epigenetic activation of enoyl-coa reductase by an …€¦ · 104 (oswox11) could interact with...
TRANSCRIPT
![Page 1: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/1.jpg)
1
Short title: Epigenetic Control Regulates Wheat Wax Synthesis 1
Epigenetic Activation of Enoyl-CoA Reductase By An Acetyltransferase Complex Triggers Wheat 2
Wax Biosynthesis 3
4
Lingyao Kong,a,2 Pengfei Zhi,a,2 Jiao Liu,a Haoyu Li,a Xiaona Zhang,a Jie Xu,a Jiaqi Zhou,a Xiaoyu 5
Wang,a and Cheng Chang,a,3 6
a College of Life Sciences, Qingdao University, Qingdao 266071, China 7
8
1 This research was supported by the National Natural Science Foundation of China (31701412,9
31701986), the Natural Science Foundation of Shandong Province (ZR2017BC109) and the 10
Qingdao Science and Technology Bureau Fund (17-1-1-50-jch, 18-2-2-51-jch). 11
2 These authors contributed equally to the article. 12
3 Address correspondence to [email protected]. 13
Corresponding author: The author responsible for the distribution of materials integral to the 14
findings presented in this article following the policy described in the Instructions for Authors 15
(www.plantphysiol.org) is: Cheng Chang ([email protected].). 16
The authors have declared that no competing interests exist. 17
18
Author contributions: C.C., L.K., and P.Z. conceived project and designed research; L.K. and P.Z. 19
performed most of the experiments with help from J.L., H.L., X.Z., J.X., J.Z., and X.W.; C.C., L.K., and 20
P.Z. analyzed the data and wrote the article with assistance from J.L., H.L., X.Z., J.X., J.Z., and X.W.; 21
C.C. supervised the project and completed the writing. 22
23
One-sentence summary: 24
A transcriptional activator recruits a histone acetyltransferase complex that epigenetically regulates the 25
biosynthesis of wheat cuticular wax, which is essential for triggering the germination of the powdery 26
mildew pathogen. 27
28
29
30
Plant Physiology Preview. Published on May 21, 2020, as DOI:10.1104/pp.20.00603
Copyright 2020 by the American Society of Plant Biologists
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 2: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/2.jpg)
2
ABSTRACT 31
The epidermal surface of bread wheat (Triticum aestivum) is coated with a hydrophobic cuticular wax 32
layer that protects plant tissues against environmental stresses. However, the regulatory mechanism of 33
cuticular wax biosynthesis remains to be uncovered in bread wheat. Here, we identified wheat 34
Enoyl-CoA Reductase (TaECR) as a core component responsible for biosynthesis of wheat cuticular 35
wax. Silencing of TaECR in bread wheat resulted in a reduced cuticular wax load and attenuated conidia 36
germination of the adapted fungal pathogen powdery mildew (Blumeria graminis f.sp. tritici; Bgt). 37
Furthermore, we established that TaECR genes are direct targets of TaECR promoter-binding MYB 38
transcription factor 1 (TaEPBM1), which could interact with the adapter protein Alteration/Deficiency in 39
Activation 2 (TaADA2) and recruit the histone acetyltransferase General Control Non-derepressible 5 40
(TaGCN5) to TaECR promoters. Most importantly, we demonstrated that the 41
TaEPBM1-TaADA2-TaGCN5 ternary protein complex activates TaECR transcription by potentiating 42
histone acetylation and enhancing RNA polymerase II enrichment at TaECR genes, thereby contributing 43
to the wheat cuticular wax biosynthesis. Finally, we identified very-long-chain aldehydes as the wax 44
signals provided by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for triggering Bgt conidia 45
germination. These results demonstrate that specific transcription factors recruit the TaADA2-TaGCN5 46
histone acetyltransferase complex to epigenetically regulate biosynthesis of wheat cuticular wax, which 47
is required for triggering germination of the adapted powdery mildew pathogen. 48
Keywords: ECR, ADA2, GCN5, cuticular wax biosynthesis, wheat, Blumeria graminis f.sp. tritici 49
50
INTRODUCTION 51
The epidermal surfaces of aerial plant organs are coated with a hydrophobic layer, the cuticle, to 52
protect plant tissues against enormous environmental stresses such as desiccation, ultraviolet radiation, 53
excessive light, extreme temperatures, and even pathogen infections (Nawrath 2006; Samuels et al., 54
2008; Domínguez et al. 2017). Although the composition and structure of the cuticle vary among plant 55
species, organs, developmental stages, and even environmental conditions, plant cuticle generally 56
consists of a macromolecular scaffold of cutin impregnated by and covered with the cuticular wax 57
mixture (Nawrath et al., 2006; Fernández et al., 2016; Domínguez et al., 2017). Increasing evidence 58
reveals that many microbial pathogens have acquired the capacity to utilize the plant cuticular wax 59
components to initiate their pre-invasion and infection processes (Serrano et al., 2014; Aragón et al., 60
2017; Ziv et al., 2018). For instance, Medicago truncatula mutants with loss of abaxial epicuticular wax 61
exhibit retarded infection of two rust pathogens, Puccinia emaculata and Phakopsora pachyrhizi, during 62
pre-invasion processes (Uppalapati et al. 2012). 63
Cuticular wax is a mixture of very-long-chain (VLC, > C20) fatty acids and their derivatives, such as 64
aldehydes, alcohols, alkanes, ketones, and esters (Nawrath, 2006; Lee and Suh 2013; Yeats and Rose, 65
2013; Martin and Rose, 2014). It is well established in model plant Arabidopsis thaliana that cuticular 66
wax biosynthesis begins with the esterification of CoA to the plastid-derived C16 and C18 fatty acids by 67
long-chain acyl-CoA synthetase (AtLACS) proteins in the endoplasmic reticulum, and the generated C16 68
and C18 acyl-CoAs are elongated to VLC acyl-CoAs under the action of the fatty acid elongase (FAE) 69
complex and ECERIFERUM2 (AtCER2) proteins (Xia et al., 1996; Todd et al., 1999; Fiebig et al., 2000; 70
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 3: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/3.jpg)
3
Hooker et al., 2002; Schnurr et al., 2004; Zheng et al., 2005; Bach et al., 2008; Beaudoin et al., 2009; Lee 71
et al., 2009; Lu et al., 2009; Weng et al., 2010; Haslam et al., 2012; Haslam and Kunst, 2013; Kim et al., 72
2013; Haslam et al., 2015). The elongated VLC acyl-CoAs are then modified into aldehydes, alkanes, 73
secondary alcohols, and ketones by an alkane-forming pathway, or into primary alcohols and wax esters 74
by an alcohol-forming pathway (Aarts et al., 1995; Millar et al., 1999; Chen et al., 2003; Rowland et al., 75
2006; Greer et al., 2007; Rowland et al., 2007; Bourdenx et al., 2011; Bernard et al., 2012; Yang et al., 76
2017; Pascal et al., 2019). As a core component of fatty acid elongase complex, enoyl-CoA reductase 77
(ECR) catalyzes the final step in the biosynthesis of VLC acyl-CoAs (Zheng et al., 2005). In Arabidopsis 78
thaliana, silencing of AtECR results in a reduction of all cuticular wax compositions such as VLC fatty 79
acids, alcohols, aldehydes, alkanes, and ketones, suggesting that Arabidopsis AtECR gets involved in the 80
VLC acyl-CoAs biosynthesis (Zheng et al., 2005). Increasing research in Arabidopsis reveals that AtECR 81
expression is governed by multiple transcriptional regulators. For instance, the AtECR transcription is 82
up-regulated by the MYB type transcription factors such as AtMYB30 and AtMYB94, but negatively 83
regulated by the AP2/ERF-type transcription factor DECREASE WAX BIOSYNTHESIS (AtDEWAX) 84
in Arabidopsis (Raffaele et al., 2008; Go et al., 2014; Lee and Suh 2014). However, the biological 85
function and transcriptional regulation of ECR remain to be uncovered in important cereal crops such as 86
bread wheat (Triticum aestivum). 87
Chromatin modifications such as acetylation, methylation, and ubiquitination play important roles in 88
the regulation of transcriptional reprogramming associated with plant development and stress responses 89
(Jenuwein and Allis 2001; Strahl and Allis 2000). As important epigenetic modifications, trimethylation 90
of histone H3 lysine 4 and deubiquitination of histone H2B could induce a permissive chromatin 91
structure for gene activation (Kurdistani and Grunstein, 2003; Daniel et al. 2004; Schmitz et al. 2009). 92
Similarly, acetylation of histone lysine residues catalyzed by histone acetyltransferases (HAT) also 93
promotes gene transcription (Kurdistani and Grunstein, 2003). As the first HAT linked to gene 94
transcriptional activation, General Control Non-derepressible 5 (GCN5) interacts with the adaptor 95
protein Alteration/Deficiency in Activation 2 (ADA2) in the HAT module of the transcriptional 96
co-activator Spt-Ada-Gcn5-acetyltransferase (SAGA) complex, which is engaged in histone acetylation, 97
histone deubiquitination, and even recruitment of the RNA polymerase II (RNA Pol II) (Grant et al., 98
1997; Weake and Workman, 2012; Wang and Dent, 2014; Moraga and Aquea, 2015). The 99
Alteration/Deficiency in Activation 2-General Control Non-derepressible 5 (ADA2-GCN5) complex is 100
reported to function in concert with specific transcription factors (TFs) to regulate gene transcription 101
associated with plant development and response to environmental stresses in Arabidopsis, rice (Oryza 102
sativa), and even Populus trichocarpa. For instance, the rice WUSCHEL-RELATED HOMEOBOX11 103
(OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 104
crown root meristem in rice (Zhou et al., 2017). Similarly, the Populus transcription factor Abscisic 105
Acid-Responsive Element (PtAREB1) could recruit the ADA2-GCN5 complex to induce expression of 106
drought-responsive PtrNAC gene expression during drought stress (Li et al., 2018; Castroverde 2019). 107
However, to date, whether and how the TF-ADA2-GCN5 complex regulates the gene transcription 108
involved in the plant cuticular wax biosynthesis remains unknown. 109
As the causal agent of wheat powdery mildew disease, Blumeria graminis f.sp. tritici (Bgt) is the 110
airborne biotrophic fungal pathogen that is capable of infecting the important crop bread wheat, leading 111
to the wheat yield losses of 10% to 40% (Zhu et al., 2015; Zhang et al., 2016; He et al., 2018; Koller et al., 112
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 4: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/4.jpg)
4
2018; Xing et al., 2018; Zou et al., 2018; Zheng et al., 2020). On the aerial surface of wheat, the first 113
contact between Bgt and wheat takes place at the cuticle, and the Bgt conidia germination is induced to 114
initiate the infection processes (Nielsen et al., 2000; Wright et al., 2002). In bread wheat, silencing of 115
3-KETOACYL-CoA SYNTHASE (TaKCS6) and WAX INDUCER 1 (TaWIN1), two positive regulators in 116
wheat cuticular wax biosynthesis, results in a reduction of Bgt conidia germination, suggesting that the 117
cuticular wax biosynthesis is essential to stimulate the Bgt conidia germination in bread wheat (Kong and 118
Chang, 2018; Wang et al., 2019). However, the function of other components responsible for the wheat 119
cuticular wax biosynthesis in modulating Bgt conidia germination needs to be characterized. 120
In this study, we showed that wheat enoyl-CoA reductase (TaECR) is a core component responsible 121
for the cuticular wax biosynthesis in bread wheat. TaECR promoter-binding MYB transcription factor 1 122
(TaEPBM1) recruits the TaADA2-TaGCN5 histone acetylatransferase complex to activate TaECR 123
transcription by potentiating histone acetylation and enhancing RNA Pol II enrichment at TaECR genes 124
and thus stimulate the cuticular wax biosynthesis required for stimulating Bgt conidia germination. 125
Besides, VLC aldehydes were identified as the wax signals provided by the 126
TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for Bgt germination in bread wheat. Thus, we revealed 127
that the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit regulates the wheat cuticular wax biosynthesis 128
essential for the germination of powdery mildew fungus. 129
130
RESULTS 131
Characterization of the Enoyl-CoA Reductase (ECR) Gene in Bread Wheat 132
In this study, we are interested in exploring the function of the wheat Enoyl-CoA Reductase (ECR) 133
gene in regulating the cuticular wax biosynthesis required for stimulating Bgt conidia germination. To 134
this end, we first identified the wheat TaECR genes based on the sequence of the Arabidopsis AtECR 135
gene (AT3G55360) and the reference genome of the hexaploid bread wheat (International Wheat 136
Genome Sequencing Consortium 2018). Three highly conserved homologous sequences of TaECR 137
genes separately located on chromosomes 3AS, 3BS and 3DS were isolated from the hexaploid bread 138
wheat cultivar Jing411, and were designated as TaECR-A, TaECR-B, and TaECR-D (Supplemental Fig. 139
S1). The open reading frames (ORFs) of these TaECR genomic sequences all contained four exons and 140
three introns, encoding proteins with over 99% amino acid sequence identity (Supplemental Figs. S1). 141
To analyze the evolution of ECR in land plants, we employed protein sequences of TaECR as query 142
sequences to search the genomes of representative land plant species from the Joint Genome Institute 143
(JGI) Phytozome v12.1 database. As shown in Supplemental Figure S2, highly homologous ECR 144
proteins were obtained from all test plant species including the hornwort Marchantia polymorpha and 145
moss Physcomitrella patens, suggesting that ECR proteins might be evolutionarily conserved among 146
land plants. 147
Since the biosynthesis of cuticular wax mainly occurs in the endoplasmic reticulum (ER) in plant 148
epidermal cells, we first analyzed the localization of TaECR in ER. TaECR-YFP fusion proteins were 149
transiently co-expressed with mCherry-HDEL, an ER indicator, in Nicotiana benthamiana leaves. 150
Confocal microscopic images showed that the fluorescence signal of TaECR-YFP was co-localized with 151
that of mCherry-HDEL at ER, suggesting that TaECR proteins localize to the ER in N. benthamiana cells 152
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 5: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/5.jpg)
5
(Fig. 1A). In addition, we expressed TaECR-HA in the wheat protoplast and performed a sucrose 153
density-gradient fractionation to validate the ER-localization of TaECR in wheat cells. Since TaECR-A, 154
TaECR-B, and TaECR-D share more than 99% amino acid sequence identity, TaECR-A was selected as 155
a representative TaECR in this experiment. As shown in Supplemental Figure S3, TaECR-HA 156
cofractionated with the ER marker BiP and exhibited the same Mg2+-dependent density shift as the ER 157
marker BiP, further confirming the ER-localization of TaECR in bread wheat. Thereafter, the expression 158
profiles of TaECR were analyzed in different tissues of wheat cultivar Jing411 using reverse 159
transcription quantitative PCR (RT-qPCR). As shown in Figure 1B, TaECR exhibits the lowest 160
expression level in roots and the highest expression levels in epidermis of leaves and stems. Its 161
expression levels were much higher in leaves and stems than in roots (Fig. 1B). 162
To explore whether TaECR involved in the wheat cuticle biosynthesis is required for stimulating Bgt 163
conidia germination, we first conducted the barley stripe mosaic virus (BSMV) induced gene silencing 164
(BSMV-VIGS) to silence all endogenous TaECR genes, including TaECR-A, TaECR-B, and TaECR-D, 165
in wheat cultivar Jing411, and characterized the chemical composition of two major cuticle components, 166
cutin and cuticular wax, in wheat leaves about 15 days post-BSMV-infection through using gas 167
chromatography-mass spectrometry (GC-MS) (Supplemental Fig. S4). Compared with the mock control, 168
inoculation with BSMV-γ has no significant effect on the deposition of cutin and cuticular wax in bread 169
wheat (Supplemental Fig. S5). As shown in Figure 1C, the total cutin load was not significantly changed 170
by the silencing of TaECR, but the wax load decreased from 12.1 μg cm-2 on wild-type Jing 411 leaves to 171
a significant level of 2.6 μg cm-2 on TaECR-silenced wheat leaves. Further quantitative analysis of wax 172
constituents revealed that VLC fatty acids and their derivatives such as aldehydes, alcohols, alkanes, 173
ketone, and even C46-C50 esters showed a remarkable decrease in the TaECR-silenced plants (Fig. 1D). 174
Thereafter, the conidia germination of Bgt strain E09 was examined on leaves of wild-type and 175
TaECR-silenced plants using light microscopy. Compared with the mock control, inoculation with 176
BSMV-γ has no significant effect on Bgt conidia germination in bread wheat (Supplemental Fig. S5). As 177
shown in Figures 1 E and 1F, the Bgt conidia germination was affected on TaECR-silenced leaves, with 178
26% more conidia failing to germinate. Taken together, these results suggest that wheat TaECR, 179
resembling its homolog in Arabidopsis, acts as a core component responsible for the cuticular wax 180
biosynthesis and positively regulates the Bgt conidia germination in bread wheat. 181
182
TaEPBM1 Functions as a Transcriptional Activator of TaECR 183
To identify the transcriptional regulator that directly binds to TaECR promoters, we performed yeast 184
one-hybrid screening against a wheat leaf cDNA library using TaECR promoter regions as baits. One 185
R2R3 type MYB transcription factor was independently and repeatedly isolated as the binding protein of 186
the TaECR promoter, and designated as TaEPBM1 (for TaECR Promoter-Binding MYB transcription 187
factor 1). Three highly conserved homologous sequences of TaEPBM1 genes located on chromosomes 188
2AS, 2BS and 2DS were obtained from Jing411 and encode TaEPBM1-A, TaEPBM1-B, and 189
TaEPBM1-D with more than 96% amino acid sequence identity, among which, TaEPBM1-A was 190
selected as a representative TaEPBM1 in the following experiments (Supplemental Fig. S6). Previous 191
studies revealed that the R2R3 type MYB transcription factor could recognize multiple cis-elements 192
including MBS (CACCAT), which was present in the TaECR promoters. Electrophoretic mobility shift 193
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 6: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/6.jpg)
6
assay (EMSA) showed that TaEPBM1 exclusively associated with the wild-type MBS but not mutant 194
MBS fragments, suggesting that TaEPBM1 has the MBS-binding activity (Supplemental Fig. S7). Yeast 195
one-hybrid assays revealed that TaEPBM1 could bind to the wild-type TaECR promoters, but not the 196
MBS cis-element mutated TaECR promoters, suggesting that TaEPBM1 could recognize the MBS 197
cis-element and directly bind to TaECR promoters in yeast cells (Fig. 2A). 198
To examine whether TaEPBM1 could bind to TaECR promoters in plant cells, we employed the wheat 199
protoplast transfection system, in which luciferase (LUC) reporters containing wild-type or mutant 200
TaECR promoter regions were cotransfected with effector constructs over-expressing TaEPBM1 (Fig. 201
2B). As shown in Figure 2C, the LucA ratio obtained from LUC reporters containing wild-type TaECR 202
promoters increased to a significant level of above 4.8 in the presence of TaEPBM1, compared with the 203
basal LUC activity of the Gal4 DNA binding domain (DBD). In contrast, the LucA ratio obtained from 204
LUC reporters containing the MBS-mutated TaECR promoters was not significantly changed by the 205
addition of TaEPBM1 (Fig. 2C). This result suggests that TaEPBM1 could bind to TaECR promoters and 206
activate their expression in wheat cells. 207
To determine the association of TaEPBM1 with TaECR promoters in bread wheat, we generated an 208
antibody specifically against TaEPBM1 and performed chromatin immunoprecipitation (ChIP) assay in 209
Jing 411 leaves (Supplemental Fig. S8A). The wheat elongation factor 1 (TaEF1) gene was employed as 210
control. As shown in Figure 2D and E, two genomic regions (represented by 1 and 2) containing the MBS 211
cis-element in TaECR promoters were subjected to the ChIP assay and found to be enriched in DNA 212
samples precipitated with the α-TaEPBM1 antibody, suggesting that TaEPBM1 associated with TaECR 213
promoters in bread wheat. At the same time, nuclear run-on assays revealed that TaECR was transcribed 214
at much lower rates in the BSMV-TaEPBM1as infected wheat plants compared with BSMV-γ plants 215
(Fig. 2F). Consistent with this, TaECR mRNA levels significantly decreased by 75% in the 216
TaEPBM1-silenced wheat leaves compared with controls, suggesting that TaEPBM1 activates the 217
TaECR transcription (Fig. 2G). In contrast, the transcription rate and expression level of TaEF1 were not 218
affected by silencing of TaEPBM1 (Supplemental Fig. S9). Together, these results indicate that 219
TaEPBM1 is a bona fide transcriptional activator of TaECR in bread wheat. 220
221
TaEPBM1 Interacts with Transcriptional Adapter TaADA2 and Forms the TaEPBM1-TaADA2- 222
TaGCN5 Ternary Protein Complex at TaECR Promoters 223
To explore the molecular mechanism by which TaEPBM1 regulates TaECR transcription, we 224
performed a yeast two-hybrid screening against a wheat leaf cDNA library to identify 225
TaEPBM1-interacting proteins. One of the isolated interacting proteins was homologous to the rice 226
ADA2 (LOC_Os03g53960) and was designated as TaADA2. Three highly-homologous sequences of 227
TaADA2 genes located on chromosomes 5AL, 5BL and 5DL were obtained from Jing411 and encode 228
TaADA2-A, TaADA2-B, and TaADA2-D with more than 99% amino acid sequence identity, among 229
which, TaADA2-A was selected as a representative TaADA2 in the following experiments 230
(Supplemental Fig. S10). As shown in Figure 3A, the interaction between TaEPBM1 and TaADA2 was 231
detected in the EGY48 yeast cells. Further yeast two-hybrid analysis with truncated TaEPBM1 and 232
TaADA2 revealed that the C-terminal region of TaEPBM1 and the N-terminal region of TaADA2 were 233
responsible for their interaction (Fig. 3A). 234
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 7: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/7.jpg)
7
To validate the TaEPBM1-TaADA2 interaction, we performed both in vitro and in vivo protein 235
interaction assays. As shown in Figure 3B, GST-TaEPBM1, but not GST alone, could retain 236
TaADA2-His instead of TaGCN5-His in the GST pull-down assay, suggesting that TaEPBM1 directly 237
interacts with TaADA2 but not TaGCN5 in vitro. In the bimolecular fluorescence complementation 238
(BiFC) assay, YFP was reconstituted in the nucleus only in the co-expression pair of nYFP-TaEPBM1 239
and cYFP-TaADA2, but not in control pairs (Fig. 3C). In addition, we generated an antibody specifically 240
against TaADA2 and performed co-immunoprecipitation (co-IP) assay to analyze the 241
TaEPBM1-TaADA2 association in Jing 411 leaves (Supplemental Fig. S8B). As shown in Figure 3D, 242
TaEPBM1 was found co-immunoprecipitated with TaADA2, which was not detected in the TaEPBM1- 243
or TaADA2- silenced plants, suggesting that TaEPBM1 interacts with TaADA2 in bread wheat. 244
In yeast and plants, ADA2 interacts with GCN5 to constitute the ADA2-GCN5 complex (Grant et al., 245
1997; Weake and Workman, 2012; Wang and Dent, 2014; Moraga and Aquea, 2015; Zhou et al., 2017; 246
Li et al., 2018; Castroverde 2019). The finding that TaEPBM1 interacts with TaADA2 prompted us to 247
ask whether TaEPBM1, TaADA2, and TaGCN5 could form a complex. To this end, we first identified 248
the wheat TaGCN5 genes using the sequence of rice OsGCN5 gene (LOC_Os10g28040) as a query to 249
search the chromosome-based reference genome of the hexaploid bread wheat (International Wheat 250
Genome Sequencing Consortium 2018). Three highly conserved homologous sequences of TaGCN5 251
genes separately located on chromosomes 1AS, 1BS and 1DS were isolated from the hexaploid bread 252
wheat cultivar Jing411 and encode TaGCN5-A, TaGCN5-B, and TaGCN5-D with more than 99% amino 253
acid sequence identity, among which, TaGCN5-A was selected as a representative TaGCN5 in the 254
following protein interaction assays (Supplemental Fig. S11). To determine the association among 255
TaEPBM1, TaADA2, and TaGCN5, we conducted yeast two-hybrid, luciferase complementation 256
imaging (LCI) and BiFC assays. As shown in Figures 4, A, B, and C, TaADA2 interacts with TaGCN5 in 257
yeast and plant cells. Notably, the association of TaEPBM1 with TaGCN5 was observed in the presence 258
but not the absence of TaADA2, suggesting that TaADA2 could function as an adapter to bridge the 259
TaEPBM1-TaGCN5 interaction in plant cells (Fig. 4, B and C). Thereafter, we performed the co-IP assay 260
to determine whether TaEPBM1, TaADA2, and TaGCN5 could form a complex in vivo. As shown in 261
Figure 4D, TaEPBM1 and TaADA2 were coimmunoprecipitated with TaGCN5-HA, but not with 262
GFP-HA. Besides, the coimmunoprecipitation of TaEPBM1 with TaGCN5-HA was abrogated by the 263
silencing of TaADA2, indicating that TaEPBM1, TaADA2, and TaGCN5 could form a ternary complex, 264
in which TaADA2 functions as an adapter to bridge the interaction between TaEPBM1 and TaGCN5 265
(Fig. 4D). 266
Having already demonstrated that TaEPBM1 directly binds to TaECR promoters and TaEPBM1, 267
TaADA2 and TaGCN5 could form a complex, we next ask whether the TaEPBM1-TaADA2-TaGCN5 268
ternary protein complex associates with TaECR promoters in bread wheat. To test this hypothesis, we 269
co-transfected the wheat protoplast with TaGCN5-HA and RNAi constructs, and performed a 270
ChIP assay to characterize the distribution of TaGCN5-HA, TaADA2, and TaEPBM1 at TaECR 271
promoters (Fig. 5). TaGCN5-HA and TaADA2 were found enriched at the promoter regions of 272
TaECR-A, TaECR-B, and TaECR-D (Fig. 5, top and middle rows), in a pattern similar with that of 273
TaEPBM1 (Fig. 5, bottom row), suggesting that they associate with TaECR promoters as a ternary 274
complex. Notably, the levels of TaADA2 and TaGCN5-HA at TaECR promoter regions were 275
significantly reduced by the silencing of TaEPBM1 (Fig. 5, Supplemental Fig. S12). Also, the silencing 276
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 8: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/8.jpg)
8
of TaADA2 decreased the accumulation of TaGCN5-HA but not TaEPBM1 at TaECR promoters (Fig. 5, 277
Supplemental Fig. S12). Together, these results indicate that TaEPBM1 interacts with the adapter protein 278
TaADA2 and recruited TaADA2-TaGCN5 complex to TaECR promoters. 279
280
TaEPBM1-TaADA2-TaGCN5 Protein Complex Activates TaECR Transcription by Potentiating 281
Histone Acetylation and Enhancing RNA Pol II Enrichment at TaECR Genes 282
In yeast and other plants, the ADA2-GCN5 complex was reported to activate gene transcription 283
through enhancing histone acetylation and recruitment of the RNA polymerase II (Grant et al., 1997; 284
Weake and Workman, 2012; Wang and Dent, 2014; Moraga and Aquea, 2015; Zhou et al., 2017; Li et al., 285
2018; Castroverde 2019). The finding that TaEPBM1 recruits the TaADA2-TaGCN5 complex to TaECR 286
promoter regions led us to ask whether the complex regulates histone acetylation at TaECR promoters. 287
To this end, we separately silenced all endogenous TaEPBM1, TaADA2 and TaGCN5 genes using 288
BSMV-VIGS, and performed a ChIP assay to analyze histone acetylation such as H3K4ac, H3K9ac, 289
H3K14ac, H3K27ac, and H4K5ac at TaECR promoters (Supplemental Fig. S12). As shown in Figure 290
6A, the levels of H3K4ac, H3K9ac, H3K14ac, H3K27ac, and H4K5ac at TaECR promoters were 291
remarkably reduced by silencing of TaEPBM1, TaADA2 or TaGCN5, indicating that TaEPBM1, 292
TaADA2, and TaGCN5 mediate histone acetylation at TaECR promoters. Notably, simultaneous 293
silencing of TaEPBM1, TaADA2, and TaGCN5 failed to cause a further change in histone acetylation at 294
TaECR promoters, compared with single-silencing of TaEPBM1, TaADA2 or TaGCN5, which is 295
consistent with the fact that TaEPBM1, TaADA2, and TaGCN5 function in a ternary protein complex 296
(Fig. 6A). 297
Recent studies in P. trichocarpa revealed that the recruitment of ADA2-GCN5 complex enables the 298
enhancement of histone acetylation and enrichment of RNA polymerase II at PtrNAC genes for the 299
development of plant drought tolerance (Li et al., 2018). To examine the potential regulation of RNA Pol 300
II recruitment at TaECR genes by TaEPBM1-TaADA2-TaGCN5 protein complex, we separately 301
silenced all endogenous TaEPBM1, TaADA2, and TaGCN5 genes using BSMV-VIGS, and analyzed the 302
occupancy of total RNA Pol II at promoters and coding regions of TaECR genes using ChIP-qPCR assay 303
(Supplemental Fig. S12). Since allelic TaECR-A, TaECR-B, and TaECR-D shared over 95% nucleotide 304
sequence identity at coding regions, we chose TaECR-A as a representative TaECR gene in these 305
ChIP-qPCR assays (Fig. 6B, Supplemental Fig. S1). As shown in Figure 6C, the levels of total RNA Pol 306
II decreased by over 25% at promoters and coding regions of TaECR genes with the silencing of 307
TaEPBM1, TaADA2 or TaGCN5, suggesting that TaEPBM1, TaADA2, and TaGCN5 stimulate the RNA 308
Pol II recruitment at promoters and coding regions of TaECR genes. At the same time, nuclear run-on 309
assays revealed that TaECR was transcribed at much lower rates in the TaEPBM1, TaADA2 or TaGCN5- 310
silenced wheat leaves compared with controls (Fig. 6D; Supplemental Fig. S12). Consistent with this, 311
TaECR transcript levels decreased by over 70% in the wheat leaves infected with BSMV-TaEPBM1as, 312
BSMV-TaADA2as or BSMV-TaGCN5as compared with BSMV-γ plants (Fig. 6E; Supplemental Fig. 313
S12). Additionally, simultaneous silencing of TaEPBM1, TaADA2, and TaGCN5 failed to cause a further 314
change in RNA Pol II recruitment and transcription at TaECR genes, compared with single-silencing of 315
TaEPBM1, TaADA2 or TaGCN5, suggesting that TaEPBM1, TaADA2 and TaGCN5 function in a 316
protein complex to facilitate the RNA Pol II recruitment and activate the TaECR transcription (Fig. 6, C, 317
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 9: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/9.jpg)
9
D, and E; Supplemental Fig. S12). In contrast, the transcription rate and expression level of TaEF1 were 318
not affected by the silencing of TaEPBM1, TaADA2 or TaGCN5 (Supplemental Fig. S9). Taken together, 319
these results indicate that the TaEPBM1-TaADA2-TaGCN5 protein complex activates TaECR 320
transcription by potentiating histone acetylation such as H3K4ac, H3K9ac, H3K14ac, H3K27ac, and 321
H4K5ac, as well as enhancing RNA Pol II occupancy at TaECR genes. 322
323
Reduced Expression of TaEPBM1, TaADA2 or TaGCN5 in Bread Wheat Decreased the Cuticular 324
Wax Biosynthesis and Attenuated Bgt Germination 325
The findings that TaECR acts as a core component responsible for the cuticular wax biosynthesis and 326
that the TaEPBM1-TaADA2-TaGCN5 protein complex directly activates the TaECR transcription led us 327
to ask whether the TaEPBM1-TaADA2-TaGCN5 protein complex regulates the cuticular wax 328
biosynthesis in bread wheat. To examine this hypothesis, we separately silenced all endogenous 329
TaEPBM1, TaADA2 and TaGCN5 genes using BSMV-VIGS, and determined leaf cuticular wax load in 330
wheat leaves about 15 days post-BSMV-infection by GC-MS (Supplemental Fig. S12). As shown in 331
Figure 7A, the total cuticular wax load decreased by over 50% in TaEPBM1, TaADA2 or 332
TaGCN5-silenced wheat leaves compared with controls. Further quantitative analysis of wax 333
components revealed that VLC wax components including fatty acids, aldehydes, alcohols, alkanes, 334
ketones, and even C46-C50 esters all showed a significant decrease in the TaEPBM1, TaADA2 or 335
TaGCN5-silenced plants (Fig. 7B). Thereafter, the conidia germination of Bgt strain E09 was examined 336
on leaves of wild-type Jing411 and TaEPBM1, TaADA2 or TaGCN5-silenced plants. As shown in Figure 337
7C and 7D, Bgt conidia on TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves exhibit remarkably 338
decreased germination rates than did Bgt conidia on Jing411 wild-type wheat leaves. Notably, 339
simultaneous silencing of TaEPBM1, TaADA2, and TaGCN5 failed to cause a further decrease in 340
cuticular wax biosynthesis and Bgt conidia germination compared with single-silencing of TaEPBM1, 341
TaADA2 or TaGCN5. Taken together, these results support that TaEPBM1, TaADA2 and TaGCN5 342
function in a protein complex to activate the TaECR transcription and thus contribute to the cuticular wax 343
biosynthesis and Bgt germination. 344
345
VLC Aldehydes are the Wax Signals Provided by TaECR-TaEPBM1-TaADA2- TaGCN5 Circuit 346
for Stimulating Bgt Germination in Bread Wheat 347
Increasing evidence revealed that the cuticular wax provides signals for stimulating conidia 348
germination of powdery mildew fungus Blumeria graminis (Nielsen et al., 2000; Wright et al., 2002; 349
Weidenbach et al., 2014; Kong and Chang, 2018; Li et al., 2018; Wang et al., 2019). The finding that 350
TaECR-TaEPBM1- TaADA2-TaGCN5 circuit regulates both the cuticular wax biosynthesis and Bgt 351
conidia germination led us to ask whether the cuticular wax biosynthesis regulated by 352
TaECR-TaEPBM1-TaADA2 -TaGCN5 circuit is essential to Bgt conidia germination. To this end, we 353
manipulated the cuticular wax on TaECR, TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves by 354
spraying cuticular wax isolated from BSMV-γ control plants and then analyzed the Bgt conidia 355
germination. As shown in Figure 8A, the application of cuticular wax isolated from BSMV-γ plants 356
enabled the Bgt germination rates on the TaECR, TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves 357
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 10: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/10.jpg)
10
to increase by about 30%, a value nearly identical to that on BSMV-γ leaves. Similarly, Bgt germination 358
rates on the BSMV-γ leaves remarkably decreased in the presence of cuticular wax isolated from TaECR, 359
TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves (Fig. 8A). These results indicated that the 360
cuticular wax biosynthesis regulated by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit is required for 361
stimulating Bgt conidia germination in bread wheat. 362
363
Previous studies revealed that the physical properties, namely hydrophobicity, and chemical 364
composition of the cuticle determine the beginning of plant-fungi interaction (Aragón et al., 2017). To 365
analyze the hydrophobicity of leaf cuticle, we measured the contact angle of water droplets on the leaf 366
surface in wheat leaves separately infected with BSMV-TaECRas, BSMV-TaEPBM1as, 367
BSMV-TaADA2as, BSMV-TaGCN5as or BSMV-γ. As shown in Figure 8A, the leaf surfaces of 368
BSMV-γ plants showed contact angles about 153°, whereas the leaf surfaces of TaECR, TaEPBM1, 369
TaADA2 or TaGCN5-silenced plants exhibited contact angles less than 131°, indicating that silencing of 370
TaECR, TaEPBM1, TaADA2 or TaGCN5 led to reduced hydrophobicity in wheat leaf cuticle. Thereafter, 371
we employed a Formvar resin-based in vitro system, which could minimize the hydrophobicity 372
difference through providing highly homogeneous surfaces, to examine the Bgt conidia germination. As 373
shown in Figure 8B, glass slides covered with Formvar/ cuticular wax isolated from wheat leaves 374
infected with BSMV-γ, BSMV-TaECRas, BSMV-TaEPBM1as, BSMV-TaADA2as, or 375
BSMV-TaGCN5as exhibit nearly identical contact angles. The germination rate of Bgt conidia on glass 376
slides covered with Formvar/BSMV-γ cuticular wax is about 77%, but less than 59% Bgt conidia could 377
germinate on glass slides coated with the Formvar/ cuticular wax isolated from wheat leaves infected 378
with BSMV-TaECRas, BSMV-TaEPBM1as, BSMV-TaADA2as, or BSMV-TaGCN5as (Supplemental 379
Fig. S13)., suggesting that the chemical composition of cuticular wax was responsible for the difference 380
in Bgt germination rate between wild-type and TaECR, TaEPBM1, TaADA2 or TaGCN5-silenced plants. 381
To characterize the role of single wax components including aldehydes, fatty acids, alcohols, alkanes, 382
and even esters (which are reduced by silencing of TaECR, TaEPBM1, TaADA2, and TaGCN5), in 383
stimulating Bgt germination, we employed glass slides covered with Formvar/wheat cuticular wax 384
supplemented with corresponding synthetic chemicals and examined the Bgt conidia germination. As 385
shown in Figure 8B, a supplement of C26, C28 or C30-aldehyde could restore the Bgt germination penalty 386
on the glass slides coated with Formvar/cuticular wax isolated from the TaECR, TaEPBM1, TaADA2 or 387
TaGCN5-silenced plants, whereas addition of other synthetic wax components such as VLC fatty acid, 388
alkane, alcohol or alkyl ester failed to promote Bgt germination. Together, these results support that the 389
VLC aldehydes are the wax signals provided by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for 390
stimulating Bgt germination. 391
392
DISCUSSION 393
Powdery mildew caused by the biotrophic fungal pathogen Bgt seriously threatens wheat production. 394
Therefore, characterizing the molecular mechanism by which wheat genes regulate Bgt infection is vital 395
to breeding Bgt-resistant wheat. In this study, we explored the transcriptional regulation of wheat 396
cuticular wax biosynthesis required for stimulating Bgt conidia germination, and revealed that the 397
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 11: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/11.jpg)
11
transcription factor TaEPBM1 recruits TaADA2-TaGCN5 complex to activate transcription of TaECR, a 398
core gene controlling wheat cuticular wax biosynthesis, by enhancing histone acetylation and 399
RNA Pol II occupancy at TaECR gene, and thereby stimulating the cuticular wax biosynthesis essential 400
for Bgt conidia germination. 401
402
TaECR is a Core Component Responsible for the Wheat Cuticular Wax Biosynthesis 403
In previous studies, Enoyl-CoA Reductase (ECR) was revealed to function in the endoplasmic 404
reticulum (ER) to catalyze the reduction of the enoyl-CoA, the final step of VLC acyl-CoA elongation 405
(Kohlwein et al., 2001). Arabidopsis cer10 mutant disrupted in the AtECR gene exhibited reduced 406
cuticular wax load, indicating that ECR participates in VLC acyl-CoA’s elongation reactions in 407
Arabidopsis (Zheng et al., 2005). However, the biological function of ECR in other plants, especially the 408
important crops, is still unknown. In this study, we characterized the function of wheat TaECR, which 409
had more than 88% amino acid identities with Arabidopsis AtECR. Both confocal microscopy imaging 410
and sucrose density-gradient fractionation assay showed that TaECR was localized to the ER, the site of 411
cuticular wax biosynthesis. Tissue-specific analysis of TaECR transcription demonstrated that TaECR is 412
highly expressed in the epidermis of wheat leaves and stems, where the cuticular wax is accumulated. 413
Consistently, the silencing of TaECR in bread wheat led to a reduction in deposition of all cuticular wax 414
components such as VLC fatty acids, alcohols, aldehydes, alkanes, and ketones, suggesting that wheat 415
TaECR, resembling Arabidopsis AtECR, acts a core component responsible for the wheat cuticular wax 416
biosynthesis. 417
Increasing evidence revealed that the function of core components mediating the cuticular wax 418
biosynthesis is largely conserved among dicots and monocots. For instance, constitutive overexpression 419
of SHINE1 (SHN1) in bread wheat increased the content of cuticular wax constituents such as VLC 420
alkanes, aldehydes and primary alcohols, which is consistent with the results of overexpression of SHN1 421
in rice, Arabidopsis and even mulberry trees (Aharoni et al., 2004; Wang et al., 2012; Sajeevan et al., 422
2017; Bi et al., 2018). Similarly, disruption of 3-KETOACYL-CoA SYNTHASE 6 (KCS6) in Arabidopsis, 423
barley and wheat all led to the attenuated deposition of cuticular wax (Fiebig et al., 2000; Hooker et al., 424
2002; Weidenbach et al., 2014; Wang et al., 2019). However, in contrast to disruption of β-ketoacyl-CoA 425
Synthase (HvKCS1)-attenuated wax synthesis in barley, AtKCS1 has little affect on wax biosynthesis in 426
Arabidopsis, suggesting that some cuticle biosynthetic components have acquired divergent functions in 427
the evolution of dicots and monocots (Todd et al., 1999; Li et al., 2018). 428
429
TaEPBM1 Recruits the TaADA2-TaGCN5 Histone Acetyltransferase Complex to Activate 430
TaECR Transcription 431
In Arabidopsis, AtECR transcription is activated by the MYB type transcription factors such as 432
MYB30 and MYB94, and suppressed by the AP2/ERF-type transcription factor DEWAX (Raffaele et 433
al., 2008; Go et al., 2014; Lee and Suh 2014). Through employing multiple approaches such as EMSA, 434
yeast one-hybrid, and ChIP-qPCR assay, we demonstrated that the MYB type transcription factor 435
TaEPBM1 could recognize the MBS cis-element and directly bind to the promoters of TaECR genes. 436
Wheat protoplast transactivation assay and RT-qPCR revealed that TaEPBM1 acts as a transcriptional 437
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 12: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/12.jpg)
12
activator of TaECR. The closest homolog of TaEPBM1 in Arabidopsis was AtMYB96 with 41.3% 438
identity, suggesting potential functional conservation of the transcription factor in monocots and dicots. 439
In previous studies, multiple MYB type transcription factors, including the Arabidopsis MYB16, 440
MYB30, MYB94, MYB96, MYB106, maize GL3, and saltwater cress EsWAX1, were reported to 441
regulate cuticular wax biosynthesis (Avato et al., 1987; Raffaele et al., 2008; Seo et al., 2011; Liu et al., 442
2012; Oshima et al., 2013; Zhu et al., 2014; Lee and Suh, 2015b; Lee et al., 2016). Here, we found that 443
TaEPBM1 activates TaECR transcription and positively regulates wheat cuticular wax biosynthesis, 444
further implicating the essential role of MYB type transcription factors in the transcriptional regulation 445
of plant cuticular wax biosynthesis. 446
In yeast and plants, ADA2 and GCN5 are integrated into the histone acetylation (HAT) module of the 447
transcriptional activator complex SAGA, which comprises more than 20 subunits grouped into 4 448
modules, including the HAT module, histone deubiquitination module, coactivator architecture module, 449
and recruiting module (Grant et al., 1997; Weake and Workman, 2012; Wang and Dent, 2014; Moraga 450
and Aquea, 2015). Recent studies revealed that the ADA2-GCN5 complex activates gene transcription 451
through enhancing histone acetylation and recruitment of the RNA polymerase II in rice and P. 452
trichocarpa (Zhou et al., 2017; Li et al., 2018). Here, we showed that TaADA2 and TaGCN5 were 453
enriched at TaECR promoters in a similar pattern, and silencing of TaADA2 and TaGCN5 led to the 454
attenuated histone acetylations such as H3K4ac, H3K9ac, H3K14ac, H3K27ac, and H4K5ac, as well as 455
reduced RNA Pol II recruitment at TaECR genes, suggesting that the TaADA2-TaGCN5 HAT module 456
might directly regulate the TaECR transcription by potentiating histone acetylation and enhancing 457
RNA Pol II enrichment. Therefore, it will be intriguing to test whether other subunits or modules of 458
SAGA complex are involved in the epigenetic control of TaECR transcription and cuticle wax 459
biosynthesis in the future. 460
Increasing evidence revealed that the ADA2-GCN5 complex complex is recruited to the target 461
promoters through interaction with specific transcription factors, in which ADA2 proteins serve as an 462
adapter to bridge the association between ADA2-GCN5 complex and transcription factors. For instance, 463
the rice homeodomain transcription factor WOX11 directly interacts with rice ADA2 and recruits the 464
ADA2-GCN5 complex to target root-specific genes involved in cell proliferation of crown root meristem 465
(Zhou et al., 2017). Similarly, the Arabidopsis AP2 transcription factor CBF directly interacts with 466
ADA2 to activate transcription of cold-responsive genes (Mao et al., 2006). Recent research in P. 467
trichocarpa also revealed that the AREB1 transcription factor interacts with the ADA2-GCN5 complex 468
to regulate gene expression during drought stress (Li et al., 2018; Castroverde 2019). Through employing 469
multiple approaches such as yeast two-hybrid, GST pull-down, BiFC, co-IP, and ChIP-qPCR assay, we 470
demonstrated that the TaEPBM1 directly interacts with TaADA2 and recruits the TaADA2-TaGCN5 471
complex to TaECR promoters to activate TaECR transcription by enhancing histone acetylation and 472
RNA Pol II occupancy at TaECR genes. Silencing of TaEPBM1, TaADA2 or TaGCN5 resulted in the 473
attenuation of cuticular wax biosynthesis required for stimulating Bgt germination, suggesting that 474
TaEPBM1 recruits TaADA2-TaGCN5 complex to establish the epigenetic regulation of cuticular wax 475
biosynthesis required for triggering Bgt conidia germination in bread wheat. 476
477
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 13: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/13.jpg)
13
TaECR-TaEPBM1-TaADA2-TaGCN5 Circuit Regulates the Cuticular Wax Biosynthesis 478
Exploited by Bgt for Triggering Conidia Germination 479
It has been demonstrated that the fungal pathogen Blumeria graminis could utilize the plant cuticular 480
wax components to initiate its pre-penetration processes (Nielsen et al., 2000; Wright et al., 2002; 481
Weidenbach et al., 2014; Kong and Chang, 2018; Li et al., 2018; Wang et al., 2019). Additionally, VLC 482
aldehydes promote the in vitro conidia germination and appressorial development of B. graminis in a 483
dose-dependent manner (Hansjakob et al., 2010; Hansjakob et al., 2011; Kong and Chang, 2018; Wang et 484
al., 2019). Here, we showed that silencing of TaECR, TaEPBM1, TaADA2 or TaGCN5 in bread wheat 485
attenuated Bgt conidia germination, which was fully restored by application of cuticular wax isolated 486
from wild-type wheat leaves. Consistently, spraying of cuticular wax isolated from TaECR, TaEPBM1, 487
TaADA2 or TaGCN5-silenced leaves led to the reduced germination of Bgt conidia on wild-type wheat 488
leaves, indicating that the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit involved in the cuticular wax 489
biosynthesis has been exploited by Bgt for triggering conidia germination. Through using an in vitro 490
system based on Formvar-coated glass slides, we showed that application of synthetic VLC aldehydes, 491
but not other synthetic wax components such as VLC fatty acids, alkanes, alcohols or alkyl esters, could 492
overcome the Bgt germination penalty on cuticular wax isolated from TaECR, TaEPBM1, TaADA2 or 493
TaGCN5-silenced wheat leaves, suggesting that VLC aldehydes are the wax signals provided by the 494
TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for triggering Bgt conidia germination in bread wheat. 495
These results allowed us to establish a model about how the TaECR-TaEPBM1-TaADA2-TaGCN5 496
circuit regulates the cuticular wax biosynthesis required for stimulating Bgt conidia germination in bread 497
wheat. As shown in Figure 9, transcription factor TaEPBM1 recognizes the MBS cis-element and directly 498
targets TaECR, an essential gene in cuticular wax biosynthesis. Through directly interacting with the 499
adapter protein TaADA2, TaEPBM1 recruits the TaADA2-TaGCN5 histone acetyltransferase complex 500
to TaECR promoters, which lead to activation of TaECR transcription by potentiating histone acetylation 501
and enhancing RNA Pol II enrichment at TaECR genes. Consequently, the cuticular wax biosynthesis is 502
stimulated, leading to the accumulation of VLC aldehyde wax constituents and thereby triggering the 503
germination of Bgt conidia. Our findings support that the recruitment of the TaADA2-TaGCN5 histone 504
acetyltransferase complex by specific transcription factor plays an important role in the epigenetic 505
control of cuticular wax biosynthesis essential for stimulating Bgt conidia germination, and provide 506
insight for the improvement of wheat powdery mildew resistance in the future. 507
508
MATERIALS AND METHODS 509
Plant Materials and Fungal Inoculation 510
The cultivar Jing411 of common wheat (Triticum aestivum L.) and the isolate E09 of wheat powdery 511
mildew fungus (Blumeria graminis f. sp. tritici) were used for the wheat-powdery mildew interaction and 512
maintained under conditions as previously reported (Liu et al., 2019). The Bgt inoculation was performed 513
in the same condition. At 12 hours post-Bgt inoculation, wheat leaves were subjected to the microscopic 514
analysis of Bgt conidia germination as described by Kong and Chang (2018). 515
Subcellular Localization Analysis 516
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 14: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/14.jpg)
14
TaECR coding regions were amplified using primers listed in Supplemental Table S1 and cloned into 517
vector pCAMBIA1300-YFP via the pENTRY-TaECR construct using the GATEWAY cloning 518
technology and then transformed into the Agrobacterium tumefaciens strain GV3101. The 519
pCAMBIA1300-derivatives expressing the endoplasmic reticulum (ER) marker mCherry-HDEL were 520
also transformed into the A. tumefaciens strain GV3101. Nicotiana benthamiana plants used in this study 521
were grown in a growth chamber at 22°C with a 14/10 h light /dark photoperiod. N. benthamiana leaves 522
co-infiltrated with A. tumefaciens strain GV3101 expressing TaECR-YFP and mCherry-HDEL were 523
imaged using the confocal microscope (Leica TCS SP5) at 48 hours post-Agro-infiltration. 524
For the subcellular localization analysis in wheat protoplast, the TaECR coding region was amplified 525
using primers listed in Supplemental Table S1 and cloned into the pCAMBIA1300-HA vector via the 526
pENTRY-TaGCN5 construct using GATEWAY cloning technology to generate the fusion protein 527
TaECR-HA. The wheat protoplasts were prepared as previously described by Liu et al (2019). 10 µg 528
plasmid of pCAMBIA1300-TaECR-HA construct was mixed with 200 µl wheat protoplasts in 250 µl 529
PEG solution containing 40% (w/v) PEG4000, 0.2M mannitol, and 0.1M CaCl2 and kept 30 minutes in 530
the dark for transfection. After being washed three times with W5 solution (pH 5.7, 2 mM MES, 5 mM 531
KCl, 120 mM CaCl2 and 150 mM NaCl), the transformed protoplasts were cultured in W5 solution for at 532
least 48 hours for the sucrose density-gradient fractionation assay. The sucrose density-gradient 533
fractionation assay was performed as described previously (Chen et al., 2002). The antibodies α-HA 534
(Millipore, 05-904), α-BiP (Stressgen, SPA-818), and α-H+ ATPase (Agrisera, AS07260) were 535
employed for immunobloting. For confocal microsopy imaging and sucrose density-gradient 536
fractionation assays, three independent biological replicates were perfomed with consistent results. 537
Barley Stripe Mosaic Virus (BSMV)-mediated Silencing of TaECR, TaEPBM1, TaADA2, and 538
TaGCN5 539
For the BSMV-mediated gene silencing, fragments of TaECR, TaEPBM1, TaADA2, and TaGCN5 540
(approximately 200-bp) were amplified using primers listed in Supplemental Table S1 and cloned in the 541
antisense orientation into the pCa-γbLIC vector through the ligation independent cloning technique to 542
create the BSMV-TaECRas, BSMV-TaEPBM1as, BSMV-TaADA2as, and BSMV-TaGCN5as 543
constructs, respectively. The BSMV-mediated gene silencing was performed as described (Yuan et al., 544
2011). About 3 weeks post-inoculation with BSMV virus, nascent wheat leaves with visible BSMV 545
symptoms were subjected to cuticle chemical analysis and powdery mildew infection. 546
Cuticle Chemical Analysis 547
As described in previous studies, wheat leaves with virus symptoms about 15 d post-BSMV-infection 548
were subjected to wax analysis (Kong and Chang, 2018; Wang et al., 2019). For the cutin composition 549
analysis, lyophilized wheat leaves from at least 5 BSMV-VIGS wheat plants were delipidated in an 550
isopropanol-chloroform-methanol solution containing 0.01% (v/v) butylated hydroxytoluene. After 551
being dried under an N2 stream and weighed, the extracts were depolymerized into methyl esters in a 552
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 15: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/15.jpg)
15
reaction mixture containing methanol and methyl nonadecanoate. After extraction with dichloromethane 553
and dried under an N2 stream, the samples were derivatized with pyridine and bis-N,O- trimethylsilyl 554
trifluoroacetamide, and then subjected to GC-MS analysis as described previously (Kong and Chang, 555
2018). The oven temperature program was set at an initial temperature 75°C, increased to 200°C at 15°C 556
min-1, then increased to 280°C at 1.5°C min-1. Methyl nonadecanoate was added as the internal standard 557
for the FID peak-based quantification. 558
The cuticular wax composition analysis was performed as described by Hansjakob et al. (2010). 559
Briefly, wheat leaves from at least 5 BSMV-VIGS wheat plants were dipped into chloroform (Merck). 560
The extracts dried under N2 were derivatized at 70°C for 30 mins through reaction with bis-N,O- 561
trimethylsilyl trifluoroacetamide and analyzed by the same GC-MS column in cutin analysis, in which 562
H2 was used as the carrier gas. The oven temperature was programmed at an initial 50°C for 2min, 563
increased to 200°C at 40°C min-1, kept at 200°C for 2min, and then increased to 320°C at 3°C min-1, and 564
finally kept at 320°C for 30min. n-Tetracosane was added as an internal standard for the FID peak-based 565
quantification and Agilent/HP chemstation software (Agilent Technologies) were employed for the cutin 566
and wax compound identification. For cuticle chemical analysis, three biological replicates were 567
statistically analyzed. 568
Wheat Protoplast Transient Gene Silencing and Expression Assay 569
For the gene silencing in wheat protoplasts, 198-, 209-, 212-bp fragments of TaEPBM1, TaADA2 and 570
TaGCN5 were amplified using primers listed in Supplemental Table S1 and cloned in the antisense 571
orientation into the pIPKb007 vector via the pENTRY-RNAi-TaEPBM1as, 572
pENTRY-RNAi-TaADA2as, and pENTRY-RNAi-TaGCN5as constructs using GATEWAY cloning 573
technology to create the RNAi-TaEPBM1as, RNAi-TaADA2as, and RNAi-TaGCN5as constructs, 574
respectively. For gene expression in wheat protoplasts, the TaGCN5 coding region was amplified using 575
primers listed in Supplemental Table S1 and cloned into the pCAMBIA1300-HA vector via the 576
pENTRY-TaGCN5 construct using GATEWAY cloning technology to generate the fusion protein 577
TaGCN5-HA. 10 µg plasmids for RNAi and pCAMBIA1300-TaGCN5-HA constructs were 578
co-transfected into wheat protoplasts as previously described by Liu et al (2019). The transformed 579
protoplasts were cultured in W5 solution for at least 48 hours for the next gene expression analysis or 580
ChIP-qPCR assays. 581
For the wheat protoplast transactivation assay, the TaEPBM1 coding region was amplified using the 582
primers listed in Supplemental Table S1 and cloned into the vector pIPKb004 vector via the 583
pENTRY-TaEPBM1 construct using the GATEWAY cloning technology. Similarly, TaECR promoters 584
were amplified using the primers listed in Supplemental Table S1 and ligated into the vector 585
5XGAL4-LUC, which was then co-transfected with pIPKb004 derivatives and internal control pPTRL 586
into the wheat protoplast as previously described by Liu et al (2019). LUC activity was measured at 48 587
hours post-transfection using a Promega dual-luciferase reporter assay system (Promega, E1910) 588
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 16: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/16.jpg)
16
according to the manual. In wheat protoplast transactivation assay, three biological replicates were 589
statistically analyzed. 590
Gene Expression Analysis 591
For gene expression analysis, wheat leaves with visible BSMV symptoms were collected at 3 weeks 592
post-inoculation with indicated BSMV virus, and wheat protoplasts were harvested at 48 hours 593
post-transfection with indicated RNAi constructs. In the nuclear run-on assay for measuring gene 594
transcription rate, wheat cell nuclei were isolated and mixed with reaction buffer (25 mM biotin-16-UTP 595
and 0.75 mM of ATP, CTP, and GTP) for the transcription reaction as described by Ding et al (2012). 596
After RNA extraction using Trizol, the nascent RNA was enriched by streptavidin magnetic beads 597
(Invitrogen) and subjected to the RT-qPCR assay using the primers listed in Supplemental Table S1. For 598
the RT-qPCR assay, total RNA was extracted using Trizol reagent and treated with Dnase I for the 599
gDNA removal. 2μg RNA was then employed to synthesize the first-strand cDNA template using the 600
cDNA synthesis supermix (Transgen) according to the manual. RT-qPCR was performed using the 601
qPCR Master Mix (Invitrogen) under the following programs: 95°C for 3 min, 40 cycles at 95°C for 20 s, 602
55°C for 20 s, and 72°C for 15 s, followed by 72°C for 1 min. The expression levels of TaGADPH, 603
TaECR, TaEPBM1, TaADA2, and TaCHR729 were analyzed using the primers listed in Supplemental 604
Table S1 and the TaGADPH, whose expression is stable among various treatments, was used as the 605
internal control for reference. For the nuclear run-on and RT-qPCR assays, three biological replicates 606
were statistically analyzed. 607
Yeast One- and Two-Hybrid Experiments 608
In yeast one-hybrid analysis, the TaEPBM1 coding region was amplified using the primers listed in 609
Supplemental Table S1 and cloned into the vector pGADT7 via the pENTRY-TaEPBM1 construct using 610
GATEWAY cloning technology to generate protein fusions to the GAL4 transcription-activating domain 611
(AD). Similarly, TaECR promoters were amplified using the primers listed in Supplemental Table S1 612
and cloned into the vectors pHIS2, which were then co-transformed with pGADT7 derivatives into 613
competent cells of yeast strain Y187 according to the manual. Yeast transformants were then grown on 614
the SD/-Trp-Leu-His plate with 15% (w/v) 3-amino-1,2,4-triazole (3-AT) to test for HIS2 expression. In 615
yeast two-hybrid analysis, the coding fragments of TaEPBM1, TaADA2, and TaGCN5 were amplified 616
using primers listed in Supplemental Table S1 and separately cloned into the vectors pLexA and 617
pB42AD via the pENTRY-TaEPBM1, pENTRY-TaADA2, and pENTRY-TaGCN5 constructs using 618
GATEWAY cloning technology; these were co-transformed into competent cells of yeast strain EGY48 619
according to the Clontech Yeast Protocols Handbook. For the truncated TaEPBM1 and TaADA2 used in 620
the yeast two-hybrid assay, the TaEPBM1-NT(1-120), TaEPBM1-CT(121-314), TaADA2-NT(1-244), 621
and TaEPBM1-NT(245-568) were amplified using primers listed in Supplemental Table S1 and cloned 622
into the vectors pLexA and pB42AD. The pB42AD-derived prey wheat cDNA library was constructed 623
and screened as previously described by Liu et al (2019). Yeast transformants were grown on the 624
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 17: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/17.jpg)
17
SD/-Ura-Trp-Leu-His plate with X-gal to test for expression of LEU2 and LacZ. The yeast strains Y187 625
and EGY48 were maintained on YPAD and SD/-Ura medium, respectively. For the yeast one- and 626
two-hybrid experiments, at least three independent biological replicates were performed with consistent 627
results. 628
Electrophoretic Mobility Shift Assay (EMSA) 629
The TaEPBM1 coding region was amplified using the primers listed in Supplemental Table S1 and 630
cloned into the vector pET32, and TaEPBM1-His recombinant protein was expressed and purified from 631
E. coli using Ni-NTA resin according to the manual. The Pchn0 probe 632
(GGTCCATACACCATCTCTGTTGGGTCCATACACCATCTCTGTTGTCT) contains two copies of 633
wild type MBS cis-elements and flanking sequences from TaECR promoters. In the mutated Probe 634
mPchn0 (GGTCCATACACAATCTCTGTTGGGTCCATACACAATCTCTGTTGTCT), the MBS 635
cis-element CACCAT was replaced by CACCAT. Pchn0 and the mPchn0 probe were generated by 636
annealing oligonucleotides (see Supplemental Table S1 for sequence information) as described 637
previously (Su et al. 2015). The EMSA was performed as described by Kong and Chang (2018). The 638
DNA-protein complexes were visualized by exposing the resultant gel on the Phosphor screen for 8 639
hours. For the EMSA, at least three independent biological replicates were performed with similar 640
results. 641
Pull-Down Assay 642
For pull-down assays, the TaEPBM1 coding region was amplified using the primers listed in 643
Supplemental Table S1 and cloned into the vector pGEX4T-1 to generate the fusion protein 644
GST-TaEPBM1, while the coding regions of TaADA2 and TaGCN5 were amplified using the primers 645
listed in Supplemental Table S1 and cloned into the vector pET32 to create proteins fusions to the 646
His-tag. The pull-down assay was performed as described by Wang et al (2019). Briefly, the recombinant 647
proteins with GST and His tags were expressed and purified from E.coli using glutathione sepharose and 648
Ni-NTA resin according to the manual. Recombinant proteins with GST and His tags were mixed as 649
pairs indicated and incubated with glutathione sepharose, and then subjected to the 650
centrifugation-assisted precipitation. After being washed five times with PBS buffer, the precipitates 651
were subjected to SDS-PAGE separation, and the co-precipitation of TaADA2-His or TaGCN5-His with 652
GST or GST-TaEPBM1 was resolved by immunoblotting with α-His antibody (CWBIO, CW0286). For 653
the pull-down assays, at least three independent biological replicates were performed with similar 654
results. 655
Bimolecular Fluorescence Complementation (BiFC) Assay 656
For BiFC assays, coding regions of TaEPBM1, TaADA2, and TaGCN5 were amplified using primers 657
listed in Supplemental Table S1 and cloned into vectors pCAMBIA1300-YN and pCAMBIA1300-YC 658
via the pENTRY-TaEPBM1, pENTRY-TaADA2, and pENTRY-TaGCN5 constructs using GATEWAY 659
cloning technology to express protein fusions to the N-terminal or C-terminal domain of YFP, 660
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 18: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/18.jpg)
18
respectively. Similarly, the TaADA2 coding region was amplified using primers listed in Supplemental 661
Table S1 and cloned into vectors pCAMBIA1300 to express TaADA2 alone. The BiFC assay was 662
performed as described by Liu et al (2019). The interaction was imaged using a confocal microscope 663
(Leica TCS SP5) at 48 hours post-Agro-infiltration. All BiFC images were collected on a Leica TCS SP5 664
confocal laser scanning system (Leica, Mannheim, Germany) connected to an inverted motorized 665
microscope with the following settings: pinhole 1 airy unit, scan speed 400 Hz bidirectional. DAPI and 666
YFP were excited with a 405 nm diode laser and a 514 nm argon laser, respectively. Fluorescence 667
emissions were collected using the following wavelengths: 420–480nm (for DAPI) and 529–540nm (for 668
YFP). Digital confocal images were analyzed using Adobe Photoshop (Version CS5) and adjusted with 669
ImageJ (Version 1.38) for the optimized intensity projection. At least three independent biological 670
replicates were performed for this BiFC assay. 671
Co-immunoprecipitation (Co-IP) Assay 672
For the Co-IP assay, wheat leaves with visible BSMV symptoms were collected at 3 weeks 673
post-inoculation with indicated BSMV virus, and wheat protoplasts were harvested at 48 hours 674
post-transfection with indicated constructs. The Co-IP assay was performed as described by Wang et al. 675
(2019). The nuclear extracts were treated with DNase I to remove the potential DNA-protein interaction 676
during the Co-IP. The epitope sequences SAFEYDRKPAVLAPD and SGHKTNRPMKLETDGS were 677
chosen and synthesized, coupled to keyhole limpet hemocyanin, and immunized mice to generate 678
antibodies against TaEPBM1 and TaADA2, respectively. The antibody specificities were analyzed by 679
Western-blot assay against total leaf protein isolated from indicated BSMV-VIGS plants (shown in 680
Supplemental Fig. S8). The antibodies α-HA (Millipore, 05-904), α-TaEPBM1, and α-TaADA2 were 681
employed for immunoprecipitation. The co-immunoprecipitation of TaEPBM1, TaADA2, and TaGCN5 682
was analyzed by immunoblot with antibodies α-HA (Millipore, 05-904), α-TaEPBM1, and α-TaADA2. 683
The ECL chemiluminescence kit (Pierce Biotechnology) was employed for the immunoblot 684
visualization. For the Co-IP assay, at least three independent biological replicates were perfomed with 685
similar results. 686
Luciferase Complementation Imaging (LCI) Assay 687
For LCI assay, coding regions of TaEPBM1, TaADA2, and TaGCN5 were amplified using primers 688
listed in Supplemental Table S1 and cloned into vectors pCAMBIA-nLUC and pCAMBIA-cLUC via the 689
pENTRY-TaEPBM1, pENTRY-TaADA2, pENTRY-TaGCN5 constructs using GATEWAY cloning 690
technology to express protein fusions to the N-terminal or C-terminal domain of firefly LUCIFERASE, 691
respectively. The LCI assay was performed as described by Kong and Chang (2018). The luminescent 692
signal was collected at 60 hours post-Agro-infiltration trough using a cooled CCD camera (iXon, 693
Andor Technology). At least three independent biological replicates were performed for this LCI assay. 694
Chromatin Immunoprecipitation (ChIP) Assay 695
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 19: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/19.jpg)
19
For the ChIP assay, wheat leaves and protoplasts were harvested at the same time as for the Co-IP 696
assay. The ChIP assay was performed as described by Wang et al (2019). The antibodies α-HA 697
(Millipore, 05-904), α-TaEPBM1, α-TaADA2, α-histone H3 (Abcam, ab1791), α-H3K4ac (Millipore, 698
07-539), α-H3K9ac (Abcam, ab10812), α-H3K14ac (Abcam, ab46984), α-H3K27ac (Abcam, ab4729), 699
α-H4K5ac (Millipore, 07-327), and α-Pol II (Abcam, ab817) were employed for the 700
immunoprecipitation. DNA recovery after chromatin immunoprecipitation was quantified as the 701
percentage of input. For H3K4ac, H3K9ac, H3K14ac, and H3K27ac analysis, relative enrichments were 702
calculated by normalizing the histone H3 acetylation ChIP with histone H3 ChIP. For H4K5ac analysis, 703
relative enrichments were calculated by normalizing the histone H4 acetylation ChIP with histone H4 704
ChIP. The ChIP-qPCR was performed using qPCR Master Mix (Invitrogen) under the following 705
programs: 95°C for 3 min, 40 cycles at 95°C for 20 s, 55°C for 20 s, and 72°C for 15 s, followed by 72°C 706
for 1 min. For the ChIP assay, three biological replicates were statistically analyzed. 707
Characterization and Manipulation of Leaf Surface and Glass Slide 708
The cuticle hydrophobicity on the wheat leaf surface and glass slide was analyzed by measuring the 709
contact angle of 1 μL water droplets on the indicated surface. Angles from at least 50 water droplets were 710
separately measured for 5s using the contact angle system (SDP-300, Sindin) and five independent 711
surface samples were statistically analyzed using Student’s t-test. The cuticle wax on the wheat leaf 712
surface and glass slide were manipulated as described previously (Hansjakob et al., 2011, Wang et al., 713
2019). Briefly, wheat leaves were sprayed with cuticular wax extracts in chloroform at 480 μg mL-1 or 714
chloroform only (control). Histobond glass slides (Marienfeld) were coated with chloroform solution 715
containing 0.5% (w/v) Formvar resin (Applichem) and leaf cuticular wax extract (480 μg ml-1) or wax 716
chemical components (7×10-5 mol l-1). For this study, VLC aldehydes were synthesized from VLC 717
alcohols as previously described, and other wax chemical components were purchased from 718
Sigma-Aldrich. At least three independent biological replicates were performed with similar results. 719
Accession Numbers 720
Sequence data in this study can be found in the GenBank database using the following accession 721
numbers: AcECR, MT181952; AfECR, MT181953; AtECR, At3g55360; BdECR, MT181954; MpECR, 722
MT181955; OsECR, MT181956; PpECR, MT181957; PsECR, MT181958; ScECR, MT181959; SfECR, 723
MT181960; SlECR, MT181961; SmECR, MT181962; TaECR-A, MT180310; TaECR-B, MT180311; 724
TaECR-D, MT180312; TaEPBM1-A, MT211783; TaEPBM1-B, MT211784; TaEPBM1-D, MT211785; 725
TaADA2-A, MT180316; TaADA2-B, MT180317; TaADA2-D, MT180318; TaGCN5-A, MT180319; 726
TaGCN5-B, MT180320; and TaGCN5-D, MT180321. 727
728
Supplemental Data 729
The following supplemental materials are available. 730
Supplemental Figure S1 The nucleotide sequences, structures and encoding proteins of TaECR genes. 731
Supplemental Figure S2 Protein sequence alignment of TaECR with putative orthologs from 732
representative land plant lineages. 733
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 20: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/20.jpg)
20
Supplemental Figure S3 Subcellular localization analysis of TaECR-HA in wheat cells by sucrose 734
density-gradient fractionation. 735
Supplemental Figure S4 RT-qPCR analysis of TaECR expression in the wheat leaves separately 736
infected with BSMV-γ and BSMV-TaECRas. 737
Supplemental Figure S5 Analysis of cuticle chemical composition and Bgt conidia germination on the 738
wheat leaves treated with mock control and BSMV-VIGS. 739
Supplemental Figure S6 The nucleotide sequences and encoding proteins of TaEPBM1 genes. 740
Supplemental Figure S7 EMSA analysis of TaEPBM1 binding to the MBS cis-element. 741
Supplemental Figure S8 Immunoblot analysis of wheat leaf protein using antibodies α-TaEPBM1 and 742
α-TaADA2. 743
Supplemental Figure S9 Nuclear run-on analysis of TaEF1 transcription and RT-qPCR analysis of 744
TaEF1 expression in the wheat leaves infected with BSMV-γ, BSMV-TaEPBM1as, BSMV-TaADA2as, 745
or BSMV-TaGCN5as. 746
Supplemental Figure S10 The nucleotide sequences and encoding proteins of TaADA2 genes. 747
Supplemental Figure S11 The nucleotide sequences and encoding proteins of TaGCN5 genes. 748
Supplemental Figure S12 RT-qPCR analysis of expression of TaGCN5, TaADA2, and TaEPBM1 in 749
wheat protoplasts and leaves. 750
Supplemental Figure S13 Statistical analysis of Bgt conidia germination on glass slides coated with 751
Formvar/cuticular wax (480 μg ml-1) with indicated contact angles. 752
Supplemental Table S1 Primers used in this study. 753
ACKNOWLEDGMENTS 754
We would like to thank the funding support from the National Natural Science Foundation of China 755
(31701412, 31701986), the Natural Science Foundation of Shandong Province (ZR2017BC109) and the 756
Qingdao Science and Technology Bureau Fund (17-1-1-50-jch, 18-2-2-51-jch). 757
758
FIGURE LEGENDS 759
Figure 1. Characterization of TaECR in bread wheat. A, Subcellular co-localization of TaECR-YFP with 760
Endoplasmic reticulum (ER) marker mCherry-HDEL in Nicotiana benthamiana leaves. YFP 761
fluorescence signal of TaECR-YFP merged with the mCherry signal of the ER marker. Bars= 10 μm. B, 762
Transcriptional profiles of TaECR in different wheat tissues. The relative transcript abundance of TaECR 763
was compared with that in roots. C, Quantification of total cutin monomer and wax per unit surface area 764
(μg cm-2) in the BSMV-γ and BSMV-TaECRas wheat leaves. D, Amount of major wax constituents per 765
unit surface area (μg cm-2) in the wheat leaves infected with BSMV-γ and BSMV-TaECRas. N. I., not 766
identified compound. E, Bgt germination on the BSMV-γ and BSMV-TaECRas wheat leaves. Black 767
arrows indicate successfully germinated conidia with a germ tube, and red arrow indicates the 768
non-germinated conidia without germ tube. Bars= 30 μm. F, Statistical analysis of Bgt conidia 769
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 21: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/21.jpg)
21
germination on the wheat leaves infected with BSMV-γ or BSMV-TaECRas. More than 10 770
BSMV-VIGS plants were employed for inoculation of Bgt conidia and at least 500 Bgt conidia were 771
analyzed for each experiment. For B, C, D, and F, three biological replicates were statistically analyzed 772
for each treatment, and data are presented as the mean±SE (Student’s t-test; ** P<0.01). 773
774
Figure 2. Transcription factor TaEPBM1 binds to TaECR promoters. A, TaEPBM1 binds to TaECR 775
promoters in yeast. Yeast cells were co-transformed with a bait vector, harboring a wild type or mutated 776
TaECR promoter fragment (labeled as pro and mpro) fused to the pHIS2 reporter, and a prey vector, 777
containing TaEPBM1 fused to a GAL4 activation domain, and were then grown on SD-Trp-Leu-His 778
plate with 15% (w/v) 3-AT to test for HIS2 expression. Optical density (OD) of diluted culture for each 779
spot is shown at the top of the panel. B, Schematic diagram of the reporter constructs harboring a 780
wild-type or mutated TaECR promoter fragment (labeled as pro and mpro) fused to the 5xGAL4 781
upstream activating sequences (UAS) and the reporter gene firefly LUCIFERASE (LUC). C, 782
Transactivation of TaECR by TaEPBM1 in wheat protoplast. Indicated pairs of effectors and LUC 783
reporters were transfected into the wheat protoplasts, and the LUC activity was measured and expressed 784
as a ration of LUC activity normalized to that obtained from protoplasts expressing DBD effectors. D, 785
Schematic diagram of TaECR promoter structures. MBS cis-element is shown as a blue box, and 786
promoter regions subjected to ChIP-qPCR analysis are labeled with numbers. Black triangle indicates 787
the start point of coding region of TaECR gene. E, ChIP-qPCR analysis of TaEPBM1 enrichment at 788
TaECR promoters in the wheat leaves infected with BSMV-γ or BSMV-TaEPBM1as. Antibody 789
α-TaEPBM1 was used for immunoprecipitation. Nuclear run-on analysis of TaECR transcription (F) and 790
RT-qPCR analysis of TaECR expression (G) in the wheat leaves infected with BSMV-γ and 791
BSMV-TaEPBM1as. For C, E, F, and G, three biological replicates were statistically analyzed for each 792
treatment, and data are presented as the mean±SE (Student’s t-test; ** P<0.01). (t-test; ** P<0.01). 793
794
Figure 3. TaEPBM1 directly interacts with TaADA2 in vitro and in vivo. A, Yeast two-hybrid analysis 795
of the interaction between TaEPBM1 and TaADA2. Different fragments of TaEPBM1 and TaADA2 796
were fused with AD and LexA vectors and cotransformed into the yeast cells. TaEPBM1 NT and CT 797
represent the N-terminal region (1-120) and C-terminal region (121-314) of TaEPBM1, whereas 798
TaADA2 NT and CT indicate the N-terminal region (1-244) and C-terminal region (245-568) of 799
TaADA2. The transformants were grown on the SD-Ura-Trp-Leu-His plate with X-gal to test for 800
expression of LEU2 and LacZ. B, GST pull-down analysis of the interaction of TaEPBM1 and TaADA2. 801
GST-TaEPBM1 or GST protein bound on GST affinity resins was incubated with TaADA2-His and 802
TaGCN5-His, and the bound protein was then detected by immunoblotting using an anti-His antibody. C, 803
BiFC analysis of the interaction between TaEPBM1 and TaADA2 in N. benthamiana leaves. The nuclei 804
were revealed by DAPI staining. The YFP fluorescence signals were detected 40 hours 805
post-Agro-infiltration. Bars= 100 μm. D, Co-IP analysis of the interaction of TaEPBM1 and TaADA2. 806
Nuclear protein was extracted from wheat leaves infected with indicated BSMV-γ, BSMV-TaEPBM1as, 807
BSMV-TaADA2as, or BSMV-TaEPBM1/TaADA2as. Antibodies α-TaEPBM1 and α-TaADA2 were 808
used for immunoprecipitation and Western-blot assays. 809
Figure 4. TaGCN5-TaADA2 complex interacts with TaEPBM1. A, Yeast two-hybrid analysis of the 810
interaction among TaGCN5, TaADA2, and TaEPBM1. The yeast transformants were grown on the 811
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 22: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/22.jpg)
22
SD-Ura-Trp-Leu-His medium with X-gal to test for interaction analysis. B, LCI analysis of the 812
interaction among TaGCN5, TaADA2, and TaEPBM1 in N. benthamiana leaves. Bars= 1 cm. C, BiFC 813
analysis of the interaction among TaGCN5, TaADA2, and TaEPBM1 in N. benthamiana leaves. The 814
nuclei were revealed by DAPI staining. The YFP fluorescence signals were detected 40 hours 815
post-Agro-infiltration. Bars= 100 μm. D, Co-IP analysis of the interaction among TaGCN5, TaADA2, 816
and TaEPBM1 in wheat cells. Nuclear protein was extracted from wheat protoplasts transfected with 817
indicated vectors. Antibodies α-HA, α-TaADA2, and α-TaEPBM1 were used for immunoprecipitation 818
and Western-blot assays. 819
Figure 5. Distribution of TaGCN5-HA, TaADA2, and TaEPBM1 on TaECR promoters in wild-type and 820
TaEPBM1-, TaADA2 or TaGCN5-silenced wheat cells. The distribution of TaGCN5-HA (upper panel), 821
TaADA2 (middle panel) and TaEPBM1 (lower panel) on TaECR promoters in wheat protoplasts were 822
analyzed by ChIP-qPCR. Wheat protoplasts were cotransfected with construct TaGCN5-HA together 823
with RNAi-EV (dark), RNAi-TaEPBM1as (grey), RNAi-TaADA2as (light grey) or RNAi-TaGCN5as 824
(white). Antibodies α-HA, α-TaADA2, and α-TaEPBM1 were used for immunoprecipitation. Three 825
independent biological replicates per treatment were statistically analyzed, and data are presented as the 826
mean±SE (Student’s t-test; ** P<0.01). 827
828
Figure 6. Characterization of histone acetylation, RNA polymerase II occupancy and gene transcription 829
at TaECR loci in wild-type and TaEPBM1-, TaADA2- or TaGCN5-silenced wheat leaves. A, ChIP-qPCR 830
analysis of abundance of H3K4ac, H3K9ac, H3K14ac, H3K27ac, and H4K5ac on TaECR promoters in 831
the wheat leaves infected with BSMV-γ (dark), BSMV-TaEPBM1as (dark grey), BSMV-TaADA2as 832
(grey), BSMV-TaGCN5as (light grey) or BSMV-TaEPBM1as + BSMV-TaADA2as + 833
BSMV-TaGCN5as + BSMV-TaECRas (white). Antibodies α-H3K4ac, α-H3K9ac, α-H3K14ac, 834
α-H3K27ac, α-H4K5ac were used for immunoprecipitation. Fragments for ChIP-qPCR analysis were 835
shown in Figure 2D. B, Schematic diagram of the TaECR gene structure. Fragments subjected to 836
ChIP-qPCR analysis are labeled with numbers. Black triangle indicates the start point of coding region 837
of TaECR gene. C, ChIP-qPCR analysis of RNA Pol II abundance on promoters and coding regions of 838
TaECR genes in the BSMV-γ (dark), BSMV-TaEPBM1as (dark grey), BSMV-TaADA2as (grey), 839
BSMV-TaGCN5as (light grey) or BSMV-TaEPBM1as + BSMV-TaADA2as + BSMV-TaGCN5as + 840
BSMV-TaECRas (white) wheat leaves. Nuclear run-on analysis of TaECR transcription rates (D) and 841
RT-qPCR analysis of TaECR expression levels (E) in the wheat leaves infected with BSMV-γ, 842
BSMV-TaEPBM1as, BSMV-TaADA2as, BSMV-TaGCN5as or BSMV-TaEPBM1as + 843
BSMV-TaADA2as + BSMV-TaGCN5as + BSMV-TaECRas. For A, C, D, and E, three independent 844
biological replicates per treatment were statistically analyzed, and data are presented as the mean±SE 845
(Student’s t-test; ** P<0.01). 846
847
Figure 7. Characterization of cuticle chemical composition and Bgt conidia germination on wild-type 848
and TaEPBM1-, TaADA2- or TaGCN5-silenced wheat leaves. A, Quantification of total cuticular wax 849
per unit surface area (μg cm-2) in the wheat leaves infected with BSMV-γ (grey), BSMV-TaEPBM1as 850
(blue), BSMV-TaADA2as (green), BSMV-TaGCN5as (orange) or BSMV-TaEPBM1as + 851
BSMV-TaADA2as + BSMV-TaGCN5as (yellow). B, Amount of major wax constituents per unit surface 852
area (μg cm-2) in the BSMV-γ (grey), BSMV-TaEPBM1as (blue), BSMV-TaADA2as (green), 853
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 23: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/23.jpg)
23
BSMV-TaGCN5as (orange) or BSMV-TaEPBM1as + BSMV-TaADA2as + BSMV-TaGCN5as (yellow) 854
infected wheat leaves. N. I., not identified compound. C, Bgt germination on the wheat leaves infected 855
with BSMV-γ, BSMV-TaEPBM1as, BSMV-TaADA2as, BSMV-TaGCN5as or BSMV-TaEPBM1as + 856
BSMV-TaADA2as + BSMV-TaGCN5as. Black arrows indicate successfully germinated conidia with a 857
germ tube, and red arrows indicate the non-germinated conidia without germ tube. Bars= 30 μm. D, 858
Statistical analysis of Bgt conidia germination on the BSMV-γ (dark grey), BSMV-TaEPBM1as (dark 859
blue), BSMV-TaADA2as (dark green), BSMV-TaGCN5as (dark orange) or BSMV-TaEPBM1as + 860
BSMV-TaADA2as + BSMV-TaGCN5as (dark yellow) infected wheat leaves. More than 10 861
BSMV-VIGS plants were employed for inoculation of Bgt conidia and at least 500 Bgt conidia were 862
analyzed for each experiment. For A, B, and D, three biological replicates were statistically analyzed for 863
each treatment, and data are presented as the mean±SE (Student’s t-test; ** P<0.01). 864
865
Figure 8. Characterization of Bgt conidia germination on TaECR-, TaEPBM1-, TaADA2 or 866
TaGCN5-silenced wheat leaves or glass slides coated with Formvar/wheat leaf wax. A, Statistical 867
analysis of Bgt conidia germination on wheat leaves infected with BSMV-γ (dark grey), 868
BSMV-TaECRas (dark blue), BSMV-TaEPBM1as (dark green), BSMV-TaADA2 (dark orange) or 869
BSMV-TaGCN5as (dark yellow). Wheat leaves with indicated contact angles were sprayed with 870
cuticular wax extracted in chloroform from indicated wheat leaves, or with chloroform only (control 871
treatment). B, Statistical analysis of Bgt conidia germination on glass slides coated with 872
Formvar/cuticular wax (480 μg ml-1) and pure waxes (7×10-5 mol l-1), or with Formvar/cuticular wax 873
(480 μg ml-1) only (control treatment). For A and B, more than 500 Bgt conidia were analyzed in one 874
experiment, and three biological replicates were statistically analyzed for each treatment, and data are 875
presented as the mean±SE (Student’s t-test; ** P<0.01). 876
877
Figure 9. Proposed model for the regulation of wheat cuticular wax biosynthesis and Bgt conidia 878
germination by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit. Transcription factor TaEPBM1 879
recognizes the MBS cis-element and directly targets TaECR, an essential gene in cuticular wax 880
biosynthesis, and then recruits the TaADA2-TaGCN5 transcriptional activator complex to TaECR 881
promoters, which potentiates histone acetylation such as H3K4ac, H3K9ac, H3K14ac, H3K27ac, and 882
H4K5ac, as well as enhances occupancy of RNA polymerase II at TaECR genes. Consequently, the 883
cuticular wax biosynthesis is stimulated, leading to the accumulation of VLC aldehydes and thereby 884
triggering the germination of Bgt conidia. 885
886
LITERATURE CITED 887
Aharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A (2004) The SHINE clade of AP2 888
domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought 889
tolerance when overexpressed in Arabidopsis. Plant Cell 16: 2463-2480 890
Aragón W, Reina-Pinto JJ, Serrano M (2017) The intimate talk between plants and microorganisms at 891
the leaf surface. J Exp Bot 68: 5339-5350 892
Aarts MG, Keijzer CJ, Stiekema WJ, Pereira A (1995) Molecular characterization of the CER1 gene 893
of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7: 2115-2127 894
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 24: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/24.jpg)
24
Avato P, Bianchi G, Nayak A, Salamini F, Gentinetta E (1987) Epicuticular waxes of maize as 895
affected by the interaction of mutant gl8 with gl3, gl4 and gl15. Lipids 22:11-16 896
Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa M, Boutin JP, Miquel 897
M, Tellier F, et al (2008) The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is 898
essential and limiting for plant development. Proc Natl Acad Sci U S A 105: 14727-14731 899
Beaudoin F, Wu X, Li F, Haslam RP, Markham JE, Zheng H, Napier JA, Kunst L (2009) 900
Functional characterization of the Arabidopsis β-ketoacyl-coenzyme a reductase candidates of the fatty 901
acid elongase. Plant Physiol 150: 1174-1191 902
Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire 903
R, Joubes J (2012) Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis 904
ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis 905
complex. Plant Cell 24: 3106-3118 906
Bi H, Shi J, Kovalchuk N, Luang S, Bazanova N, Chirkova L, Zhang D, Shavrukov Y, Stepanenko 907
A, Tricker P (2018) Overexpression of the TaSHN1 transcription factor in bread wheat leads to leaf 908
surface modifications, improved drought tolerance, and no yield penalty under controlled growth 909
conditions. Plant Cell Environ 41: 2549-2566 910
Bourdenx B, Bernard A, Domergue F, Pascal S, Léger A, Roby D, Pervent M, Vile D, Haslam RP, 911
Napier JA, et al (2011) Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain 912
alkane biosynthesis and influences plant response to biotic and abiotic stresses. Plant Physiol 156: 29-45 913
Castroverde CDM (2019) The AREB1-ADA2b-GCN5 complex regulates gene expression during 914
drought stress. Plant Cell 31: 559-560 915
Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor ETR1 to 916
the endoplasmic reticulum of Arabidopsis. J Biol Chem 277: 19861-19866 917
Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Cloning and characterization of the 918
WAX2 gene of Arabidopsis involved in cuticle membrane and wax production. Plant Cell 15:1170-1185 919
Daniel JA, Torok MS, Sun ZW, Schieltz D, Allis CD, Yates JR, Grant PA (2004) Deubiquitination 920
of histone H2B by a yeast acetyltransferase complex regulates transcription. J Biol Chem 279: 921
1867-1871 922
Ding Y, Fromm M, Avramova Z (2012) Multiple exposures to drought 'train' transcriptional responses 923
in Arabidopsis. Nat Commun 3: 740 924
Domínguez E, Heredia-Guerrero JA, Heredia A (2017) The plant cuticle: old challenges, new 925
perspectives. J Exp Bot 68: 5251-5255 926
Fernández V, Guzmán-Delgado P, Graça J, Santos S, Gil L (2016) Cuticle structure in relation to 927
chemical composition: re-assessing the prevailing model. Front Plant Sci 7: 427 928
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 25: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/25.jpg)
25
Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D (2000) Alterations in CER6, a gene 929
identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems. Plant 930
Cell 12: 2001-2008 931
Go YS, Kim H, Kim HJ, Suh MC (2014) Arabidopsis cuticular wax biosynthesis is negatively 932
regulated by the DEWAX gene encoding an AP2/ERF-type transcription factor. Plant Cell 933
26:1666-1680 934
Grant PA, Duggan L, Côté J, Roberts SM, Brownell JE, Candau R, Ohba R, Owen-Hughes T, 935
Allis CD, Winston F, Berger SL, Workman JL (1997) Yeast Gcn5 functions in two multisubunit 936
complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA 937
(Spt/Ada) complex. Genes Dev 11: 1640-1650 938
Greer S, Wen M, Bird D, Wu X, Samuels L, Kunst L, Jetter R (2007) The cytochrome P450 enzyme 939
CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and 940
ketones in stem cuticular wax of Arabidopsis. Plant Physiol 145: 653-667 941
Hansjakob A, Bischof S, Bringmann G, Riederer M, Hildebrandt U (2010) Very-long-chain 942
aldehydes promote in vitro prepenetration processes of Blumeria graminis in a dose- and chain length- 943
dependent manner. New Phytol 188: 1039-1054 944
Hansjakob A, Riederer M, Hildebrandt U (2011) Wax matters: absence of very-long-chain aldehydes 945
from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of 946
Blumeria graminis. Plant Pathol 60: 1151-1161 947
Haslam TM, Haslam R, Thoraval D, Pascal S, Delude C, Domergue F, Fernández AM, Beaudoin 948
F, Napier JA, Kunst L, et al (2015) ECERIFERUM2-LIKE proteins have unique biochemical and 949
physiological functions in very-long-chain fatty acid elongation. Plant Physiol 167: 682-692 950
Haslam TM, Kunst L (2013) Extending the story of very-long-chain fatty acid elongation. Plant Sci 951
210: 93-107 952
Haslam TM, Mañas-Fernández A, Zhao L, Kunst L (2012) Arabidopsis ECERIFERUM2 is a 953
component of the fatty acid elongation machinery required for fatty acid extension to exceptional 954
lengths. Plant Physiol 160: 1164-1174 955
He H, Zhu S, Zhao R, Jiang Z, Ji Y, Ji J, Qiu D, Li H, Bie T (2018) Pm21, encoding a typical 956
CC-NBS-LRR protein, confers broad-spectrum resistance to wheat powdery mildew disease. Mol Plant 957
11: 879-882 958
Hooker TS, Millar AA, Kunst L (2002) Significance of the expression of the CER6 condensing 959
enzyme for cuticular wax production in Arabidopsis. Plant Physiol 129:1568-1580 960
International Wheat Genome Sequencing Consortium (2018) Shifting the limits in wheat research 961
and breeding using a fully annotated reference genome. Science 361: eaar7191 962
Jenuwein T, Allis CD (2001) Translating the histone code. Science 293: 1074-1080 963
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 26: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/26.jpg)
26
Kim J, Jung JH, Lee SB, Go YS, Kim HJ, Cahoon R, Markham JE, Cahoon EB, Suh MC (2013) 964
Arabidopsis 3-ketoacylcoenzyme A synthase 9 is involved in the synthesis of tetracosanoic acids as 965
precursors of cuticular waxes, suberins, sphingolipids, and phospholipids. Plant Physiol 162:567-580 966
Kohlwein SD, Eder S, Oh CS, Martin CE, Gable K, Bacikova D, Dunn T (2001) Tsc13p is required 967
for fatty acid elongation and localizes to a novel structure at the nuclear-vacuolar interface in 968
Saccharomyces cerevisiae. Mol Cell Biol 21:109-125 969
Koller T, Brunner S, Herren G, Hurni S, Keller B (2018) Pyramiding of transgenic Pm3 alleles in 970
wheat results in improved powdery mildew resistance in the field. Theor Appl Genet 131: 861-871 971
Kong LY, Chang C (2018) Suppression of wheat TaCDK8/TaWIN1 interaction negatively affects 972
germination of Blumeria graminis f.sp. tritici by interfering with very-long-chain aldehyde 973
biosynthesis. Plant Mol Biol 96: 165-178 974
Kurdistani SK, Grunstein M (2003) Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell 975
Biol 4: 276-284 976
Lee SB, Jung SJ, Go YS, Kim HU, Kim JK, Cho HJ, Park OK, Suh MC (2009) Two Arabidopsis 977
3-ketoacyl CoA synthase genes, KCS20 and KCS2/DAISY, are functionally redundant in cuticular wax 978
and root suberin biosynthesis, but differentially controlled by osmotic stress. Plant J 60: 462-475 979
Lee SB, Kim HU, Suh MC (2016) MYB94 and MYB96 additively activate cuticular wax biosynthesis 980
in Arabidopsis. Plant Cell Physiol 57: 2300-2311 981
Lee SB, Suh MC (2013). Recent advances in cuticular wax biosynthesis and its regulation in 982
Arabidopsis. Mol Plant 6: 246-249 983
Lee SB, Suh MC (2014) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor 984
in Arabidopsis. Plant Cell Physiol 56:48-60 985
Lee SB, Suh MC (2015a) Advances in the understanding of cuticular waxes in Arabidopsis thaliana and 986
crop species. Plant Cell Rep 34: 557-572 987
Lee SB, Suh MC (2015b) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor 988
in Arabidopsis. Plant Cell Physiol 56: 48-60 989
Li C, Haslam TM, Krüger A, Schneider LM, Mishina K, Samuels L, Yang H, Kunst L, Schaffrath 990
U, Nawrath C, et al (2018) The β-Ketoacyl-CoA synthase HvKCS1, encoded by Cer-zh, plays a key 991
role in synthesis of barley leaf wax and germination of barley powdery mildew. Plant Cell Physiol 59: 992
806-822 993
Li S, Lin YJ, Wang P, Zhang B, Li M, Chen S, Shi R, Tunlaya-Anukit S, Liu X, Wang Z, Dai X, Yu 994
J, et al (2018). Histone acetylation cooperating with AREB1 transcription factor regulates drought 995
response and tolerance in Populus trichocarpa. Plant Cell 31: 663-686 996
Liu J, Zhi P, Wang X, Fan Q, Chang C (2019) Wheat WD40-repeat protein TaHOS15 functions in a 997
histone deacetylase complex to fine-tune defense response to Blumeria graminis f.sp. tritici. J Exp Bot 998
70: 255-268 999
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 27: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/27.jpg)
27
Liu S, Yeh C-T, Tang HM, Nettleton D, Schnable PS (2012) Gene mapping via bulked segregant 1000
RNA-Seq (BSR-Seq). PLOS One 7: e36406 1001
Lu S, Song T, Kosma DK, Parsons EP, Rowland O, Jenks MA (2009) Arabidopsis CER8 encodes 1002
LONGCHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in 1003
plant wax and cutin synthesis. Plant J 59: 553-564 1004
Mao Y, Pavangadkar KA, Thomashow MF, Triezenberg SJ (2006) Physical and functional 1005
interactions of Arabidopsis ADA2 transcriptional coactivator proteins with the acetyltransferase GCN5 1006
and with the cold-induced transcription factor CBF1. Biochim Biophys Acta 1759: 69-79 1007
Martin LB, Rose JK (2014) There's more than one way to skin a fruit: formation and functions of fruit 1008
cuticles. J Exp Bot 65: 4639-4651 1009
Millar AA, Clemens S, Zachgo S, Giblin EM, Taylor DC, Kunst L (1999) CUT1, an Arabidopsis 1010
gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid 1011
condensing enzyme. Plant Cell 11: 825-838 1012
Moraga F, Aquea F (2015) Composition of the SAGA complex in plants and its role in controlling gene 1013
expression in response to abiotic stresses. Front Plant Sci 6: 865 1014
Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant 1015
Biol 9: 281-287 1016
Nielsen KA, Nicholson RL, Carver TLW, Kunoh H, Oliver RP (2000) First touch: An immediate 1017
response to surface recognition in conidia of Blumeria graminis. Physiol Mol Plant P 56: 63-70 1018
Oshima Y, Shikata M, Koyama T, Ohtsubo N, Mitsuda N, Ohme-Takagi M (2013) MIXTA-like 1019
transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in 1020
Arabidopsis and Torenia fournieri. Plant Cell 25: 1609-1624 1021
Pascal S, Bernard A, Deslous P, Gronnier J, Fournier-Goss A, Domergue F, Rowland O, Joubès J 1022
(2019) Arabidopsis CER1-LIKE1 functions in a cuticular very-long-chain alkane-forming complex. 1023
Plant Physiol 179: 415-432 1024
Raffaele S, Vailleau F, Léger A, Joubès J, Miersch O, Huard C, Blée E, Mongrand S, Domergue F, 1025
Roby D (2008) A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for 1026
activation of the hypersensitive cell death response in Arabidopsis. Plant Cell 20: 752-767 1027
Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an 1028
alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. 1029
Plant Physiol 142: 866-877 1030
Rowland O, Lee R, Franke R, Schreiber L, Kunst L (2007) The CER3 wax biosynthetic gene from 1031
Arabidopsis thaliana is allelic to WAX2/YRE/FLP1. FEBS Lett 581: 3538-3544 1032
Sajeevan RS, Nataraja KN, Shivashankara KS, Pallavi N, Gurumurthy DS, Shivanna MB (2017) 1033
Expression of Arabidopsis SHN1 in Indian mulberry (Morus indica L.) increases leaf surface wax 1034
content and reduces post-harvest water loss. Front Plant Sci 8: 418 1035
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 28: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/28.jpg)
28
Samuels L, Kunst L, Jetter R (2008) Sealing plant surfaces: cuticular wax formation by epidermal 1036
cells. Annu Rev Plant Biol 59: 683-707 1037
Schmitz RJ, Tamada Y, Doyle MR, Zhang X, Amasino RM (2009) Histone H2B deubiquitination is 1038
required for transcriptional activation of FLOWERING LOCUS C and for proper control of flowering in 1039
Arabidopsis. Plant Physiol 149:1196-1204 1040
Schnurr J, Shockey J, Browse J (2004) The acyl-CoA synthetase encoded by LACS2 is essential for 1041
normal cuticle development in Arabidopsis. Plant Cell 16: 629-642 1042
Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor 1043
regulates cuticular wax biosynthesis under drought conditions in Arabidopsis. Plant Cell 23: 1138- 1152 1044
Serrano M, Coluccia F, Torres M, L’Haridon F, Métraux JP (2014) The cuticle and plant defense to 1045
pathogens. Front Plant Sci 5: 274 1046
Strahl BD, Allis CD (2000) The language of covalent histone modifications. Nature 403: 41-45 1047
Todd J, Post-Beittenmiller D, Jaworski JG (1999) KCS1 encodes a fatty acid elongase 1048
3-ketoacyl-CoA synthase affecting wax biosynthesis in Arabidopsis thaliana. Plant J 17: 119-130 1049
Uppalapati SR, Ishiga Y, Doraiswamy V, Bedair M, Mittal S, Chen J, Nakashima J, Tang Y, 1050
Tadege M, Ratet P, et al (2012) Loss of abaxial leaf epicuticular wax in Medicago truncatula 1051
irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhost rust pathogens. 1052
Plant Cell 24: 353-370 1053
Wang L, Dent SY (2014) Functions of SAGA in development and disease. Epigenomics 6: 329-339 1054
Wang X, Zhi P, Fan Q, Zhang M, Chang C (2019) Wheat CHD3 protein TaCHR729 regulates the 1055
cuticular wax biosynthesis required for stimulating germination of Blumeria graminis f.sp. tritici. J Exp 1056
Bot 70: 701-713 1057
Wang Y, Wan L, Zhang L, Zhang Z, Zhang H, Quan R, Zhou S, Huang R (2012) An ethylene 1058
response factor OsWR1 responsive to drought stress transcriptionally activates wax synthesis related 1059
genes and increases wax production in rice. Plant Mol Biol 78: 275-288 1060
Weake VM, Workman JL (2012) SAGA function in tissues pecific gene expression. Trends Cell Biol. 1061
22: 177-184 1062
Weak VM, Lee KK, Guelman S, Lin CH, Seidel C, Abmayr SM, Workman JL (2008) 1063
SAGA-mediated H2B deubiquitination controls the development of neuronal connectivity in the 1064
Drosophila visual system. EMBO J 27: 394-405 1065
Weidenbach D, Jansen M, Franke RB, Hensel G, Weissgerber W, Ulferts S, Jansen I, Schreiber L, 1066
Korzun V, Pontzen R et al (2014) Evolutionary conserved function of barley and Arabidopsis 1067
3-KETOACYL-CoA SYNTHASES in providing wax signals for germination of powdery mildew fungi. 1068
Plant Physiol 166: 1621-1633 1069
Weng H, Molina I, Shockey J, Browse J (2010) Organ fusion and defective cuticle function in a lacs1 1070
lacs2 double mutant of Arabidopsis. Planta 231: 1089-1100 1071
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 29: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/29.jpg)
29
Wright AJ, Thomas BJ, Carver TLW (2002) Early adhesion of Blumeria graminis to plant and 1072
artificial surfaces demonstrated by centrifugation. Physiol Mol Plant P 61: 217-226 1073
Xia Y, Nikolau BJ, Schnable PS (1996) Cloning and characterization of CER2, an Arabidopsis gene 1074
that affects cuticular wax accumulation. Plant Cell 8:1291-1304 1075
Xing L, Hu P, Liu J, Witek K, Zhou S, Xu J, Zhou W, Gao L, Huang Z, Zhang R, et al (2018) Pm21 1076
from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in 1077
wheat. Mol Plant 11: 874-878 1078
Yang X, Zhao H, Kosma DK, Tomasi P, Dyer JM, Li R, Liu X, Wang Z, Parsons EP, Jenks MA, et 1079
al (2017) The acyl desaturase CER17 is involved in producing wax unsaturated primary alcohols and 1080
cutin monomers. Plant Physiol 173: 1109-1124 1081
Yeats TH, Rose JK (2013) The formation and function of plant cuticles. Plant Physiol 163: 5-20 1082
Yuan C, Li C, Yan L, Jackson AO, Liu Z, Han C, Yu J, Li D (2011) A high throughput barley stripe 1083
mosaic virus vector for virus induced gene silencing in monocots and dicots. PLOS One 6: e26468. 1084
Zhang JC, Zheng HY, Li YW, Li HJ, Liu X, Qin HJ, Dong LL, Wang DW (2016) Coexpression 1085
network analysis of the genes regulated by two types of resistance responses to powdery mildew in 1086
wheat. Sci Rep 6: 23805 1087
Zheng H, Dong L, Han X, Jin H, Yin C, Han Y, Li B, Qin H, Zhang JS, Shen Q, et al (2020) The 1088
TuMYB46L-TuACO3 module regulates ethylene biosynthesis in einkorn wheat defense to powdery 1089
mildew. New Phytol 225: 2526-2541 1090
Zheng H, Rowland O, Kunst L (2005) Disruptions of the Arabidopsis Enoyl-CoA reductase gene 1091
reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant 1092
morphogenesis. Plant Cell 17: 1467-1481 1093
Zhou S, Jiang W, Long F, Cheng S, Yang W, Zhao Y, Zhou DX (2017) Rice homeodomain protein 1094
WOX11 recruits a histone acetyltransferase complex to establish programs of cell proliferation of crown 1095
root meristem. Plant Cell 29: 1088-1104 1096
Zhu L, Guo J, Zhu J, Zhou C (2014) Enhanced expression of EsWAX1improves drought tolerance 1097
with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis. Plant Physiol 1098
Biochem 75: 24-35 1099
Zhu YF, Li YB, Fei F, Wang ZK, Wang W, Cao AZ, Liu Y, Han S, Xing LP, Wang HY, et al (2015) 1100
An E3 ubiquitin ligase gene CMPG1-V from Haynaldia villosa L. contributes to the powdery mildew 1101
resistance in common wheat (Triticum aestivum L.). Plant J 84: 154-168 1102
Zou S, Wang H, Li Y, Kong Z, Tang D (2018) The NB-LRR gene Pm60 confers powdery mildew 1103
resistance in wheat. New Phytol 218: 298-309 1104
Ziv C, Zhao Z, Gao YG, Xia Y (2018) Multifunctional roles of plant cuticle during plant-pathogen 1105
interactions. Front Plant Sci 9: 1088 1106
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 30: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/30.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 31: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/31.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 32: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/32.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 33: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/33.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 34: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/34.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 35: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/35.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 36: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/36.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 37: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/37.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 38: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/38.jpg)
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 39: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/39.jpg)
Parsed CitationsAharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A (2004) The SHINE clade of AP2 domain transcription factors activateswax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. Plant Cell 16: 2463-2480
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Aragón W, Reina-Pinto JJ, Serrano M (2017) The intimate talk between plants and microorganisms at the leaf surface. J Exp Bot 68:5339-5350
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Aarts MG, Keijzer CJ, Stiekema WJ, Pereira A (1995) Molecular characterization of the CER1 gene of Arabidopsis involved inepicuticular wax biosynthesis and pollen fertility. Plant Cell 7: 2115-2127
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Avato P, Bianchi G, Nayak A, Salamini F, Gentinetta E (1987) Epicuticular waxes of maize as affected by the interaction of mutant gl8with gl3, gl4 and gl15. Lipids 22:11-16
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa M, Boutin JP, Miquel M, Tellier F, et al (2008) The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development. Proc Natl Acad Sci U S A 105:14727-14731
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Beaudoin F, Wu X, Li F, Haslam RP, Markham JE, Zheng H, Napier JA, Kunst L (2009) Functional characterization of the Arabidopsis β-ketoacyl-coenzyme a reductase candidates of the fatty acid elongase. Plant Physiol 150: 1174-1191
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire R, Joubes J (2012) Reconstitution ofplant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. Plant Cell 24: 3106-3118
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bi H, Shi J, Kovalchuk N, Luang S, Bazanova N, Chirkova L, Zhang D, Shavrukov Y, Stepanenko A, Tricker P (2018) Overexpression ofthe TaSHN1 transcription factor in bread wheat leads to leaf surface modifications, improved drought tolerance, and no yield penaltyunder controlled growth conditions. Plant Cell Environ 41: 2549-2566
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bourdenx B, Bernard A, Domergue F, Pascal S, Léger A, Roby D, Pervent M, Vile D, Haslam RP, Napier JA, et al (2011) Overexpressionof Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abioticstresses. Plant Physiol 156: 29-45
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Castroverde CDM (2019) The AREB1-ADA2b-GCN5 complex regulates gene expression during drought stress. Plant Cell 31: 559-560Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor ETR1 to the endoplasmic reticulum ofArabidopsis. J Biol Chem 277: 19861-19866
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Cloning and characterization of the WAX2 gene of Arabidopsis involved incuticle membrane and wax production. Plant Cell 15:1170-1185
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Daniel JA, Torok MS, Sun ZW, Schieltz D, Allis CD, Yates JR, Grant PA (2004) Deubiquitination of histone H2B by a yeastacetyltransferase complex regulates transcription. J Biol Chem 279: 1867-1871
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ding Y, Fromm M, Avramova Z (2012) Multiple exposures to drought 'train' transcriptional responses in Arabidopsis. Nat Commun 3:740
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 40: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/40.jpg)
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Domínguez E, Heredia-Guerrero JA, Heredia A (2017) The plant cuticle: old challenges, new perspectives. J Exp Bot 68: 5251-5255Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fernández V, Guzmán-Delgado P, Graça J, Santos S, Gil L (2016) Cuticle structure in relation to chemical composition: re-assessingthe prevailing model. Front Plant Sci 7: 427
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D (2000) Alterations in CER6, a gene identical to CUT1, differentially affectlong-chain lipid content on the surface of pollen and stems. Plant Cell 12: 2001-2008
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Go YS, Kim H, Kim HJ, Suh MC (2014) Arabidopsis cuticular wax biosynthesis is negatively regulated by the DEWAX gene encoding anAP2/ERF-type transcription factor. Plant Cell 26:1666-1680
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Grant PA, Duggan L, Côté J, Roberts SM, Brownell JE, Candau R, Ohba R, Owen-Hughes T, Allis CD, Winston F, Berger SL, WorkmanJL (1997) Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complexand the SAGA (Spt/Ada) complex. Genes Dev 11: 1640-1650
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Greer S, Wen M, Bird D, Wu X, Samuels L, Kunst L, Jetter R (2007) The cytochrome P450 enzyme CYP96A15 is the midchain alkanehydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of Arabidopsis. Plant Physiol 145: 653-667
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hansjakob A, Bischof S, Bringmann G, Riederer M, Hildebrandt U (2010) Very-long-chain aldehydes promote in vitro prepenetrationprocesses of Blumeria graminis in a dose- and chain length- dependent manner. New Phytol 188: 1039-1054
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hansjakob A, Riederer M, Hildebrandt U (2011) Wax matters: absence of very-long-chain aldehydes from the leaf cuticular wax of theglossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis. Plant Pathol 60: 1151-1161
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Haslam TM, Haslam R, Thoraval D, Pascal S, Delude C, Domergue F, Fernández AM, Beaudoin F, Napier JA, Kunst L, et al (2015)ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-long-chain fatty acid elongation. PlantPhysiol 167: 682-692
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Haslam TM, Kunst L (2013) Extending the story of very-long-chain fatty acid elongation. Plant Sci 210: 93-107Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Haslam TM, Mañas-Fernández A, Zhao L, Kunst L (2012) Arabidopsis ECERIFERUM2 is a component of the fatty acid elongationmachinery required for fatty acid extension to exceptional lengths. Plant Physiol 160: 1164-1174
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
He H, Zhu S, Zhao R, Jiang Z, Ji Y, Ji J, Qiu D, Li H, Bie T (2018) Pm21, encoding a typical CC-NBS-LRR protein, confers broad-spectrum resistance to wheat powdery mildew disease. Mol Plant 11: 879-882
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hooker TS, Millar AA, Kunst L (2002) Significance of the expression of the CER6 condensing enzyme for cuticular wax production inArabidopsis. Plant Physiol 129:1568-1580
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
International Wheat Genome Sequencing Consortium (2018) Shifting the limits in wheat research and breeding using a fully annotatedreference genome. Science 361: eaar7191
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jenuwein T, Allis CD (2001) Translating the histone code. Science 293: 1074-1080 www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 41: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/41.jpg)
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kim J, Jung JH, Lee SB, Go YS, Kim HJ, Cahoon R, Markham JE, Cahoon EB, Suh MC (2013) Arabidopsis 3-ketoacylcoenzyme Asynthase 9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, andphospholipids. Plant Physiol 162:567-580
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kohlwein SD, Eder S, Oh CS, Martin CE, Gable K, Bacikova D, Dunn T (2001) Tsc13p is required for fatty acid elongation and localizesto a novel structure at the nuclear-vacuolar interface in Saccharomyces cerevisiae. Mol Cell Biol 21:109-125
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Koller T, Brunner S, Herren G, Hurni S, Keller B (2018) Pyramiding of transgenic Pm3 alleles in wheat results in improved powderymildew resistance in the field. Theor Appl Genet 131: 861-871
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kong LY, Chang C (2018) Suppression of wheat TaCDK8/TaWIN1 interaction negatively affects germination of Blumeria graminis f.sp.tritici by interfering with very-long-chain aldehyde biosynthesis. Plant Mol Biol 96: 165-178
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kurdistani SK, Grunstein M (2003) Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell Biol 4: 276-284Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee SB, Jung SJ, Go YS, Kim HU, Kim JK, Cho HJ, Park OK, Suh MC (2009) Two Arabidopsis 3-ketoacyl CoA synthase genes, KCS20and KCS2/DAISY, are functionally redundant in cuticular wax and root suberin biosynthesis, but differentially controlled by osmoticstress. Plant J 60: 462-475
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee SB, Kim HU, Suh MC (2016) MYB94 and MYB96 additively activate cuticular wax biosynthesis in Arabidopsis. Plant Cell Physiol 57:2300-2311
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee SB, Suh MC (2013). Recent advances in cuticular wax biosynthesis and its regulation in Arabidopsis. Mol Plant 6: 246-249Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee SB, Suh MC (2014) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis. Plant Cell Physiol56:48-60
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee SB, Suh MC (2015a) Advances in the understanding of cuticular waxes in Arabidopsis thaliana and crop species. Plant Cell Rep 34:557-572
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee SB, Suh MC (2015b) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis. Plant CellPhysiol 56: 48-60
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li C, Haslam TM, Krüger A, Schneider LM, Mishina K, Samuels L, Yang H, Kunst L, Schaffrath U, Nawrath C, et al (2018) The β-Ketoacyl-CoA synthase HvKCS1, encoded by Cer-zh, plays a key role in synthesis of barley leaf wax and germination of barley powderymildew. Plant Cell Physiol 59: 806-822
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li S, Lin YJ, Wang P, Zhang B, Li M, Chen S, Shi R, Tunlaya-Anukit S, Liu X, Wang Z, Dai X, Yu J, et al (2018). Histone acetylationcooperating with AREB1 transcription factor regulates drought response and tolerance in Populus trichocarpa. Plant Cell 31: 663-686
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liu J, Zhi P, Wang X, Fan Q, Chang C (2019) Wheat WD40-repeat protein TaHOS15 functions in a histone deacetylase complex to fine-tune defense response to Blumeria graminis f.sp. tritici. J Exp Bot 70: 255-268
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liu S, Yeh C-T, Tang HM, Nettleton D, Schnable PS (2012) Gene mapping via bulked segregant RNA-Seq (BSR-Seq). PLOS One 7: www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 42: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/42.jpg)
e36406Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lu S, Song T, Kosma DK, Parsons EP, Rowland O, Jenks MA (2009) Arabidopsis CER8 encodes LONGCHAIN ACYL-COA SYNTHETASE1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis. Plant J 59: 553-564
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mao Y, Pavangadkar KA, Thomashow MF, Triezenberg SJ (2006) Physical and functional interactions of Arabidopsis ADA2transcriptional coactivator proteins with the acetyltransferase GCN5 and with the cold-induced transcription factor CBF1. BiochimBiophys Acta 1759: 69-79
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Martin LB, Rose JK (2014) There's more than one way to skin a fruit: formation and functions of fruit cuticles. J Exp Bot 65: 4639-4651Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Millar AA, Clemens S, Zachgo S, Giblin EM, Taylor DC, Kunst L (1999) CUT1, an Arabidopsis gene required for cuticular waxbiosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme. Plant Cell 11: 825-838
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Moraga F, Aquea F (2015) Composition of the SAGA complex in plants and its role in controlling gene expression in response to abioticstresses. Front Plant Sci 6: 865
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant Biol 9: 281-287Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nielsen KA, Nicholson RL, Carver TLW, Kunoh H, Oliver RP (2000) First touch: An immediate response to surface recognition inconidia of Blumeria graminis. Physiol Mol Plant P 56: 63-70
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Oshima Y, Shikata M, Koyama T, Ohtsubo N, Mitsuda N, Ohme-Takagi M (2013) MIXTA-like transcription factors and WAXINDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri. Plant Cell 25: 1609-1624
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pascal S, Bernard A, Deslous P, Gronnier J, Fournier-Goss A, Domergue F, Rowland O, Joubès J (2019) Arabidopsis CER1-LIKE1functions in a cuticular very-long-chain alkane-forming complex. Plant Physiol 179: 415-432
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Raffaele S, Vailleau F, Léger A, Joubès J, Miersch O, Huard C, Blée E, Mongrand S, Domergue F, Roby D (2008) A MYB transcriptionfactor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis. PlantCell 20: 752-767
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductaseinvolved in cuticular wax production in Arabidopsis. Plant Physiol 142: 866-877
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Rowland O, Lee R, Franke R, Schreiber L, Kunst L (2007) The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic toWAX2/YRE/FLP1. FEBS Lett 581: 3538-3544
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sajeevan RS, Nataraja KN, Shivashankara KS, Pallavi N, Gurumurthy DS, Shivanna MB (2017) Expression of Arabidopsis SHN1 inIndian mulberry (Morus indica L.) increases leaf surface wax content and reduces post-harvest water loss. Front Plant Sci 8: 418
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Samuels L, Kunst L, Jetter R (2008) Sealing plant surfaces: cuticular wax formation by epidermal cells. Annu Rev Plant Biol 59: 683-707Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schmitz RJ, Tamada Y, Doyle MR, Zhang X, Amasino RM (2009) Histone H2B deubiquitination is required for transcriptional activationof FLOWERING LOCUS C and for proper control of flowering in Arabidopsis. Plant Physiol 149:1196-1204 www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 43: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/43.jpg)
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schnurr J, Shockey J, Browse J (2004) The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development inArabidopsis. Plant Cell 16: 629-642
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor regulates cuticular wax biosynthesis underdrought conditions in Arabidopsis. Plant Cell 23: 1138- 1152
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Serrano M, Coluccia F, Torres M, L'Haridon F, Métraux JP (2014) The cuticle and plant defense to pathogens. Front Plant Sci 5: 274Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Strahl BD, Allis CD (2000) The language of covalent histone modifications. Nature 403: 41-45Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Todd J, Post-Beittenmiller D, Jaworski JG (1999) KCS1 encodes a fatty acid elongase 3-ketoacyl-CoA synthase affecting waxbiosynthesis in Arabidopsis thaliana. Plant J 17: 119-130
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Uppalapati SR, Ishiga Y, Doraiswamy V, Bedair M, Mittal S, Chen J, Nakashima J, Tang Y, Tadege M, Ratet P, et al (2012) Loss of abaxialleaf epicuticular wax in Medicago truncatula irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhostrust pathogens. Plant Cell 24: 353-370
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang L, Dent SY (2014) Functions of SAGA in development and disease. Epigenomics 6: 329-339Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang X, Zhi P, Fan Q, Zhang M, Chang C (2019) Wheat CHD3 protein TaCHR729 regulates the cuticular wax biosynthesis required forstimulating germination of Blumeria graminis f.sp. tritici. J Exp Bot 70: 701-713
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang Y, Wan L, Zhang L, Zhang Z, Zhang H, Quan R, Zhou S, Huang R (2012) An ethylene response factor OsWR1 responsive todrought stress transcriptionally activates wax synthesis related genes and increases wax production in rice. Plant Mol Biol 78: 275-288
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Weake VM, Workman JL (2012) SAGA function in tissues pecific gene expression. Trends Cell Biol. 22: 177-184Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Weak VM, Lee KK, Guelman S, Lin CH, Seidel C, Abmayr SM, Workman JL (2008) SAGA-mediated H2B deubiquitination controls thedevelopment of neuronal connectivity in the Drosophila visual system. EMBO J 27: 394-405
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Weidenbach D, Jansen M, Franke RB, Hensel G, Weissgerber W, Ulferts S, Jansen I, Schreiber L, Korzun V, Pontzen R et al (2014)Evolutionary conserved function of barley and Arabidopsis 3-KETOACYL-CoA SYNTHASES in providing wax signals for germination ofpowdery mildew fungi. Plant Physiol 166: 1621-1633
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Weng H, Molina I, Shockey J, Browse J (2010) Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant ofArabidopsis. Planta 231: 1089-1100
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wright AJ, Thomas BJ, Carver TLW (2002) Early adhesion of Blumeria graminis to plant and artificial surfaces demonstrated bycentrifugation. Physiol Mol Plant P 61: 217-226
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Xia Y, Nikolau BJ, Schnable PS (1996) Cloning and characterization of CER2, an Arabidopsis gene that affects cuticular waxaccumulation. Plant Cell 8:1291-1304
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
![Page 44: Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 105 crown root meristem](https://reader034.vdocument.in/reader034/viewer/2022050110/5f4795d2139df948fd12ac64/html5/thumbnails/44.jpg)
Xing L, Hu P, Liu J, Witek K, Zhou S, Xu J, Zhou W, Gao L, Huang Z, Zhang R, et al (2018) Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat. Mol Plant 11: 874-878
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yang X, Zhao H, Kosma DK, Tomasi P, Dyer JM, Li R, Liu X, Wang Z, Parsons EP, Jenks MA, et al (2017) The acyl desaturase CER17 isinvolved in producing wax unsaturated primary alcohols and cutin monomers. Plant Physiol 173: 1109-1124
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yeats TH, Rose JK (2013) The formation and function of plant cuticles. Plant Physiol 163: 5-20Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yuan C, Li C, Yan L, Jackson AO, Liu Z, Han C, Yu J, Li D (2011) A high throughput barley stripe mosaic virus vector for virus inducedgene silencing in monocots and dicots. PLOS One 6: e26468.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang JC, Zheng HY, Li YW, Li HJ, Liu X, Qin HJ, Dong LL, Wang DW (2016) Coexpression network analysis of the genes regulated bytwo types of resistance responses to powdery mildew in wheat. Sci Rep 6: 23805
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zheng H, Dong L, Han X, Jin H, Yin C, Han Y, Li B, Qin H, Zhang JS, Shen Q, et al (2020) The TuMYB46L-TuACO3 module regulatesethylene biosynthesis in einkorn wheat defense to powdery mildew. New Phytol 225: 2526-2541
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zheng H, Rowland O, Kunst L (2005) Disruptions of the Arabidopsis Enoyl-CoA reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant morphogenesis. Plant Cell 17: 1467-1481
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhou S, Jiang W, Long F, Cheng S, Yang W, Zhao Y, Zhou DX (2017) Rice homeodomain protein WOX11 recruits a histoneacetyltransferase complex to establish programs of cell proliferation of crown root meristem. Plant Cell 29: 1088-1104
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhu L, Guo J, Zhu J, Zhou C (2014) Enhanced expression of EsWAX1improves drought tolerance with increased accumulation ofcuticular wax and ascorbic acid in transgenic Arabidopsis. Plant Physiol Biochem 75: 24-35
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhu YF, Li YB, Fei F, Wang ZK, Wang W, Cao AZ, Liu Y, Han S, Xing LP, Wang HY, et al (2015) An E3 ubiquitin ligase gene CMPG1-V fromHaynaldia villosa L. contributes to the powdery mildew resistance in common wheat (Triticum aestivum L.). Plant J 84: 154-168
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zou S, Wang H, Li Y, Kong Z, Tang D (2018) The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol 218: 298-309
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ziv C, Zhao Z, Gao YG, Xia Y (2018) Multifunctional roles of plant cuticle during plant-pathogen interactions. Front Plant Sci 9: 1088Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.