussis (23, 77, 102). However,a mutant of strain JR32 with a deletion of the entire lvh locuswas unchanged in entry, intracellular multiplication, and cyto-toxicity to HL-60-derived macrophages and J774 macrophagesas well as in intracellular multiplication in A. castellanii amoe-bae when stationary-phase cultures are used for infection (77;also data not shown). Nonetheless, an in-frame deletion mu-tant of lvhB2 encoding a putative pilin subunit of the Lvh T4SSin L. pneumophila strain AA100 exhibits decreased intracellu-lar multiplication in HL-60 macrophages when grown at 30°Ccompared to 37°C (69). This result suggested that the lvh locusmight be involved in virulence phenotypes when L. pneumo-phila is cultured under conditions different from those rou-tinely used for stationary-phase broth cultures.

The lvh type IVA SS locus is required for reversal of defec-tive entry of dot/icm mutants by WS treatment. To determineif the lvh locus is involved in reversal of virulence defects indotA and dotB mutants following WS treatment, entry wasstudied in the lvh deletion mutant described above (77) and in�lvh dotA and �lvh dotB double mutants (Table 1). The �lvhmutant was not defective in entry into amoebae (Fig. 2A) orJ774 macrophages (Fig. 2B) when stationary or WS-treatedcultures were used for infection. As expected from stationary-phase entry defects of dotA and dotB mutants (Fig. 1A, B),stationary-phase cultures of the �lvh dotA and �lvh dotB dou-ble mutants were defective for entry into both amoeba andmacrophage hosts (Fig. 2A and B). However, the defective

entry of the �lvh dotA and �lvh dotB double mutants was notreversed by WS treatment, contrasting with WS reversal ofdefective entry in dotA and dotB single mutants (Fig. 1). Theseresults suggested that the lvh locus was involved in WS reversalof defective entry in the dotA and dotB mutants. Similar ex-periments with �lvh icmE and �lvh icmT double mutants im-plicated the lvh locus in WS reversal of defective entry of icmEand icmT mutants into J774 macrophages (data not shown).IcmE is homologous to the VirB10 proteins of type IVA SSs,but its function in the Dot/Icm T4SS is not known (76).

Complementation of double mutants with the lvh locus gavefurther support to a role for the lvh locus in reversal of defec-tive entry by WS treatment. Plasmid lvh restored WS reversalof defective entry into amoebae for the �lvh dotA doublemutant (Fig. 2A) and defective entry into J774 macrophagesfor �lvh dotA and �lvh dotB double mutants (Fig. 2B). Entry ofstationary-phase cultures of the complemented �lvh dotA dou-ble mutant into J774 macrophages was larger than expected,and complementation of the WS-treated �lvh lvh dotA mutantwas partial for both amoeba and macrophage hosts. Thesenuances in complementation may be due to differences be-tween amoeba and macrophage hosts, to differences in expres-sion of the lvh locus from the complementing plasmid and froma chromosomal location, to differences in complementation ina dotA mutant defective in a membrane protein and comple-mentation in a dotB mutant defective in a cytosolic protein,and/or to the presence of mobilization genes in the comple-menting pMMB207 vector which is known to inhibit intracel-lular multiplication and macrophage killing phenotypes incomplementation of dot/icm mutants (79).

Use of LysoTracker Red to quantify acidification of L. pneu-mophila-containing phagosomes. The delayed acidification ofLegionella-containing phagosomes (44, 93) was initially dem-onstrated using the pH dependence of fluorescence from flu-orescein-labeled Legionella (45). More recently, colocalizationof internalized L. pneumophila with LAMP-1 or LAMP-2membrane protein markers of lysosomes and late endosomeshas been used (3, 48, 60, 93, 96). Phagosomes containing dotAor dotB mutants acquired LAMP-1 or LAMP-2 markers at agreater frequency than the corresponding parental strain, dem-onstrating that a functional Dot/Icm T4SS is required for thedelayed acidification when stationary cultures from rich me-dium are used to infect macrophages.

In our studies, acidification of L. pneumophila-containingphagosomes was quantified by colocalization of GFP-expressingbacteria with the LysoTracker Red fluorophore. LysoTrackerRed is preferentially retained in acidic vacuoles and is thus adirect probe for phagosome acidification. The equivalence ofLysoTracker Red and LAMP-1 for assessing acidification of L.pneumophila-containing phagosomes is supported by several ob-servations. In J774 murine macrophages, LysoTracker Red andLAMP-1 show identical intracellular localizations (97). In BMMs,our LysoTracker Red data are in excellent agreement with pub-lished data using LAMP-1 following infection with broth station-ary cultures of strain JR32: 29% colocalization with LysoTracker(Fig. 3B) compared to 30% with LAMP-1 (3). Stationary cul-tures of dotA and dotB mutants of strain JR32 colocalized 70 to80% with LysoTracker compared to 80 to 90% colocalizationwith LAMP-1 for dotA and dotB mutants of L. pneumophilastrain Lp02 (3).



.org/D

ownloaded from

http://iai.asm.org/

Water stress reverses the defective acidification of phago-somes containing L. pneumophila dot/icm mutants. FollowingWS treatment, acidification of phagosomes containing dotAand dotB mutants of strain JR32 was identical to that of strainJR32 in J774 peritoneal macrophages (Fig. 3A) and in murineBMMs (Fig. 3B). WS treatment also reversed the defectiveacidification of dotA-containing phagosomes in HL-60-derivedhuman macrophages. Colocalization with LysoTracker was58% for stationary-phase cultures and 32% after WS treat-ment, compared to 27 and 26%, respectively, for parentalstrain JR32 (data not shown). In MH-S murine alveolar mac-rophages, WS treatment of stationary cultures reduced colo-calization of the dotA mutant from 56 to 29%, compared to13% and 19%, respectively, for strain JR32 (data not shown).In sum, our data demonstrated WS reversal of defectivephagosome acidification of dotA and dotB mutants in primaryand cultured macrophage lines, in human and murine macro-phages, and in macrophages of leukemic, bone marrow, peri-toneal, and alveolar origins. These data suggested that theDot/Icm type IVB SS is not required for delayed acidificationof L. pneumophila-containing phagosomes when stationary-phase broth cultures are treated with the WS aquatic mimic.

Reversal of defective phagosome acidification in J774 mac-rophages by WS treatment was also demonstrated for nullmutants in icmE and icmF strains but not icmG (Fig. 3B).IcmG interacts with the carboxyl terminus of the RalF trans-located protein and is therefore implicated in recognition orescort of translocated proteins (55). The ability to reversedefective phenotypes in some but not all dot/icm mutants,previously noted for reversal of defective entry by treatmentwith buffered saline (6), is likely a complex function of whichgenes are differentially expressed by WS treatment and theinteraction of Dot/Icm and Lvh T4SS components. Phagosomeacidification experiments could not be performed in A. castel-lanii because LysoTracker dispersed throughout the amoebacytosol, suggestive of disruption of vacuole structure or toxicityto the amoeba.

The lvh type IVA SS locus is required for effective delay ofphagosome acidification in L. pneumophila strain JR32.Phagosomes containing the �lvh mutant were defective in de-lay of acidification in J774 macrophages following infectionwith stationary or WS cultures (Fig. 3A). These data suggestedthat the lvh locus and, by implication, the Lvh T4SS are re-quired for delay of phagosome acidification in strain JR32. Thedifference between the 50 to 55% colocalization of the �lvhmutant and the 65 to 75% colocalization of the dotA and dotBmutants can be attributed to wild-type dot/icm genes and theDot/Icm T4SS in the �lvh mutant. Supporting this, the percentcolocalization of the �lvh dotB double mutant tended to begreater than that for the �lvh mutant. Direct support for in-volvement of the lvh locus in delayed phagosome acidificationwas obtained by complementation, comparing colocalization of�lvh mutant strains containing no vector, the complementationplasmid plvh� used in the experiment shown in Fig. 2, or anempty pMMB207 vector (Fig. 3C). In the presence of plasmidplvh�, colocalization of the �lvh mutant decreased, approach-ing values of strain JR32. Partial complementation can beattributed to the factors discussed above. The presence of theplvh� plasmid or empty vector had no effect on colocalizationof stationary or WS-treated cultures of L. pneumophila strain

JR32 (Fig. 3C). Data shown in Fig. 3A and C support thehypothesis that the lvh locus and, by implication, the Lvh T4SSare required for delay of phagosome acidification of strainJR32 and for reversal of defective acidification of the dotBmutant by the WS mimic of aquatic niches of L. pneumophila.

Although the �lvh mutant was defective in delay of phago-some acidification in macrophages (Fig. 3A), it replicated iden-tically to its parental strain JR32 when stationary-phase cul-tures were used to infect HL-60-derived macrophages (77) orJ774 macrophages (data not shown). This intracellular multi-plication could be attributed to the Dot/Icm T4SS present andfunctional in the �lvh mutant and to the fact that �45% of�lvh mutant bacteria reside in phagosomes that are delayed inacidification (Fig. 3A) and are thus, presumably, able to ac-quire an intracellular multiplication phenotype.

Defective intracellular multiplication in amoebae and mac-rophages is not reversed by WS treatment. Since WS treat-ment of dot/icm mutants reversed their defective entry anddelay of phagosome acidification, which precede intracellularmultiplication, the effect of WS treatment on intracellular mul-tiplication was tested. The Tn903 insertion mutants of dotA(80) and dotB used in these studies were unable to replicate inA. castellanii amoebae and J774 macrophages following infec-tion with stationary-phase broth cultures (Fig. 4A and B). Theinability of stationary-phase dotA and dotB mutants to repli-cate in BMMs and the MH-S alveolar macrophage line wasalso demonstrated (data not shown).

Defective intracellular multiplication of dotA or dotB mu-tants in A. castellanii or J774 macrophages was not reversed byWS treatment (Fig. 4A and B). To test if dotA and dotBmutants replicated intracellularly but were defective in releaseinto the infection medium, as shown for lepA and lepB mutants(21), L. pneumophila was titered following lysis of J774 mac-rophages with saponin. At 24 h after infection with WS-treatedbacteria, the titer of strain JR32 increased 2.7 times while thetiter of dotA and dotB mutants was 0.4 times that immedi-ately following infection. These data indicated that dotA anddotB mutants were nonreplicative in macrophages followingWS treatment and did not suggest that replication occurs butrelease from macrophage hosts is defective. We also tested ifWS treatment enhanced intracellular multiplication of an icmFmutant which is partially defective in intracellular multiplica-tion in HL-60 macrophages (80). Consistent with prior data forHL-60 macrophages (80), stationary-phase cultures of icmF L.pneumophila showed a partial replication defect in J774 mac-rophages (data not shown). WS-treated cultures of the icmFmutant were nonreplicative in J774 macrophages as assessedby titering the infection medium or by titering saponin lysatesof macrophage host cells (data not shown). In sum, WS treat-ment was unable to reverse defective intracellular multiplica-tion in nonreplicative dotA and dotB mutants or in the icmFmutant that is partially defective in macrophages infected withstationary-phase cultures.

The amoeba cyst environmental mimic. The entrance ofLegionella into domestic water supplies from aquatic nicheshas been attributed to the resistance of L. pneumophila en-cysted in amoeba to chlorine used for water purification (49).Coculture with A. castellanii resuscitated L. pneumophila froma viable but nonculturable state (90). These observationsprompted the development of an encystment mimic to test the



.org/D

ownloaded from

http://iai.asm.org/

reversal of intracellular multiplication defects in dot/icm mu-tants. A. castellanii trophozoites were infected with WS-treateddotA and dotB L. pneumophila bacteria, which show entry intoamoebae comparable to that of parental strain JR32 (Fig. 1A);the trophozoites were then converted to cysts by cooling to4°C. This temperature is relevant to the etiology of Legion-naires’ disease because L. pneumophila has been isolated fromwater of 6°C (40), and water temperatures in cooling towershave been reported as low as 8°C (101). After overnight incu-bation cysts were reverted to trophozoites at 28°C, and intra-cellular multiplication was quantified.

Mutants in dotA and dotB replicate in amoebae followingencystment. The rate of intracellular multiplication of strain

JR32 in the encystment mimic (Fig. 5A) was comparable tothat following infection of A. castellanii trophozoites with sta-tionary-phase or with WS-treated cultures (Fig. 4A). Followingencystment, dotA and dotB mutants replicated intracellularly,as assessed by increased titers in the infection medium, withincreases of 50-fold and 19-fold, respectively, at 18 to 27 h afterreversion of cysts to trophozoites (Fig. 5B). Control experi-ments were performed with WS-treated L. pneumophila incu-bated at 4°C without prior exposure to amoebae and thenwarmed to 28°C before infection of amoeba trophozoites.Strain JR32 replicated intracellularly, but dotA and dotB mu-tants were nonreplicative (data not shown) and behaved com-parable to data shown in Fig. 4A. These results indicated that

FIG. 4. Stationary-phase and WS-treated cultures of dotA and dotB mutants are nonreplicative in amoeba trophozoites and macrophages. A.castellanii trophozoites (A) or cultured J774 mouse macrophages (B) were infected with stationary-phase (filled symbols) or WS treated cultures(open symbols) of the indicated L. pneumophila strain at an MOI of 1, and intracellular multiplication was quantified by titer of the infectionmedium during incubation at 28°C (A) or 37°C (B). The number of independent experiments in which stationary-phase or WS-treated cultureswere unable to replicate is two for dotA and two for dotB in A. castellanii trophozoites and one for dotA and two for dotB in J774 macrophages.t0, time zero.

FIG. 5. Intracellular multiplication of internalized dotA and dotB mutants in amoebae following reversion of cysts to trophozoites. A. castellaniitrophozoites were infected with WS-treated cultures of the indicated L. pneumophila strain at an MOI of 10 at 28°C. After 30 min external bacteriawere removed by washing, and trophozoites containing internalized bacteria were converted to cysts at 4°C. After 19 h at 4°C, cysts were revertedto trophozoites at 28°C, and intracellular multiplication was quantified by titer of the infection medium at the indicated times after addition tomicrotiter dishes. The number of independent experiments in which intracellular multiplication comparable to that in panel A was observed is 10for strain JR32 and seven for the �lvh mutant. For panel B the number of independent experiments in which an increase in titer comparable toor greater than that shown was observed is five for dotA and seven for dotB. Decreased intracellular multiplication in the �lvh dotB mutant wasobserved in three independent experiments. t0, time zero.



.org/D

ownloaded from

http://iai.asm.org/

intracellular multiplication of dotA and dotB mutants is depen-dent on encystment of L. pneumophila in amoebae. In theabsence of encystment, WS treatment and incubation at 4°Care insufficient to reverse the intracellular multiplication defectof stationary or WS-treated cultures of dotA or dotB mutants.

To test if the titer increases after encystment were attribut-able to a progressive egress of dotA or dotB L. pneumophilainternalized following WS treatment rather than to authenticintracellular replication, GFP-expressing Legionella were di-rectly observed in fixed amoebae by epifluorescence micros-copy. We assumed that 25 to 50 Legionella bacteria were re-leased into the medium on lysis of an infected amoeba cellsince encystment can trap �50 L. pneumophila bacteria peramoeba cyst (32). Calculations showed that the increase in titer(Fig. 5A) at 20 to 24 h is attributable to less than 1% of theamoebae present. Analysis of internalized GFP-expressing L.pneumophila showed 0.3 bacterium per amoeba prior to en-cystment at 4°C (data not shown). Since very few amoebaecontain large numbers of bacteria, the percentage of infectedamoebae containing 2 or more GFP-L. pneumophila bacteriawas taken as indicative of bacteria undergoing replication (Fig.6). For strain JR32 and the dotA and dotB strains, this per-centage increased between 1 and 22 h after the reversion totrophozoites. Thus, microscopic analysis confirmed that dotAand dotB mutants undergo bona fide intracellular multiplica-tion following WS-mediated entry and amoeba encystment.

The titer of dotA and dotB L. pneumophila in the infectionmedium decreased between 30 and 47 h after the reversion ofcysts to trophozoites (Fig. 5B). When aliquots were removedfrom the infection medium at 20 to 30 h and maintained at28°C in the absence of amoebae, the titer was not significantlydecreased at 47 h. This indicated that the decrease in titer wasnot due to loss of plating efficiency in the infection medium(data not shown). Microscopic examination of internalizedGFP-expressing Legionella showed that the number of repli-

cating dotA and dotB mutants decreased between 22 and 47 hwhile the percentage of replicating bacteria of the parentalstrain JR32 continued to increase (Fig. 6). The number of CFUand microscopic data suggested that the decreased titer shownin the graph in Fig. 5B was due to phagocytosis and killing ofdotA and dotB L. pneumophila by A. castellanii. These datasupport a model in which dotA and dotB mutants are able toundergo intracellular replication in A. castellanii amoebae fol-lowing encystment but are unable to reinfect and/or continuemultiple successive rounds of intracellular multiplication afteregress from initial amoeba hosts.

Involvement of the lvh T4SS locus in intracellular multipli-cation of dotA and dotB mutants following encystment. To testinvolvement of the lvh locus in reversal of defective intracel-lular multiplication, the encystment experiment was performedwith the �lvh mutant and the �lvh dotB double mutant used toshow lvh involvement in entry and delay of phagosome acidi-fication phenotypes (Fig. 1 to 3). Assessed by titer of theinfection medium, the �lvh mutant replicated identically to theparental strain JR32 (Fig. 5A), as expected from the identicalintracellular multiplication of the �lvh mutant and strain JR32in conventional infection protocols with A. castellanii tropho-zoites and HL-60 (77) and J774 macrophages (data notshown). Consistent with these titer data, microscopic analysisof the GFP-expressing �lvh mutant demonstrated intracellularreplication comparable to that of strain JR32 (Fig. 6A). Incontrast, replication was significantly reduced for the �lvh dotAmutant by microscopic analysis (Fig. 6A) and for the �lvh dotBdouble mutant by titer of bacteria in the infection medium(Fig. 5B) and by microscopic analysis (Fig. 6A). Complemen-tation of the �lvh dotA or �lvh dotB double mutants was testedin the microscopic assay for intracellular replication (Fig. 6B).Complementation of the �lvh dotB double mutant was demon-strable at 4.5 and 21 h while the �lvh dotA double mutant wascomplemented only at 4.5 h. It is unclear why the �lvh dotA

FIG. 6. Microscopic assay of intracellular growth after reversion of amoeba cysts to trophozoites. A. castellanii trophozoites were infected withthe indicated WS-treated Legionella strain containing plasmid GFP, converted to amoeba cysts, then reverted to trophozoites as described in thelegend of Fig. 5, and then adhered to glass coverslips. At the indicated times after adherence to coverslips, infected amoebae were fixed and stainedfor visualization of internal bacteria. In panel A values at 22 h are significantly different from respective values at 1 h for JR32, �lvh, dotA, anddotB strains (P � 0.02). For �lvh dotA and �lvh dotB strains, values at 22 and 47 h are not significantly different from respective values at 1 h (P �0.3). For dotA and dotB strains, values at 47 h are not significantly different from respective values at 1 h (P � 0.3). Intracellular replication wasshown in three independent experiments for the dotA and dotB mutants, and a decrease in replication for the �lvh dotA and �lvh dotB mutantswas shown in two independent experiments. In panel B at 4.5 h, P values for single versus �lvh double mutants are 0.064 and 0.029 for dotA anddotB mutants, respectively. At 21 h, P values for the corresponding comparisons are 0.11 and 0.001. The P values for the �lvh double mutants versusthe corresponding strains complemented with plvh� are 0.16 and 0.19 for dotA and dotB mutants, respectively, at 4.5 h and 0.35 and 0.013,respectively, at 21 h. The experiment with the plvh�-complemented strains in panel B was performed once.



.org/D

ownloaded from

http://iai.asm.org/

double mutant was not complemented at 21 h. As stated above,complementation may be influenced by different levels of ex-pression from plasmid and chromosomal lvh genes and thepresence of mob genes on the complementing plasmid. Main-tenance of appropriate expression levels is likely a criticalfactor in achieving complementation of the intracellular repli-cation defect. The 21-h time point in the intracellular replica-tion experiment shown in Fig. 6B is considerably longer thanthe 0.5- to 1-h length of entry (Fig. 2) and phagosome acidifi-cation experiments (Fig. 3C) in which complementation of the�lvh dotA or �lvh dotB double mutants was demonstrated.Complementation of the �lvh mutation may be more success-ful for virulence phenotypes of shorter duration. In sum, dataon single mutants, double mutants, and complemented mu-tants indicated that the lvh locus and, by inference, the LvhT4SS are required for intracellular multiplication of dotA anddotB Legionella following amoeba encystment. The data wereconsistent with a model in which the Lvh T4SS is preferentiallyinvolved in virulence phenotypes of L. pneumophila under con-ditions that mimic the aquatic and amoeba cyst niches of theLegionnaires’ disease bacterium.

Effect of WS treatment on lvh expression. Since the lvh locuswas implicated in reversal of defective virulence-related phe-notypes following WS treatment, the effect of WS treatment onexpression of the lvh locus was tested using a LacZ fusion withthe 5 end of the first virB gene of the lvh locus, virB2. The virBlocus of many type IVA SSs consists of a single operon begin-ning with the first virB gene (20). LacZ assays performed overthe first 6 hours and after 16 to 19 h of WS treatment showedno induction of LacZ activity in WS-treated cultures of strainJR32 or the dotA or dotB strains compared to the correspond-ing stationary-phase cultures (data not shown). These dataraised the possibility of posttranslational changes in Lvh ex-pression, such as posttranslational modification, associationwith accessory proteins, or changes in intracellular location.Formation of a functional type IVA SS in A. tumefaciens in-volves localization of VirB/D proteins to the poles of the bac-terial cell. In L. pneumophila the SdeA, SidC, and LidA pro-tein substrates of the Dot/Icm T4SS show polar localization (7,31, 55), suggesting that L. pneumophila T4SSs have polar lo-cations and that localization to specific subcellular regions isinvolved in formation or activation of a functional T4SS.

DISCUSSION

The requirement for the Dot/Icm T4SS and the dispensabil-ity of the Lvh T4SS for entry, intracellular multiplication, andcytotoxicity of L. pneumophila to host cells were deduced frominfecting amoebae and macrophages with dot/icm or �lvh mu-tants grown to stationary phase in rich medium. Data pre-sented in this work support a model in which the requirementfor the Dot/Icm T4SS and the dispensability of the Lvh typeIVA SS are conditional and dependent on Legionella cultureconditions. Defective entry and defective delay of phagosomeacidification of mutants in dotA and dotB, essential for functionof the Dot/Icm T4SS, were reversed and restored to values ofthe parental strain JR32 by incubation of stationary-phase cul-tures in water prior to infection of amoebae or macrophages.Defective intracellular multiplication of dotA and dotB mu-tants in A. castellanii amoebae was reversed by encystment of

water-treated cultures in amoebae. The data for �lvh dotA and�lvh dotB double mutants suggested that the Lvh T4SS cansubstitute for the Dot/Icm T4SS or components of the Dot/IcmT4SS in entry following WS treatment and can substitute forintracellular multiplication following encystment. In addition,the Lvh T4SS contributed to delay of phagosome acidificationin L. pneumophila strain JR32. The Lvh T4SS was previouslyshown to function in conjugal transfer of RSF1010-relatedplasmids (77). Demonstrating a role for the Lvh T4SS inphagosome acidification suggested that the Lvh T4SS can alsotranslocate Legionella effector proteins because secretion ofprotein substrates of a T4SS is thought to be required fordelayed phagosome acidification (65, 76).

Identification of a role for the L. pneumophila Lvh T4SS invirulence-related phenotypes raises questions about redun-dant, overlapping, or independent contributions of the Dot/Icm and Lvh T4SSs to virulence-related phenotypes. Principalquestions are whether virulence-related proteins translocatedby the Dot/Icm T4SS are recognized and translocated by theLvh T4SS and whether the Lvh T4SS is involved in associationof components of the endoplasmic reticulum with the Legion-ella-containing phagosome. Salmonella enterica serovar Typhi-murium utilizes two type III secretion systems in producing atyphoid-like disease in mice. One, encoded by SPI-1, is re-quired for entry into nonphagocytic cells and a second, en-coded by SPI-2, is required for optimal replication in macro-phages (14). The culture conditions in which dispensability ofthe Legionella Dot/Icm T4SS was demonstrated, exposure towater and encystment in amoebae, suggest that the Lvh T4SSis preferentially involved in the spread of Legionnaires’ diseasefrom environmental niches. In this regard, promising ap-proaches for dissecting the contributions of Dot/Icm and LvhT4SSs will be testing the effect of other environmental mimicson virulence-related phenotypes and analysis of aerosol infec-tion by L. pneumophila in animal models (85–87).

Reversal of defective virulence phenotypes in dot/icm mu-tants by WS treatment and amoeba encystment could involvefunctional substitution of the Lvh T4SS for a nonfunctionalDot/Icm T4SS, full or partial reconstitution, or repair of theDot/Icm T4SS using components of the Lvh T4SS or functionalcontributions to type IV secretion from both Lvh and Dot/Icmsystems. Studies to distinguish between these molecular mech-anisms will be facilitated by the strong homologies of Lvhproteins with proteins of the A. tumefaciens type IVA SS forwhich functional roles have been identified for nearly all VirBand VirD components (25, 33). Cross-linking (17, 18, 54),immunofluorescence, and immuno-electron microscopy ap-proaches (51, 52) used to demonstrate changes in the intracel-lular location of A. tumefaciens VirB/D proteins in response tosecretion stimuli are likely to be feasible for studying assemblyand intracellular location of Lvh T4SS proteins under differentculture conditions and in response to environmental mimics.

L. pneumophila has been proposed to be an accidentalpathogen that transitions from a planktonic pond bacteriumand parasite of environmental amoebae to the causative agentof Legionnaires’ disease (74, 83, 95). Our studies implicatingthe Lvh T4SS in the spread of Legionnaires’ disease suggestthat the lvh locus is involved in that transition. Supporting thissuggestion is the observation that the lvh locus is present in L.pneumophila and other species of the Legionella genus that are



.org/D

ownloaded from

http://iai.asm.org/

human pathogens but absent from species that are not humanpathogens (73). In addition, microarray data show increasedexpression of both lvh and dot/icm genes following internaliza-tion by A. castellanii amoebae (66).

Following entry into a host cell, L. pneumophila cycles be-tween a replicative form capable of intracellular multiplicationand a transmissive form capable of reinfecting new host cells.Current models of the role of nutrient limitation in signalingthis transition, the stress regulators involved, and the changesin dot/icm gene expression are based principally on studies inwhich stationary or postexponential broth cultures are used forinfection (41, 42, 63, 75). The present study demonstrated thatfollowing WS treatment, mutants in dotA, dotB, and otherdot/icm genes become infective and capable of enteringamoeba and macrophage hosts and delaying phagosome acid-ification. Studies following encystment in amoebae demon-strated that dotA and dotB mutants can become capable ofreplication in amoeba trophozoites and suggest that they areunable to reinfect new amoeba hosts. These results identifyWS treatment and amoeba encystment as new, etiologicallyrelevant experimental systems for studying the transition be-tween replicative and transmissive forms.

L. pneumophila is a prototypic example of an environmentalpathogen for which amoebae play a critical role in the diseaseetiology (91). Amoeba species in the genera Hartmannella andAcanthamoeba are believed to be environmental reservoirs forreplication of aquatic L. pneumophila (13, 38, 39, 91). Encyst-ment protects both amoeba host (32) and Legionella parasite(49) from chlorination treatment used for water purificationand likely from thermal, oxidative, pH, and other stresses en-countered when cysts reside in standing-water reservoirs ofman-made origin. Encystment, which can capture �50 Legion-ella bacteria per amoeba host cell (32), is therefore proposedas an avenue by which Legionella can colonize new environ-ments and a means of delivering an infectious inoculum fol-lowing aerosolization of Legionella-containing cysts. Followinginfection and intracellular multiplication in amoeba trophozo-ites, L. pneumophila strain 130b demonstrated enhanced entryand intracellular multiplication in cultured cells and enhancedreplication in lungs after intratracheal infection of mice (27,28). L. pneumophila strain JR32 regained plating ability from anonviable and nonculturable state after 125 days of incubationin tap water following coincubation with A. castellanii tropho-zoites (90).

Analogous roles for amoebae have been demonstrated forother bacterial and fungal pathogens of environmental origin,including Mycobacterium tuberculosis, Vibrio cholerae, Fran-cisella tularensis, and Cryptococcus neoformans (1, 2, 29, 89, 91).In addition, rumen protozoa have been implicated in enhanc-ing the pathogenicity and invasion by drug-resistant S. enterica(68) and in the spread of antibiotic resistance between differ-ent species of bacteria (57). Our studies describe an experi-mentally simple system for testing the effect of encystment onvirulence-related phenotypes. The increasing number of envi-ronmental pathogens that use amoebae as etiological agentssuggests that limiting invasion and encystment of environmen-tal amoebae may be a means of controlling the spread of theseinfectious diseases.

ACKNOWLEDGMENTS

We thank the Summer Undergraduate Research Program of the SueGolding Graduate Division of Albert Einstein College of Medicine forsupport of C.B.G. (summer 2004) and Z.V. (summer 2005).

We thank Howard Shuman, Department of Microbiology and Im-munology, Columbia University College of Physicians and Surgeons,for Legionella strains, the J774 macrophage line, and review of themanuscript. We thank colleagues at Albert Einstein College of Med-icine, Anne Bresnick and Dianne Cox, and the Albert Einstein AnalyticalImaging Facility for use of epifluorescence microscopes; Richard Stanleyand Fiona Pixley for assistance with preparation of mouse bone mar-row for culturing bone marrow macrophages; and Hillel Cohen foradvice on statistical analysis.

REFERENCES

1. Abd, H., T. Johansson, I. Golovliov, G. Sandstrom, and M. Forsman. 2003.Survival and growth of Francisella tularensis in Acanthamoeba castellanii.Appl. Environ. Microbiol. 69:600–606.

2. Abd, H., A. Weintraub, and G. Sandstrom. 2005. Intracellular survival andreplication of Vibrio cholerae O139 in aquatic free-living amoebae. Environ.Microbiol. 7:1003–1008.

3. Bandyopadhyay, P., B. Byrne, Y. Chan, M. S. Swanson, and H. M. Steinman.2003. Legionella pneumophila catalase-peroxidases are required for propertrafficking and growth in primary macrophages. Infect. Immun. 71:4526–4535.

4. Bandyopadhyay, P., and H. M. Steinman. 2000. Catalase-peroxidases ofLegionella pneumophila: cloning of the katA gene and studies of KatAfunction. J. Bacteriol. 182:6679–6686.

5. Bandyopadhyay, P., and H. M. Steinman. 1998. Legionella pneumophilacatalase-peroxidases: cloning of the katB gene and studies of KatB function.J. Bacteriol. 180:5369–5374.

6. Bandyopadhyay, P., H. Xiao, H. A. Coleman, A. Price-Whelan, and H. M.Steinman. 2004. Icm/Dot-independent entry of Legionella pneumophila intoamoeba and macrophage hosts. Infect. Immun. 72:4541–4551.

7. Bardill, J. P., J. L. Miller, and J. P. Vogel. 2005. IcmS-dependent translo-cation of SdeA into macrophages by the Legionella pneumophila type IVsecretion system. Mol. Microbiol. 56:90–103.

8. Berger, K. H., and R. R. Isberg. 1993. Two distinct defects in intracellulargrowth complemented by a single genetic locus in Legionella pneumophila.Mol. Microbiol. 7:7–19.

9. Berger, K. H., J. J. Merriam, and R. R. Isberg. 1994. Altered intracellulartargeting properties associated with mutations in the Legionella pneumo-phila dotA gene. Mol. Microbiol. 14:809–822.

10. Bollin, G. E., J. F. Plouffe, M. F. Para, and B. Hackman. 1985. Aerosolscontaining Legionella pneumophila generated by shower heads and hot-water faucets. Appl. Environ. Microbiol. 50:1128–1131.

11. Bornstein, N., D. Marmet, M. Surgot, M. Nowicki, A. Arslan, J. Esteve, andJ. Fleurette. 1989. Exposure to Legionellaceae at a hot spring spa: a pro-spective clinical and serological study. Epidemiol. Infect. 102:31–36.

12. Brand, B. C., A. Sadosky, and S. H. A. 1994. The Legionella pneumophilaicm locus: a set of genes required for intracellular multiplication in humanmacrophages. Mol. Microbiol. 14:797–808.

13. Brown, M. R., and J. Barker. 1999. Unexplored reservoirs of pathogenicbacteria: protozoa and biofilms. Trends Microbiol. 7:46–50.

14. Brown, N. F., B. A. Vallance, B. K. Coombes, Y. Valdez, B. A. Coburn, andB. B. Finlay. 2005. Salmonella pathogenicity island 2 is expressed prior topenetrating the intestine. PLOS Pathog. 1:e32.

15. Burns, D. L. 2003. Type IV transporters of pathogenic bacteria. Curr. Opin.Microbiol. 6:29–34.

16. Byrne, B., and M. S. Swanson. 1998. Expression of Legionella pneumophilavirulence traits in response to growth conditions. Infect. Immun. 66:3029–3034.

17. Carle, A., C. Hoppner, K. Ahmed Aly, Q. Yuan, A. den Dulk-Ras, A.Vergunst, D. O’Callaghan, and C. Baron. 2006. The Brucella suis type IVsecretion system assembles in the cell envelope of the heterologous hostAgrobacterium tumefaciens and increases IncQ plasmid pLS1 recipient com-petence. Infect. Immun. 74:108–117.

18. Cascales, E., and P. J. Christie. 2004. Definition of a bacterial type IVsecretion pathway for a DNA substrate. Science 304:1170–1173.

19. Cazalet, C., C. Rusniok, H. Bruggemann, N. Zidane, A. Magnier, L. Ma, M.Tichit, S. Jarraud, C. Bouchier, F. Vandenesch, F. Kunst, J. Etienne, P.Glaser, and C. Buchrieser. 2004. Evidence in the Legionella pneumophilagenome for exploitation of host cell functions and high genome plasticity.Nat. Genet. 36:1165–1173.

20. Chen, C. Y., L. Eckmann, S. J. Libby, F. C. Fang, S. Okamoto, M. F.Kagnoff, J. Fierer, and D. G. Guiney. 1996. Expression of Salmonella typhi-murium rpoS and rpoS-dependent genes in the intracellular environment ofeukaryotic cells. Infect. Immun. 64:4739–4743.

21. Chen, J., K. S. de Felipe, M. Clarke, H. Lu, O. R. Anderson, G. Segal, and



.org/D

ownloaded from

http://iai.asm.org/

H. A. Shuman. 2004. Legionella effectors that promote nonlytic release fromprotozoa. Science 303:1358–1361.

22. Chien, M., I. Morozova, S. Shi, H. Sheng, J. Chen, S. M. Gomez, G.Asamani, K. Hill, J. Nuara, M. Feder, J. Rineer, J. J. Greenberg, V.Steshenko, S. H. Park, B. Zhao, E. Teplitskaya, J. R. Edwards, S. Pampou,A. Georghiou, I. C. Chou, W. Iannuccilli, M. E. Ulz, D. H. Kim, A. Geringer-Sameth, C. Goldsberry, P. Morozov, S. G. Fischer, G. Segal, X. Qu, A.Rzhetsky, P. Zhang, E. Cayanis, P. J. De Jong, J. Ju, S. Kalachikov, H. A.Shuman, and J. J. Russo. 2004. The genomic sequence of the accidentalpathogen Legionella pneumophila. Science 305:1966–1968.

23. Christie, P. J. 2001. Type IV secretion: intercellular transfer of macromol-ecules by systems ancestrally related to conjugation machines. Mol. Micro-biol. 40:294–305.

24. Christie, P. J. 2004. Type IV secretion: the Agrobacterium VirB/D4 andrelated conjugation systems. Biochim. Biophys. Acta 1694:219–234.

25. Christie, P. J., and E. Cascales. 2005. Structural and dynamic properties ofbacterial type IV secretion systems. Mol. Membr. Biol. 22:51–61.

26. Christie, P. J., and J. P. Vogel. 2000. Bacterial type IV secretion: conjuga-tion systems adapted to deliver effector molecules to host cells. TrendsMicrobiol. 8:354–360.

27. Cirillo, J. D., S. L. Cirillo, L. Yan, L. E. Bermudez, S. Falkow, and L. S.Tompkins. 1999. Intracellular growth in Acanthamoeba castellanii affectsmonocyte entry mechanisms and enhances virulence of Legionella pneumo-phila. Infect. Immun. 67:4427–4434.

28. Cirillo, J. D., S. Falkow, and L. S. Tompkins. 1994. Growth of Legionellapneumophila in Acanthamoeba castellanii enhances invasion. Infect. Im-mun. 62:3254–3261.

29. Cirillo, J. D., S. Falkow, L. S. Tompkins, and L. E. Bermudez. 1997.Interaction of Mycobacterium avium with environmental amoebae enhancesvirulence. Infect. Immun. 65:3759–3767.

30. Coers, J., J. C. Kagan, M. Matthews, H. Nagai, D. M. Zuckman, and C. R.Roy. 2000. Identification of Icm protein complexes that play distinct roles inthe biogenesis of an organelle permissive for Legionella pneumophila intra-cellular growth. Mol. Microbiol. 38:719–736.

31. Conover, G. M., I. Derre, J. P. Vogel, and R. R. Isberg. 2003. The Legionellapneumophila LidA protein: a translocated substrate of the Dot/Icm systemassociated with maintenance of bacterial integrity. Mol. Microbiol. 48:305–321.

32. De Jonckheere, J., and H. van de Voorde. 1976. Differences in destructionof cysts of pathogenic and nonpathogenic Naegleria and Acanthamoeba bychlorine. Appl. Environ. Microbiol. 31:294–297.

33. Ding, Z., K. Atmakuri, and P. J. Christie. 2003. The outs and ins ofbacterial type IV secretion substrates. Trends Microbiol. 11:527–535.

34. Dumenil, G., and R. R. Isberg. 2001. The Legionella pneumophila IcmRprotein exhibits chaperone activity for IcmQ by preventing its participationin high-molecular-weight complexes. Mol. Microbiol. 40:1113–1127.

35. Dumenil, G., T. P. Montminy, M. Tang, and R. R. Isberg. 2004. IcmR-regulated membrane insertion and efflux by the Legionella pneumophilaIcmQ protein. J. Biol. Chem. 279:4686–4695.

36. Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed,D. C. Mackel, and W. B. Baine. 1979. Charcoal-yeast extract agar: primaryisolation medium for Legionella pneumophila. J. Clin. Microbiol. 10:437–441.

37. Fernandez-Moreira, E., J. H. Helbig, and M. S. Swanson. 2006. Membranevesicles shed by Legionella pneumophila inhibit fusion of phagosomes withlysosomes. Infect. Immun. 74:3285–3295.

38. Fields, B. Legionella in the environment. In P. S. Hoffman, T. W. Klein, andH. Friedman (ed.), Legionella pneumophila: pathogenesis and immunity, inpress. Springer Publishing Corp., New York, NY.

39. Fields, B. S. 1996. The molecular ecology of Legionellae. Trends Micro.4:286–290.

40. Fliermans, C. B., W. B. Cherry, L. H. Orrison, S. J. Smith, D. L. Tison, andD. H. Pope. 1981. Ecological distribution of Legionella pneumophila. Appl.Environ. Microbiol. 41:9–16.

41. Gal-Mor, O., and G. Segal. 2003. Identification of CpxR as a positiveregulator of icm and dot virulence genes of Legionella pneumophila. J.Bacteriol. 185:4908–4919.

42. Gal-Mor, O., and G. Segal. 2003. The Legionella pneumophila GacA ho-molog (LetA) is involved in the regulation of icm virulence genes and isrequired for intracellular multiplication in Acanthamoeba castellanii. Mi-crob. Pathog. 34:187–194.

43. Hilbi, H., G. Segal, and H. A. Shuman. 2001. Icm/dot-dependent upregu-lation of phagocytosis by Legionella pneumophila. Mol. Microbiol. 42:603–617.

44. Horwitz, M. A. 1983. Formation of a novel phagosome by the Legionnaires’disease bacterium (Legionella pneumophila) in human monocytes. J Exp.Med. 158:1319–1331.

45. Horwitz, M. A., and F. R. Maxfield. 1984. Legionella pneumophila inhibitsacidification of its phagosome in human monocytes. J. Cell Biol. 99:1936–1943.

46. Horwitz, M. A., and S. C. Silverstein. 1983. Intracellular multiplication ofLegionnaires’ disease bacteria (Legionella pneumophila) in human mono-

cytes is reversibly inhibited by erythromycin and rifampin. J. Clin. Investig.71:15–26.

47. Horwitz, M. A., and S. C. Silverstein. 1980. Legionnaires’ disease bacterium(Legionella pneumophila) multiples intracellularly in human monocytes.J. Clin. Investig. 66:441–450.

48. Joshi, A. D., S. Sturgill-Koszycki, and M. S. Swanson. 2001. Evidence thatDot-dependent and -independent factors isolate the Legionella pneumo-phila phagosome from the endocytic network in mouse macrophages. CellMicrobiol. 3:99–114.

49. Kilvington, S., and J. Price. 1990. Survival of Legionella pneumophila withincysts of Acanthamoeba polyphaga following chlorine exposure. J. Appl.Bacteriol. 68:519–525.

50. Kirby, J. E., J. P. Vogel, H. L. Andrews, and R. R. Isberg. 1998. Evidencefor pore-forming ability by Legionella pneumophila. Mol. Microbiol. 27:323–336.

51. Kumar, R. B., and A. Das. 2002. Polar location and functional domains ofthe Agrobacterium tumefaciens DNA transfer protein VirD4. Mol. Micro-biol. 43:1523–1532.

52. Kumar, R. B., Y. H. Xie, and A. Das. 2000. Subcellular localization of theAgrobacterium tumefaciens T-DNA transport pore proteins: VirB8 is essen-tial for the assembly of the transport pore. Mol. Microbiol. 36:608–617.

53. Liles, M. R., P. H. Edelstein, and N. P. Cianciotto. 1999. The prepilinpeptidase is required for protein secretion by and the virulence of theintracellular pathogen Legionella pneumophila. Mol. Microbiol. 31:959–970.

54. Liu, Z., and A. N. Binns. 2003. Functional subsets of the virB type IVtransport complex proteins involved in the capacity of Agrobacterium tume-faciens to serve as a recipient in virB-mediated conjugal transfer of plasmidRSF1010. J. Bacteriol. 185:3259–3269.

55. Luo, Z. Q., and R. R. Isberg. 2004. Multiple substrates of the Legionellapneumophila Dot/Icm system identified by interbacterial protein transfer.Proc. Natl. Acad. Sci. USA 101:841–846.

56. Matsunaga, K., T. W. Klein, H. Friedman, and Y. Yamamoto. 2001. Alve-olar macrophage cell Line MH-S is valuable as an in vitro model forLegionella pneumophila infection. Am. J. Respir. Cell Mol. Biol. 24:326–331.

57. McCuddin, Z. P., S. A. Carlson, M. A. Rasmussen, and S. K. Franklin.2006. Klebsiella to Salmonella gene transfer within rumen protozoa: impli-cations for antibiotic resistance and rumen defaunation. Vet. Microbiol.114:275–284.

58. McDade, J. E., C. C. Shepard, D. W. Fraser, T. R. Tsai, M. A. Redus, andW. R. Dowdle. 1977. Legionnaires’ disease: isolation of a bacterium anddemonstration of its role in other respiratory disease. N. Engl. J. Med.297:1197–1203.

59. Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

60. Miyake, M., T. Watanabe, H. Koike, M. Molmeret, Y. Imai, and Y. AbuKwaik. 2005. Characterization of Legionella pneumophila pmiA, a geneessential for infectivity of protozoa and macrophages. Infect. Immun. 73:6272–6282.

61. Molmeret, M., O. A. Alli, S. Zink, A. Flieger, N. P. Cianciotto, and Y. A.Kwaik. 2002. icmT is essential for pore formation-mediated egress ofLegionella pneumophila from mammalian and protozoan cells. Infect. Im-mun. 70:69–78.

62. Molmeret, M., D. M. Bitar, L. Han, and Y. A. Kwaik. 2004. Cell biology ofthe intracellular infection by Legionella pneumophila. Microbes Infect.6:129–139.

63. Molofsky, A. B., and M. S. Swanson. 2004. Differentiate to thrive: lessonsfrom the Legionella pneumophila life cycle. Mol. Microbiol. 53:29–40.

64. Molofsky, A. B., and M. S. Swanson. 2003. Legionella pneumophila CsrA isa pivotal repressor of transmission traits and activator of replication. Mol.Microbiol. 50:445–461.

65. Nagai, H., and C. R. Roy. 2003. Show me the substrates: modulation of hostcell function by type IV secretion systems. Cell Microbiol. 5:373–383.

66. Pampou, S., I. Morozova, D. Hilbert, K. S. de Felipe, P. Morozov, J. J.Russo, H. A. Shuman, and S. Kalachikov. 2006. Analysis of gene expressionin Legionella during axenic growth and infection, p. 343–346. In N. P.Cianciotto (ed.), Legionella: state of the art 30 years after its recognition.ASM Press, Washington, DC.

67. Purcell, M., and H. A. Shuman. 1998. The Legionella pneumophilaicmGCDJBF genes are required for killing of human macrophages. Infect.Immun. 66:2245–2255.

68. Rasmussen, M. A., S. A. Carlson, S. K. Franklin, Z. P. McCuddin, M. T.Wu, and V. K. Sharma. 2005. Exposure to rumen protozoa leads to en-hancement of pathogenicity of and invasion by multiple-antibiotic-resistantSalmonella enterica bearing SGI1. Infect. Immun. 73:4668–4675.

69. Ridenour, D. A., S. L. Cirillo, S. Feng, M. M. Samrakandi, and J. D. Cirillo.2003. Identification of a gene that affects the efficiency of host cell infectionby Legionella pneumophila in a temperature-dependent fashion. Infect.Immun. 71:6256–6263.

70. Rowbotham, T. J. 1986. Current views on the relationships between amoe-bae, legionellae and man. Isr. J. Med. Sci. 22:678–689.

71. Roy, C. R., and R. R. Isberg. 1997. Topology of Legionella pneumophila



.org/D

ownloaded from

http://iai.asm.org/

DotA: an inner membrane protein required for replication in macrophages.Infect. Immun. 65:571–578.

72. Sadosky, A. B., L. A. Wiater, and H. A. Shuman. 1993. Identification ofLegionella pneumophila genes required for growth within and killing ofhuman macrophages. Infect. Immun. 61:5361–5373.

73. Samrakandi, M. M., S. L. Cirillo, D. A. Ridenour, L. E. Bermudez, and J. D.Cirillo. 2002. Genetic and phenotypic differences between Legionella pneu-mophila strains. J. Clin. Microbiol. 40:1352–1362.

74. Santic, M., and Y. Abu Kwaik. 2006. Legionella pneumophila can hijack theself-destruct system of macrophages. Microbe 1:185–191.

75. Sauer, J. D., M. A. Bachman, and M. S. Swanson. 2005. The phagosomaltransporter A couples threonine acquisition to differentiation and replica-tion of Legionella pneumophila in macrophages. Proc. Natl. Acad. Sci. USA102:9924–9929.

76. Segal, G., M. Feldman, and T. Zusman. 2005. The Icm/Dot type-IV secre-tion systems of Legionella pneumophila and Coxiella burnetii. FEMS Micro-biol. Rev. 29:65–81.

77. Segal, G., J. J. Russo, and H. A. Shuman. 1999. Relationships between anew type IV secretion system and the icm/dot virulence system of Legionellapneumophila. Mol. Microbiol. 34:799–809.

78. Segal, G., and H. A. Shuman. 1997. Characterization of a new regionrequired for macrophage killing by Legionella pneumophila. Infect. Immun.65:5057–5066.

79. Segal, G., and H. A. Shuman. 1998. Intracellular multiplication and humanmacrophage killing by Legionella pneumophila are inhibited by conjugalcomponents of IncQ plasmid RSF1010. Mol. Microbiol. 30:197–208.

80. Segal, G., and H. A. Shuman. 1999. Legionella pneumophila utilizes thesame genes to multiply within Acanthamoeba castellanii and human mac-rophages. Infect. Immun. 67:2117–2124.

81. Sexton, J. A., J. S. Pinkner, R. Roth, J. E. Heuser, S. J. Hultgren, and J. P.Vogel. 2004. The Legionella pneumophila PilT homologue DotB exhibitsATPase activity that is critical for intracellular growth. J. Bacteriol. 186:1658–1666.

82. Sexton, J. A., and J. P. Vogel. 2002. Type IVB secretion by intracellularpathogens. Traffic 3:178–185.

83. Shuman, H. A., M. Purcell, G. Segal, L. Hales, and L. A. Wiater. 1998.Intracellular multiplication of Legionella pneumophila: human pathogen oraccidental tourist? Curr. Topics Microbiol. Immun. 225:99–112.

84. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with genefusions. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

85. Skerrett, S. J., G. J. Bagby, R. A. Schmidt, and S. Nelson. 1997. Antibody-mediated depletion of tumor necrosis factor-alpha impairs pulmonary hostdefenses to Legionella pneumophila. J. Infect. Dis. 176:1019–1028.

86. Skerrett, S. J., and T. R. Martin. 1991. Alveolar macrophage activation inexperimental legionellosis. J. Immunol. 147:337–345.

87. Skerrett, S. J., R. A. Schmidt, and T. R. Martin. 1989. Impaired clearanceof aerosolized Legionella pneumophila in corticosteroid-treated rats: amodel of Legionnaires’ disease in the compromised host. J. Infect. Dis.160:261–273.

88. Stanley, E. R. 1997. Murine bone marrow-derived macrophages. MethodsMol. Biol. 75:301–304.

89. Steenbergen, J. N., H. A. Shuman, and A. Casadevall. 2001. Cryptococcusneoformans interactions with amoebae suggest an explanation for its viru-lence and intracellular pathogenic strategy in macrophages. Proc. Natl.Acad. Sci. USA 98:15245–15250.

90. Steinert, M., L. Emody, R. Amann, and J. Hacker. 1997. Resuscitation ofviable but nonculturable Legionella pneumophila Philadelphia JR32 byAcanthamoeba castellanii. Appl. Environ. Microbiol. 63:2047–2053.

91. Steinert, M., U. Hentschel, and J. Hacker. 2002. Legionella pneumophila: anaquatic microbe goes astray. FEMS Microbiol. Rev. 26:149–162.

92. Stone, B. J., and Y. A. Kwaik. 1999. Natural competence for DNA trans-formation by Legionella pneumophila and its association with expression oftype IV pili. J. Bacteriol. 181:1395–1402.

93. Sturgill-Koszycki, S., and M. S. Swanson. 2000. Legionella pneumophilareplication vacuoles mature into acidic, endocytic organelles. J Exp. Med.192:1261–1272.

94. Sun, A. N., A. Camilli, and D. A. Portnoy. 1990. Isolation of Listeria mono-cytogenes small-plaque mutants defective for intracellular growth and cell-to-cell spread. Infect. Immun. 58:3770–3778.

95. Swanson, M. S., and B. K. Hammer. 2000. Legionella pneumophilapathogenesis: a fateful journey from amoebae to macrophages. Annu.Rev. Microbiol. 54:567–613.

96. Swanson, M. S., and R. R. Isberg. 1996. Identification of Legionella pneu-mophila mutants that have aberrant intracellular fates. Infect. Immun.64:2585–2594.

97. Via, L. E., R. A. Fratti, M. McFalone, E. Pagan-Ramos, D. Deretic, and V.Deretic. 1998. Effects of cytokines on mycobacterial phagosome matura-tion. J. Cell Sci. 111:897–905.

98. Vogel, J. P., H. L. Andrews, S. K. Wong, and R. R. Isberg. 1998. Conjugativetransfer by the virulence system of Legionella pneumophila. Science 279:873–876.

99. Watarai, M., I. Derre, J. Kirby, J. D. Growney, W. F. Dietrich, and R. R.Isberg. 2001. Legionella pneumophila is internalized by a macropinocytoticuptake pathway controlled by the Dot/Icm system and the mouse Lgn1locus. J. Exp. Med. 194:1081–1096.

100. Wiater, L. A., A. B. Sadosky, and H. A. Shuman. 1994. Mutagenesis ofLegionella pneumophila using Tn903dIIlacZ: identification of a growth-phase-regulated pigmentation gene. Mol. Micro. 11:641–653.

101. Yamamoto, H., M. Sugiura, S. Kusunoki, T. Ezaki, M. Ikedo, and E.Yabuuchi. 1992. Factors stimulating propagation of Legionellae in coolingtower water. Appl. Environ. Microbiol. 58:1394–1397.

102. Yeo, H. J., and G. Waksman. 2004. Unveiling molecular scaffolds of the typeIV secretion system. J. Bacteriol. 186:1919–1926.

103. Zusman, T., O. Gal-Mor, and G. Segal. 2002. Characterization of a Legion-ella pneumophila relA insertion mutant and roles of RelA and RpoS invirulence gene expression. J. Bacteriol. 184:67–75.

Editor: D. L. Burns



.org/D

ownloaded from

http://iai.asm.org/

environmental mimics and the lvh type iva secretion system ... · infection and immunity, feb....

Documents