eradication of hepatocellular carcinoma by nkg2d-specific ...€¦ · 04.09.2019 · tumors,...

1

Eradication of hepatocellular carcinoma by NKG2D-specific CAR T-1

cells 2

3

Bin Sun1,2,3, #

, Dong Yang1,2, 3, #

, Hongjiu Dai3, #, *

, Xiuyun Liu2, Ru Jia

4, Xiaoyue Cui

2, 4

Wenxuan Li5, Changchun Cai

7, Jianming Xu

4, Xudong Zhao

1,2,6, * 5

1 Laboratory of tumor animal models and anti-aging, State Key Laboratory of 6

Biotherapy and Cancer Center, West China Hospital, Sichuan University, Chengdu 7

610041, Sichuan. China. 8

2 Key Laboratory of Animal Models and Human Disease Mechanisms of Chinese 9

Academy of Sciences/Key Laboratory of Bioactive Peptides of Yunnan Province, 10

Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 11

650223, China 12

3 Nanjing Kaedi Biotech Co. Ltd., Nanjing, Jiangsu 211100, China 13

4 Department of GI Oncology, the 307 Hospital of Academy of Military Medical 14

Science, Beijing 100071, China 15

5 College of Life Sciences, Sichuan University, Chengdu, Sichuan 610064, China 16

6 Center for Excellence in Animal Evolution and Genetics, Chinese Academy of 17

Sciences, Kunming 650223, China 18

7 Department of Gastroenterology, The Affiliated Hospital of Jiujiang University, 19

Jiujiang, Jiangxi 332000, China 20

21

# These authors contributed equally to the study. 22

23

Running title: NKG2D-BBz CAR-T eliminates hepatocellular cancer 24

25

on March 29, 2021. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026

http://cancerimmunolres.aacrjournals.org/

2

Key words: NKG2D, NKG2DL, HCC, CAR-T cells 26

27

Financial Support 28

This work was financially supported by the National Natural Science Foundation of China 29

(U1702289 to X.Z., 81802976 to D.Y.) 30

31

*Co-corresponding authors 32

Hongjiu Dai, Ph.D. 33

NANJING KAEDI BIOTECH INC. 34

No. 18 Zhilan Road, Building #5 Room 402, Science Park, Jiangning District, Nanjing, 35

Jiangsu 211100, China 36

E-mail: [email protected] 37

Tel: +86-25-52187062 38

39

Xudong Zhao, Ph.D. 40

Kunming Institute of Zoology, the Chinese Academy of Sciences 41

No. 32 Jiaochang Donglu, Kunming, Yunnan 650223, P.R. China 42

E-mail: [email protected] 43

Tel: +86-871-68125430 44

45

46

Disclosure of Potential Conflicts of Interest 47

No potential conflicts of interest were disclosed. 48

49

Total number of figures: 6 50

Total number of tables: 0 51

Word count: 3460 52

53




3

54

Abstract 55

Despite the great success of chimeric antigen receptor T (CAR-T) cell therapy in the 56

treatment of hematological malignancies, CAR-T cell therapy is limited in solid 57

tumors, including hepatocellular carcinoma (HCC). NKG2D ligands (NKG2DLs) are 58

generally absent on the surface of normal cells but are overexpressed on malignant 59

cells, offering good targets for CAR-T therapy. Indeed, analysis of the Cancer 60

Genome Atlas and HCC tumor samples showed that the expression of most 61

NKG2DLs was elevated in tumors compared with normal tissues. Thus, we designed 62

a novel NKG2D-CAR comprising the extracellular domain of human NKG2D, 4-1BB 63

and CD3ζ signaling domains (BBz). NKG2D-BBz CAR-T cells efficiently killed the 64

HCC cell lines SMMC-7721 and MHCC97H in vitro, which express high levels of 65

NKG2DLs, whereas they less efficiently killed NKG2DL- silenced SMMC-7721 cells 66

or NKG2DL-negative Hep3B cells. Overexpression of MICA or ULBP2 in Hep3B 67

improved the killing capacity of NKG2D-BBz CAR-T cells. T cells expressing the 68

NKG2D-BBz CAR effectively eradicated SMMC-7721 HCC xenografts. 69

Collectively, these results suggested that NKG2D-BBz CAR-T cells could potently 70

eliminate NKG2DL-high HCC cells both in vitro and in vivo, thereby providing a 71

promising therapeutic intervention for NKG2DL-positive HCC patients. 72

73

74

Introduction 75

Liver cancer is the sixth most common cancer type and the fourth most common 76

cause of cancer-related deaths worldwide (1) Hepatocellular carcinoma (HCC) 77

accounts for more than 75–85% of all liver cancer cases (1). In developed countries, 78

approximately 40% of HCC patients are diagnosed at an early stage due to health 79




4

surveillance programs (2,3). According to the Barcelona Clinic Liver Cancer (BCLC) 80

staging system, many therapies, such as partial liver resection, transplantation, and 81

local ablation, have excellent effects on early-stage HCC patients (stages 0 and A), 82

providing median survival rates of 60 months and beyond (2,4). Unfortunately, most 83

HCC patients, especially in developing countries, are diagnosed at a later disease 84

stage because the symptoms of liver cancer are not obvious until it is in its later stages 85

(3,5). For more developed stages of HCC, only a few treatments have shown survival 86

benefits. Patients at intermediate stages (stage B) benefit from chemoembolization 87

and have an estimated median survival of 26 months (2,6). For patients at advanced 88

stages (stage C), only two therapies have been approved for clinical use by the Food 89

and Drug Administration (FDA), sorafenib as a frontline treatment and regorafenib as 90

a second line treatment (7,8); these drugs extend the overall survival of patients by 2-91

3 months but are often accompanied by treatment-induced adverse events，such as 92

hypophosphatemia, weight loss, hand–foot skin reaction, hypertension, etc. (7,8). 93

Therefore, novel strategies for the treatment of advanced HCC, such as 94

immunotherapy with PD-1 antibodies or Chimeric antigen receptor T (CAR-T) cells, 95

are currently being tested in clinical trials (2,3,9). 96

Immunotherapy is an effective treatment strategy for several cancers, including 97

HCC. For example, administration of a cytotoxic T-lymphocyte-associated protein 4 98

(CTLA-4) inhibitor enhances antitumor immunity in a murine HCC model, with a 99

tumor re-challenge rejection rate of 90% and an elimination rate of 50% for 100

metastatic tumor(10). In addition, nivolumab (a fully human programmed death-1 101

inhibitor) shows potential as a treatment for HCC with a manageable safety profile 102

(11). Chimeric antigen receptor T (CAR-T) cell therapy is another emerging 103

immunotherapeutic option for cancer treatment (2,3). CAR-T cells are engineered to 104




5

express a specific CAR, which recognizes tumor-associated antigens on the surface of 105

tumor cells and then kills these cells in a targeted manner (12). However, clinical 106

application of this approach requires the identification of the tumor-associated 107

antigens and the design of highly specific CARs. 108

CAR-T immunotherapy has shown promise in the fight against cancer, especially 109

for hematologic malignancies (12,13). Currently, the FDA has approved two CAR-T 110

therapies for blood cancer: Yescarta (axicabtagene cioleucel) developed by Kite 111

Pharma Inc. and Kymriah (tisangenlecleucel) developed by Novartis International AG 112

(14). However, insufficient persistence of tumor-specific antigens (15), heterogeneity 113

among tumor cells (16,17), presence of an immunosuppressive microenvironment 114

(16), and toxicity due to off-target effects currently (17) compromise the therapeutic 115

efficiency of CAR-T immunotherapy in solid cancers. There are a few of ongoing 116

preclinical studies of CAR-T therapies for HCC, which target the HCC associated 117

antigens GPC-3, MUC-1, and CEA. However, the clinical results of CAR-T cells in 118

HCC have been disappointing and associate with severe side effects (18). Therefore, 119

there is a need to further develop CAR-T therapies for the treatment of HCC. 120

NK group 2 member D (NKG2D) is a type II transmembrane-anchored C-type 121

lectin-like protein receptor expressed on natural killer (NK) cells, CD8+ T cells, 122

subsets of γδ T cells, and some autoreactive CD4+ T cells (19,20). NKG2D 123

recognizes its ligands (NKG2DLs), such as MHC I chain-related molecules A and B 124

(MICA and MICB) (21) and six cytomegalovirus UL16-binding proteins (ULBP1–6) 125

(22). NKG2DLs are generally absent on the surface of normal cells but are 126

overexpressed on tumor cells, and their expression can be further increased by 127

chemotherapy or radiation (23). Accordingly, NKG2DL is a potential target for CAR-128

T therapy. Previous studies have indicated that ligation of NKG2D with its ligands 129




6

can activate NK cells and stimulate T cells in vitro (24), and ectopic expression of 130

NKG2DLs on tumor cells was sufficient to cause tumor rejection mediated by NK 131

cells (25). NKG2D-expressing CARs exhibited robust anti-tumor efficacy in several 132

different xenograft models, including models of multiple myeloma (26), ovarian 133

carcinoma (27), osteosarcoma (28), glioblastoma (29), pancreatic cancer (30), and 134

relapsed/refractory acute myeloid leukemia (31). NKG2DLs are also overexpressed in 135

human HCC, and the expression is significantly and negatively associated with poor 136

prognosis or early recurrence (32,33). However, no NKG2D-CAR has been reported 137

for HCC treatment. Therefore, we designed a NKG2D-BBz CAR with high 138

specificity and selectivity for HCC, and evaluated its antitumor activities using HCC 139

cell lines in vitro and in a xenograft mouse model in vivo. 140

141

Materials and methods 142

143

Plasmid construction and lentiviral package 144

The lentiviral vectors pTomo-pCMV-MICA-IRES-EGFP and pTomo-pCMV-ULBP2-145

IRES-puro, which were used for overexpression of MICA and ULBP2 in Hep3B cells 146

as described below, were constructed in a pTomo vector backbone (Addgene, USA). 147

The full-length human MICA (accession_NM_000247, primer: F, 148

ATGGGGCTGGGCCCGGTCTT; R, CTAGGCGCCCTCAGTGGAGCCAG ) and 149

ULBP2 (accession_NM_025217, primer: F, ATGGCAGCAGCCGCCGCTACCAAG; 150

R, TCAGATGCCAGGGAGGATGAAG) sequences were PCR-amplified using 151

PrimeSTAR HS DNA Polymerase (Takara, China) and inserted into the plasmids 152

between the XbaI and BamHI restriction sites. For the MICA andULBP2 shRNA 153

plasmids, the target sequences were cloned into a plko.1 puro vector obtained from 154




7

Addgene according to the manufacturer’s protocol (http://www.addgene.org/8453/). 155

The target sequences were as follow: shMICA-1, GCAGAAGATGTCCTGGGAAAT; 156

shMICA-2, ATTCAATTCCCTGCCTGGAT; shULBP2-1, 157

CCTCCTCTTTGACTCAGAGAA; shULBP2-2, TGAGCACGGTCTTGATCAAAC. 158

A codon-optimized targeting domain comprising the extracellular domain of human 159

NKG2D or CD19 scFv (as shown in the Supplementary Table) was synthesized 160

(Idobio, China) and fused to a CAR backbone comprising a human CD8 hinge spacer 161

and transmembrane domain, 4-1BB co-stimulatory domain and CD3ζ (BBz) (as 162

shown in the Supplementary Table 1). The entire encoding sequence of the CAR 163

expression molecule (as shown in Supplementary Table 1) was cloned into the 164

lentiviral vector LentiGuide-Puro (Addgene, USA) between the SmaI and MluI 165

restriction sites to replace PuroR and an EF1a promoter was inserted in front of the 166

CAR sequences by SmaI single digestion. For lentiviral package, the lentiviral 167

plasmids were co-transfected into HEK293T cells with the packaging plasmids 168

psPAX2 and pCMV-VSVG (Addgene, USA) at a ratio of 10:8:5. Lentivirus were 169

harvested as described before (34). 170

171

Cell lines and culture 172

The human liver cancer cell lines SMMC-7721, Hep3B, and MHCC97H were 173

purchased from Guangzhou Jennio Biotech Co., Ltd. in March 2018 and validated 174

using short tandem repeat (STR) profiling in October 2018.Hep3B cells were infected 175

with pTomo-CMV-ULBP2-IRES-puro and pTomo-CMV-MICA-IRES-EGFP 176

lentivirus [multiplicity of infection (MOI) = 10] to generate Hep3B-ULBP2 and 177

Hep3B-MICA cell lines, respectively. SMMC-7721 cells were infected with pTomo-178

CMV-luciferase-IRES-puro, plko-shMICA, and plko-shULBP2 lentivirus (MOI = 10) 179




8

and subsequently selected by puromycin (1 μg/ml) for 2 weeks to generate SMMC-180

7721-luciferase, SMMC7721-shMICA, SMMC7721-shULPB2, and SMMC7721-181

shMICA-shULBP2 cell lines, respectively. Hep3B, Hep3B-MICA, and Hep3B-182

ULBP2 cells were cultured in Dulbecco’s modified Eagle’s medium (Life 183

Technologies, USA) supplemented with 10% FBS (Life Technologies, USA), 100 184

U/ml penicillin, and 100 mg/ml streptomycin sulfate (Life Technologies, USA). 185

SMMC-7721 and MHCC97H cells were cultured in RPMI1640 (Life Technologies, 186

USA) supplemented with 10% FBS, 100 U/ml penicillin, and 100 mg/ml 187

streptomycin sulfate. HEK293T cells used for lentiviral package were obtained from 188

A. Lasorella (The Institute for Cancer Genetics, Columbia University Medical Center) 189

in December 2011 and cultured in DMEM (Life Technologies, USA) supplemented 190

with 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin sulfate. HEK293T 191

cells were not validated within the past year. All the cells were cultured at 37°C in a 192

humidified incubator with 5% CO2 and routinely confirmed to be Mycoplasma-free 193

by PCR. 194

195

Generation of CAR-T cells 196

Primary T cells were isolated from peripheral blood of three healthy donors and two 197

HCC patients using the RosetteSep™ Human T Cell Enrichment Cocktail 198

(STEMCELL, Canada) according to the manufacturer’s protocol. The purity of the 199

isolated cells was detected by flow cytometry using phycoerythrin-conjugated anti-200

human CD3 (Biolegend, 300408).T cells were cultured in RPMI1640 (Gibco, USA) 201

supplemented with 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin sulfate, 202

and 200 U/ml IL-2 (PeproTech, USA). To generate CAR-T cells, T cells were 203

stimulated with CD3/CD28 beads (Life Technologies, USA) at a ratio of 1:1 for 48 h 204




9

and then infected with lentiviral particles at a MOI of 10. All the patient studies were 205

approved by the Institutional Review Board at Kunming Institute of Zoology, Chinese 206

Academy of Sciences (approved ID: SMKX-2019022) with written informed consent 207

obtained from participants and conducted in accordance with the international ethical 208

guidelines for biomedical research involving human subjects. 209

210

In vitro cytotoxicity assays 211

The specific cytotoxicity of the CAR-modified T cells was tested against the various 212

HCC cell lines at variable effector-to-target (E/T) ratios of 0.5:1, 1:1, 2:1, 4:1, and 213

8:1. After 16 h of culture in RPMI1640 (Gibco, USA) supplemented with 10% FBS, 214

100 U/ml penicillin, 100 mg/ml streptomycin sulfate, cytotoxicity was measured 215

using Cell-Mediated Cytotoxicity Fluorometric Assay Kit (BioVison, K315-100, 216

USA) according to the manufacturer’s protocol. 217

218

Flow cytometry 219

Cells were harvested, washed twice with 1× PBS, and resuspended in cold PBS 220

containing 2% FCS, 1% sodium azide (at a density of 1 × 106 cells/ml). Subsequently, 221

labelled primary antibodies were added into the cell suspension according to the 222

manufacturers’ instructions and incubated for 1h at 4℃ in the dark. To evaluate CAR 223

expression, CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells were incubated 224

with Alexa Fluor 647-conjugated goat anti-mouse F(ab)2 (Jackson 225

ImmunoResearch，115-606-006) and allophycocyanin (APC)-conjugated anti-226

NKG2D (Biolegend, 320808), respectively. APC-conjugated MICA (R&D Systems, 227

FAB1300A), MICB (R&D Systems, FAB1599A), ULBP1 (R&D Systems, 228

FAB1380A), ULBP2/5/6 (R&D Systems, FAB1298A), and ULBP3 (R&D Systems, 229




10

FAB1517A) were used to determine the expression of NKG2DLs on different HCC 230

cells. APC-anti-CD4 (Biolegend, 357408) and FITC-anti-CD8 (Biolegend, 344704) 231

were used to detect the ratio of CD4-positive to CD8-positive T cells. All flow 232

cytometry readings were performed on the BD LSR Fortessa system and analyzed 233

using FlowJo software. 234

Cell growth analysis 235

To detect the proliferation capacity, a 5-ethynyl-uridine (EdU)-labeling assay was 236

performed using Click-iT EdU imaging Kits (Invitrogen, C10337). Briefly, EdU was 237

added to the cell culture medium at a final concentration 10 μM and incubated for 1 h 238

at 37°C in a humidified incubator with 5% CO2. Then the cells were harvested and 239

fixed with 4% paraformaldehyde. Permeabilization was performed with 0.3% Triton 240

X-100 followed by incubation withClick-iT reaction cocktail containing Alexa 241

Fluor® azide for 30 min at room temperature. The EdU incorporation rate was 242

analyzed by flow cytometry. To measure the proportion of apoptotic cells, cells were 243

harvested, washed with 1× PBS, and resuspended at a density of 1 × 106 cells/ml. 244

Thereafter, 7-aminoactinomycin D (Sangon Biotech, E607304-0200, China) was 245

added according to the manufacturer’s protocol and the ratio of stained cell was 246

analyzed by flow cytometry. 247

Cytokine release assay 248

CD19-BBz CAR-T and NKG2D-BBz CAR-T cells were co-cultured with SMMC-249

7721 cells in RPMI1640 (Gibco, USA) supplemented with 10% FBS, 100 U/ml 250

penicillin, 100 mg/ml streptomycin sulfate at an E/T ratio of 0:1 and 5:1, respectively, 251

for 16 h. 10 μL of the supernatant was collected and the concentrations of IFN-γ (BD 252

Biosciences，550612), interleukin (IL)-10 (BD Biosciences，550613), tumor 253




11

necrosis factor (TNF)-α (BD Biosciences，550610), and IL-2 (BD Biosciences，254

550611) were determined using respective enzyme-linked immunosorbent assay 255

(ELISA) kits as described above according to the manufacturer instructions. The 256

quantification was performed on the Synergy H1 (BioTek, USA) by measuring 257

absorbance at 450 nm. 258

In vivo HCC xenograft model 259

All protocols were approved by the animal ethics committee of the Kunming Institute 260

of Zoology, Chinese Academy of Sciences. Five to six-week-old NOD-Prkdcscid

261

Il2rgtm1

/Bcgen mice (B-NDG) were purchased from Jiangsu Biocytogen Co., Ltd. 262

(Jiangsu, China). A total of 1 × 106 SMMC-7721-luciferase cells were suspended in 263

PBS containing 30% Matrigel (BD Bioscience) and subcutaneously injected into the 264

B-NDG mice. When the mean tumor bioluminescence reached ~5 × 106 265

photons/second at one-week after tumor cell injectiona, the mice were anesthetized 266

with 2.5% avertin by intraperitoneal injection (15 ml/kg) followed by the 267

intraperitoneal injection of 150 mg/kg D-luciferin (BioVison, USA). Ten minutes 268

later, bioluminescent signals were recorded using an in vivo imaging software (IVIS) 269

system (Lumina Xr, USA), and the mice were randomly divided into the following 270

four groups: (i) tail intravenous injection of 100 l of sterile saline only without T 271

cells; (ii) 1 × 107 non-transduced T cells (NTD) in sterile saline; (iii) 1 × 10

7 272

genetically modified CD19-BBz CAR-T cells in sterile saline (CD19-BBz CAR); and 273

(iv) 1 × 107 genetically modified NKG2D-BBz CAR-T cells in sterile saline 274

(NKG2D-BBz CAR). After that, the bioluminescent signals were measured 275

approximately every 10 days. The data were quantified using Living Image software 276

(Caliper Life Science, USA). The mice were sacrificed when the tumor volume 277

reached approximately 2000 mm3. 278




12

Tissue microarray and immunohistochemistry (IHC) Analysis 279

Immunohistochemistry analysis was performed as described previously (34). Briefly, 280

sections cut from paraffin-embedded samples were deparaffinized, rehydrated, and 281

processed for antigen retrieval with sodium citrate buffer (Beyotime, china). The 282

sections were blocked with 10% serum from the same species as the source of the 283

secondary antibody for 1 hour at room temperature and incubated with primary 284

antibodies at 4°C overnight. Then, the sections were washed thrice in TBS 0.025% 285

Triton with gentle agitation and incubated with secondary antibodies for 1 hour at 286

room temperature. Chromogenic staining was performed on the sections using 3,3′-287

Diaminobenzidine (Beyotime, P0203, china) according to the manufacturer’s 288

protocol. The OD-CT-DgLive02-002 microarray (Outdo Biotech, Shanghai, China) 289

containing 32 human liver cancer samples, HOrgN090PT02 microarray (Outdo 290

Biotech, Shanghai, China) containing 90 normal tissues from major human organs 291

(including the thyroid, tongue, esophagus, stomach, duodenum, colon, liver, pancreas, 292

trachea, lung, heart, artery, skeletal muscle, skin, seminal vesicle, prostate, testis, 293

bladder, brain, and spleen) and HLivH060CD03 microarray (Outdo Biotech, 294

Shanghai, China) containing 7 non-tumor cirrhotic liver tissues were immunostained 295

using anti-MICA (Abcam, ab93170, USA) at a dilution ratio of 1:200 or anti-ULBP2 296

(thermo fisher, PA5-47118, USA) at a dilution ratio of 1:50. To investigate the 297

persistence of the administrated human T cells in the mice, the sections of formalin-298

fixed, paraffin-embedded lung, liver, bone marrow, hippocampus, spleen, kidney, 299

pancreas, and tumor tissues from the CD19-BBz CAR-T group and NKG2D-BBz 300

CAR-T groups were immuno-stained using an CD3-ξ antibody (Santa Cruz 301

Biotechnology, sc-1239, USA) at a dilution ratio of 1:100. 302

Karyotype assays 303




13

NKG2D-BBz CAR-T cells were collected 10 days after infection with NKG2D-BBz 304

CAR and normal T cells were used as controls. Karyotype assays were conducted as 305

previously described (35). Briefly, cells were treated with colcemid (Sangon Biotech, 306

A600322, China) at 37℃ for 2 hours, then harvested, washed in 0.075mol/L KCl at 307

37℃ for 10 min. Then the cells were fixed in freshly prepared fixative 308

(methanol/glacial acetic acid = 3/1), dropped onto slides, and dried at room 309

temperature. The chromosome images were captured on the Olympus DP71 310

microscope. 311

Statistical analysis 312

All statistical analyses were performed using GraphPad Prism 7.0 statistical software. 313

The data were all presented as mean ± standard deviation (SD). Statistical differences 314

between two groups were analyzed using Student’s t-tests with Welch correction. 315

Statistical differences among three or more groups were analyzed by one-way 316

ANOVA with Sidak correction. Statistical significance was defined as *P ≤ 0.05,

**P ≤ 317

0.01, ***

P ≤ 0.001. 318

319

Results 320

NKG2DLs were overexpressed in human liver cancer 321

To clarify the expression of NKG2DLs in clinical samples, we analyzed the RNA-Seq 322

data of paired liver cancer and normal tissues from the Cancer Genome Atlas (TCGA; 323

N = 50). The results showed that MICA, MICB, ULBP1, ULBP2, ULBP4, and ULBP5 324

were upregulated compared with those in paired normal tissues (Supplemental Fig. 325

S1). Similarly, immunohistochemistry in human liver cancer specimens on the OD-326

CT-DgLive02-002 microarray chip showed that expression levels of MICA and 327

ULBP2 were elevated in 72% (23/32) and 97% (31/32) of the liver cancer tissues, 328




14

respectively (Fig. 1A, B). Although the leading cause of HCC is cirrhosis and most 329

HCC patients have liver cirrhosis, the expression of MICA and ULBP2 was absent in 330

non-tumor cirrhotic liver tissue (Supplemental Fig. S2). In addition, flow cytometry 331

showed that the expression levels of all NKG2DLs were low in the Hep3B cell line, 332

while MICA and ULBP2 were highly expressed in the SMMC-7721 and MHCC97H 333

cell lines (Fig. 1C). These results clearly supported the possibility of using NKG2DL 334

as a target in HCC therapy. 335

336

NKG2D-BBz CAR-T cells lysed HCC cells in a NKG2DL-dependent manner 337

We designed the lentiviral expression vectors encoding CD19-BBz and NKG2D-BBz 338

as shown in Fig. 2A. T cells were isolated from PBMCs of healthy donors, and 99.2% 339

of the cells were confirmed to be CD3-positive by flow cytometry (Supplemental Fig. 340

S3). After activation with CD3/28 beads for 48 h, T cells were infected with CD19-341

BBz and NKG2D-BBz lentivirus. After 72 h, CD19 and NKG2D-BBz CAR were 342

detected in 42.3% and 46.1% of the T cells, respectively (Fig. 2B). The results of the 343

cytotoxicity assay showed that at the E:T ratio of 8:1, NKG2D-BBz CAR-T cells 344

could efficiently lyse SMMC-7721 and MHHC97H cells (approximately 100%), but 345

not the NKG2DLs-negative Hep3B cell line (less than 30%). By contrast, CD19-BBz 346

CAR-T cells failed to initiate the specific lysis of these HCC cell lines (Fig. 2C). 347

Cytotoxic T cells secrete several cytokines upon killing target cells. To confirm the 348

specific cytotoxicity of NKG2D-BBz CAR-T cells, cytokine were assessed in the cell 349

culture medium, demonstrating that TNF-α, IFN-γ, IL-10, and IL-2 were significantly 350

increased in SMMC-7721 cells cultured with NKG2D-BBz CAR-T cells, but not in 351

the culture medium of CD19-BBz CAR-T or NTD T cells (Fig. 2D). 352

To investigate if the cytotoxicity of NKG2D-BBz CAR-T cell was positively 353




15

correlated with the cell surface expression of NKG2D ligands, lentiviral particles that 354

induced MICA or ULBP2 silencing were constructed and used to infect SMMC-7721 355

cells (Supplemental Fig. S4). Silencing MICA and ULBP2 in SMMC7721-shMICA-356

shULBP2 cells was confirmed by flow cytometry (MICA, 72.5%; ULBP2, 80.1%; 357

Fig 3A). Correspondingly, NKG2D-BBz CAR-T cells showed less potent cytotoxicity 358

against SMMC7721-shMICA-shULBP2 cells compared to other cell lines (Fig 3B). 359

Ectopic NKG2DL-expressed cell lines Hep3B-MICA and Hep3B-ULBP2 were also 360

generated (Fig 3C). The cytotoxicity of NKG2D-BBz CAR-T cells towards the 361

Hep3B-MICA or Hep3B-ULBP2 cells was greater than 60%, even at the lowest E:T 362

ratio of 0.5:1 (Fig 3D), whereas the cytotoxicity towards the wild-type Hep3B cells 363

was only about 4% at the same E:T ratio (Fig 3D). These data indicate that the 364

cytotoxicity of NKG2D-BBz CAR-T on HCC cells is NKG2DL-dependent. 365

366

NKG2D-BBz CAR-T cells suppressed the growth of SMMC-7721 xenografts 367

To explore the therapeutic efficacy of NKG2D-BBZ CAR-T cells in vivo, 368

subcutaneous xenografts were established by injecting transfected SMMC-7721-369

luciferase cells into B-NDG mice, followed by of the CAR T-cell therapy 7 days later. 370

In all mice receiving saline, NTD, or CD19-BBz CAR-T, SMMC-7721 xenografts 371

progressively grew. However, the xenografts in mice receiving NKG2D-BBz CAR-T 372

cells had delayed tumor growth than the three control groups. Overall, 50% (3/6) of 373

the mice showed no tumors 19 days after infusion with NKG2D-BBz CAR-T cells, 374

while the other three mice only had minimal residual tumor remaining (Fig. 4A, B). 375

At the end of the study, four out of the six mice in the group receiving the NKG2D-376

BBz CAR-T cells were tumor-free, and the other two mice had very small tumors 377

remaining with bioluminescence of approximately 5 × 106 photons/second (Fig. 4A, 378




16

B). Collectively, these data demonstrate that NKG2D-BBz CAR-T cells can 379

successfully inhibit the tumorigenesis of subcutaneous SMMC-7721 xenografts. 380

Since the direct interaction between CAR-T cells and cancer cells is necessary 381

for a therapeutic effect, human T cells in the xenograft tumor and normal tissues were 382

detected via immunohistochemistry using anti-CD3-ξ. The immunohistochemistry 383

results showed that NKG2D-BBz CAR-T cells accumulated in SMMC-7721 384

xenografts, while only small quantities of CD19-BBz CAR-T cells were found in 385

tumors. Human T cells were also detected in the bone marrow of both the NKG2D-386

BBz CAR-T and CD19-BBz CAR-T groups but were absent in the lung, liver, kidney, 387

and brain (Fig. 4C). These results indicate that NKG2D-BBz CAR-T cells 388

preferentially infiltrated and resided in the HCC tumors, correlating to the efficient 389

suppression of tumor growth. 390

391

NKG2D-BBz CAR-T cells derived from HCC patients showed antitumor activity 392

HCC patients have reported abnormalities in their lymphocyte function (36), thus 393

the antitumor activity of NKG2D CAR-T cells derived from HCC patient T cells 394

needed to be verified. Peripheral blood collected from two HCC patients without 395

radiotherapy and chemotherapy was used to isolate T cells. Compared with the T cells 396

of a healthy donor, the patients’ T cells proliferated more slowly (Supplemental Fig. 397

S5). The T cells were infected with CD19-BBz and NKG2D-BBz lentiviral particles 398

and the expression of CARs was detected by flow cytometry. The patients’ CAR-T 399

cells had similar CAR expression efficiency and CD4/CD8 ratios to that of T cells 400

derived from healthy donor (Supplemental Fig. S6&S7). To determine the 401

cytotoxicity of NKG2D-BBz CAR-T cells from different sources against HCC cells, 402

we incubated T cells with SMMC7721 cells at different E:T ratios. The results 403




17

showed that patients’ NKG2D CAR-T cell have a comparable antitumor activity with 404

NKG2D CAR-T cell derived from a healthy donor (Fig. 5A). Correspondingly, both 405

NKG2D-BBz CAR-T cells showed effective antitumor activity against xenografts 406

formed by SMMC-7721 cells in B-NDG mice (Fig. 5B&C). As expected, xenografts 407

treated with normal saline (NS), or NTD, CD19-BBz CAR-T cells derived from HCC 408

patients grew rapidly (Fig. 5B&C). 409

Safety evaluation of CAR-T cells 410

The expression of tumor-associated antigens on normal cells often leads to severe off-411

target effects from CAR-T therapy, limiting their clinical application (37). Analysis of 412

the HOrgN090PT02 microarray chip demonstrated the lack of MICA expression in 413

most human tissues (thyroid, tongue, esophageal epithelium, gastric mucosa, jejunal 414

mucous membrane, ileal mucous membrane, appendix, mucous membrane of the 415

rectum, liver, pancreas, trachea, lung, myocardium, artery, skeletal muscle, seminal 416

vesicle, prostate, bladder, testis, medulla oblongata, telencephalon, epencephal, 417

brainstem, and spleen) except for the skin (3/3) (Fig. 6A). Considering gene transfer 418

mediated by lentivirus can possibly induce genome instability and cell malignant 419

transformation, karyotype and proliferation assays were performed to evaluate the 420

safety of CAR expression by lentivral infection. NKG2D-BBz CAR-T cells 421

maintained a normal karyotype compared with that of untransduced T cells for up to 422

14 days post-transduction (Fig. 6B). At 72 h after infection with the lentivirus 423

expressing CD19-BBz CAR and NKG2D-BBz CAR, there were no significant 424

alterations detected in the proliferation and apoptotic status of T cells (Supplemental 425

Fig. S8). 426

427

Discussion 428




18

The potential therapeutic efficacy of NKG2D-based CAR-T cells has been tested in 429

several malignant tumors, but their efficacy in liver cancer has not been assessed until 430

now. In this study, we designed a novel NKG2D-BBz CAR using the extracellular 431

domain of NKG2D instead of the full-length sequence, followed by 4-1BB and CD3ζ, 432

and successfully produced NKG2D-BBz CAR-T cells that showed strong cytotoxicity 433

against HCC cell lines in vitro as well as a therapeutic effect against HCC cell 434

xenografts in vivo These results demonstrated that NKG2D-BBz CAR-T can 435

specifically eradicate HCC cells in an NKG2DL-dependent manner, providing a 436

scientific basis for proceeding to a clinical trial for NKG2DL-positive patients. 437

CAR-T immunotherapy has excellent effects in hematologic malignancies (38). 438

Accordingly, many studies have been performed to extrapolate the success to solid 439

tumors, yet few have shown success (39). To date, several tumor-associated antigens 440

(TAA) expressed in liver tumor cells have been exploited for CAR-T therapy, and 441

were demonstrated to lyse HCC cells in vitro and eliminate mouse xenografts in vivo, 442

including GPC-3 (40), MUC1 (41), AFP (42), and CEA (43). However, the clinical 443

results of CAR-T cells in the treatment of HCC have yielded poor therapeutic 444

responses (18,44). The immunosuppressive tumor microenvironment is one of the 445

main contributors to the limited antitumor effects of CAR-T in liver cancers (18,36). 446

NKG2D-based CAR-T cells eliminate the inhibitive tumor microenvironment through 447

the following mechanisms: 1) killing the tumor neovasculature expressing NKG2DLs 448

to ameliorate the microenvironment and enhance the immunotherapy effect (45); 2) 449

killing immunosuppressive myeloid-derived suppressor cells and regulatory T cells; 450

and 3) recruiting myeloid cells and activated macrophages to modulate the immune 451

tumor microenvironment (46,47). Tumor heterogeneity is a major cause of tumor 452

immune escape and often leads to recurrence and metastasis. NKG2D-based CAR-T 453




19

cells can target multiple ligands expressed in tumor cells and thus may be beneficial 454

for the radical treatment of tumors (48). T lymphocytes, both CD4+ T helper cells and 455

CD8+ cytotoxic T cells usually play an important role in tumor suppression, and a 456

significant decrease in T cell activity has been observed in HCC patients (36). 457

However, in the present study, the CD4+/CD8+ ratio in NKG2D CAR-T cells in HCC 458

patients was still within the normal range (from 0.39 to 7.43) (49). In addition, 459

NKG2D CAR-T derived from patient T cells showed strong killing activity 460

specifically toward liver cancer cells. These findings suggest NKG2D CAR-T as a 461

potential multi-functional CAR-T therapy. 462

A major concern of CAR-T cells in clinical practice is their potential off-tumor 463

effects. For example, treatment with the receptor tyrosine-protein kinase ERBB2-464

CART resulted in acute respiratory distress syndrome in a patient with colorectal liver 465

metastasis due to the expression of Erbb2 in the lungs (50). In addition, treatment of 466

CEA antigen-directed CAR-T cells in colon cancer patients resulted in severe colitis 467

due to antigen recognition of the normal colonic tissue (51). Therefore, the specificity 468

of TAAs is of great importance in the application of CAR-T therapy. Using a tissue 469

chip including 96 samples from 27 tissue types, we confirmed that MICA, one of the 470

most important NKG2DLs, is not expressed in most normal tissues, which is in line 471

with previous reports (52,53). MICA is localized in the cytoplasm of most MICA-472

positive epithelial cells (54), suggesting that these MICA-positive epithelial cells 473

would not be targeted by NKG2D-BBz CAR-T cells. CAR NKR-2 (developed by 474

Celyad) was the first-generation NKG2D CAR with infusion of full-length NKG2D, 475

DAP10, and the CD3ζ cytoplasmic domain. Although MICA was found to be slightly 476

expressed in the skin, a phase I clinical trial of NKR-2 (NCT02203825) revealed that 477

seven patients with acute myeloid leukemia and five patients with multiple myeloma 478




20

were successfully treated with NKR-2 cells without obvious toxicities or other 479

adverse events (55). These data demonstrated the safety of NKG2D-based CAR-T 480

therapy. 481

Taken together, this study clarified the therapeutic roles of NKG2D-BBz CAR-T 482

cells in preclinical HCC models. Considering the proven safety of NKG2D CAR-T 483

cells in clinical trials with other cancers, their use can be expected to be applied in 484

clinical trials for NKG2DL-positive patients. 485

486

Acknowledgements 487

We would like to thank Guolan Ma from the Public Technology Service Center, 488

Kunming Institute of Zoology, Chinese Academy of Sciences for her technical 489

support in the flow cytometric analysis. 490

491

References 492

1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer 493

statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 494

cancers in 185 countries. CA Cancer J Clin 2018;68(6):394-424 doi 495

10.3322/caac.21492. 496

2. Llovet JM, Zucman-Rossi J, Pikarsky E, Sangro B, Schwartz M, Sherman M, et al. 497

Hepatocellular carcinoma. Nat Rev Dis Primers 2016;2:16018 doi 498

10.1038/nrdp.2016.18. 499

3. Llovet JM, Montal R, Sia D, Finn RS. Molecular therapies and precision medicine for 500

hepatocellular carcinoma. Nat Rev Clin Oncol 2018;15(10):599-616 doi 501

10.1038/s41571-018-0073-4. 502

4. Yang JD, Roberts LR. Hepatocellular carcinoma: A global view. Nat Rev 503

Gastroenterol Hepatol 2010;7(8):448-58 doi 10.1038/nrgastro.2010.100. 504

5. Dimitroulis D, Damaskos C, Valsami S, Davakis S, Garmpis N, Spartalis E, et al. 505

From diagnosis to treatment of hepatocellular carcinoma: An epidemic problem for 506

both developed and developing world. World J Gastroenterol 2017;23(29):5282-94 507

doi 10.3748/wjg.v23.i29.5282. 508

6. Llovet JM, Real MI, Montana X, Planas R, Coll S, Aponte J, et al. Arterial 509

embolisation or chemoembolisation versus symptomatic treatment in patients with 510




21

unresectable hepatocellular carcinoma: a randomised controlled trial. Lancet 511

2002;359(9319):1734-9 doi 10.1016/S0140-6736(02)08649-X. 512

7. Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, et al. Sorafenib in 513

advanced hepatocellular carcinoma. N Engl J Med 2008;359(4):378-90 doi 514

10.1056/NEJMoa0708857. 515

8. Bruix J, Qin S, Merle P, Granito A, Huang YH, Bodoky G, et al. Regorafenib for 516

patients with hepatocellular carcinoma who progressed on sorafenib treatment 517

(RESORCE): a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 518

2017;389(10064):56-66 doi 10.1016/S0140-6736(16)32453-9. 519

9. Lee S, Loecher M, Iyer R. Immunomodulation in hepatocellular cancer. J Gastrointest 520

Oncol 2018;9(1):208-19 doi 10.21037/jgo.2017.06.08. 521

10. Chen ZB, Shen SQ, Peng BG, Tao JP. Intratumoural GM-CSF microspheres and 522

CTLA-4 blockade enhance the antitumour immunity induced by thermal ablation in a 523

subcutaneous murine hepatoma model. Int J Hyperther 2009;25(5):374-82 doi 524

10.1080/02656730902976807. 525

11. El-Khoueiry AB, Sangro B, Yau T, Crocenzi TS, Kudo M, Hsu C, et al. Nivolumab in 526

patients with advanced hepatocellular carcinoma (CheckMate 040): an open-label, 527

non-comparative, phase 1/2 dose escalation and expansion trial. Lancet 528

2017;389(10088):2492-502 doi 10.1016/S0140-6736(17)31046-2. 529

12. Maude SL, Frey N, Shaw PA, Aplenc R, Barrett DM, Bunin NJ, et al. Chimeric 530

antigen receptor T cells for sustained remissions in leukemia. N Engl J Med 531

2014;371(16):1507-17 doi 10.1056/NEJMoa1407222. 532

13. Curran KJ, Brentjens RJ. Chimeric antigen receptor T cells for cancer 533

immunotherapy. J Clin Oncol 2015;33(15):1703-6 doi 10.1200/JCO.2014.60.3449. 534

14. Yip A, Webster RM. The market for chimeric antigen receptor T cell therapies. Nat 535

Rev Drug Discov 2018;17(3):161-2 doi 10.1038/nrd.2017.266. 536

15. Kershaw MH, Westwood JA, Parker LL, Wang G, Eshhar Z, Mavroukakis SA, et al. A 537

phase I study on adoptive immunotherapy using gene-modified T cells for ovarian 538

cancer. Clinical Cancer Research 2006;12(20):6106-15 doi 10.1158/1078-0432.Ccr-539

06-1183. 540

16. Gilham DE, Debets R, Pule M, Hawkins RE, Abken H. CAR-T cells and solid tumors: 541

tuning T cells to challenge an inveterate foe. Trends Mol Med 2012;18(7):377-84 doi 542

10.1016/j.molmed.2012.04.009. 543

17. Kakarla S, Gottschalk S. CAR T cells for solid tumors: armed and ready to go? 544

Cancer J 2014;20(2):151-5 doi 10.1097/PPO.0000000000000032. 545

18. Chen Y, E CY, Gong ZW, Liu S, Wang ZX, Yang YS, et al. Chimeric antigen 546

receptor-engineered T-cell therapy for liver cancer. Hepatobiliary Pancreat Dis Int 547

2018;17(4):301-9 doi 10.1016/j.hbpd.2018.05.005. 548

19. Raulet DH. Roles of the NKG2D immunoreceptor and its ligands. Nat Rev Immunol 549

2003;3(10):781-90 doi 10.1038/nri1199. 550




22

20. Zhang J, Basher F, Wu JD. NKG2D Ligands in Tumor Immunity: Two Sides of a 551

Coin. Front Immunol 2015;6:97 doi 10.3389/fimmu.2015.00097. 552

21. Champsaur M, Lanier LL. Effect of NKG2D ligand expression on host immune 553

responses. Immunol Rev 2010;235(1):267-85 doi 10.1111/j.0105-2896.2010.00893.x. 554

22. El-Gazzar A, Groh V, Spies T. Immunobiology and conflicting roles of the human 555

NKG2D lymphocyte receptor and its ligands in cancer. J Immunol 2013;191(4):1509-556

15 doi 10.4049/jimmunol.1301071. 557

23. Dhar P, Wu JD. NKG2D and its ligands in cancer. Curr Opin Immunol 2018;51:55-61 558

doi 10.1016/j.coi.2018.02.004. 559

24. Bauer S, Groh V, Wu J, Steinle A, Phillips JH, Lanier LL, et al. Activation of NK cells 560

and T cells by NKG2D, a receptor for stress-inducible MICA. Science 561

1999;285(5428):727-9. 562

25. Cerwenka A, Baron JL, Lanier LL. Ectopic expression of retinoic acid early inducible-563

1 gene (RAE-1) permits natural killer cell-mediated rejection of a MHC class I-bearing 564

tumor in vivo. Proc Natl Acad Sci U S A 2001;98(20):11521-6 doi 565

10.1073/pnas.201238598. 566

26. Barber A, Zhang T, Megli CJ, Wu JL, Meehan KR, Sentman CL. Chimeric NKG2D 567

receptor-expressing T cells as an immunotherapy for multiple myeloma. Exp Hematol 568

2008;36(10):1318-28 doi 10.1016/j.exphem.2008.04.010. 569

27. Barber A, Zhang T, DeMars LR, Conejo-Garcia J, Roby KF, Sentman CL. Chimeric 570

NKG2D receptor-bearing T cells as immunotherapy for ovarian cancer. Cancer 571

Research 2007;67(10):5003-8 doi 10.1158/0008-5472.Can-06-4047. 572

28. Fernandez L, Metais JY, Escudero A, Vela M, Valentin J, Vallcorba I, et al. Memory T 573

Cells Expressing an NKG2D-CAR Efficiently Target Osteosarcoma Cells. Clinical 574

Cancer Research 2017;23(19):5824-35 doi 10.1158/1078-0432.Ccr-17-0075. 575

29. Weiss T, Schneider H, Silginer M, Steinle A, Pruschy M, Polic B, et al. NKG2D-576

Dependent Antitumor Effects of Chemotherapy and Radiotherapy against 577

Glioblastoma. Clin Cancer Res 2018;24(4):882-95 doi 10.1158/1078-0432.CCR-17-578

1766. 579

30. Demoulin B, Cook WJ, Murad J, Graber DJ, Sentman ML, Lonez C, et al. Exploiting 580

natural killer group 2D receptors for CAR T-cell therapy. Future Oncol 581

2017;13(18):1593-605 doi 10.2217/fon-2017-0102. 582

31. Sallman DA, Brayer J, Sagatys EM, Lonez C, Breman E, Agaugue S, et al. NKG2D-583

based chimeric antigen receptor therapy induced remission in a relapsed/refractory 584

acute myeloid leukemia patient. Haematologica 2018 doi 585

10.3324/haematol.2017.186742. 586

32. Kamimura H, Yamagiwa S, Tsuchiya A, Takamura M, Matsuda Y, Ohkoshi S, et al. 587

Reduced NKG2D ligand expression in hepatocellular carcinoma correlates with early 588

recurrence. J Hepatol 2012;56(2):381-8 doi 10.1016/j.jhep.2011.06.017. 589

33. Fang L, Gong JY, Wang Y, Liu RR, Li ZS, Wang Z, et al. MICA/B expression is 590




23

inhibited by unfolded protein response and associated with poor prognosis in human 591

hepatocellular carcinoma. J Exp Clin Canc Res 2014;33 doi ARTN 76 592

10.1186/s13046-014-0076-7. 593

34. Yang D, Sun B, Zhang XH, Cheng DM, Yu XP, Yan LZ, et al. Huwe1 Sustains 594

Normal Ovarian Epithelial Cell Transformation and Tumor Growth through the 595

Histone H1.3-H19 Cascade. Cancer Res 2017;77(18):4773-84 doi 10.1158/0008-596

5472.Can-16-2597. 597

35. Chou CH, Yang NK, Liu TY, Tai SK, Hsu DS, Chen YW, et al. Chromosome 598

instability modulated by BMI1-AURKA signaling drives progression in head and neck 599

cancer. Cancer Res 2013;73(2):953-66 doi 10.1158/0008-5472.CAN-12-2397. 600

36. Sachdeva M, Chawla YK, Arora SK. Immunology of hepatocellular carcinoma. World 601

J Hepatol 2015;7(17):2080-90 doi 10.4254/wjh.v7.i17.2080. 602

37. Bonifant CL, Jackson HJ, Brentjens RJ, Curran KJ. Toxicity and management in CAR 603

T-cell therapy. Mol Ther-Oncolytics 2016;3 doi UNSP 16011 604

10.1038/mto.2016.11. 605

38. Gauthier J, Yakoub-Agha I. Chimeric antigen-receptor T-cell therapy for 606

hematological malignancies and solid tumors: Clinical data to date, current limitations 607

and perspectives. Curr Res Transl Med 2017;65(3):93-102 doi 608

10.1016/j.retram.2017.08.003. 609

39. Harper K. CAR T-cell Therapy for Solid Tumors? Cancer Discov 2018;8(11):1341- doi 610

Doi 10.1158/2159-8290.Cd-Nd2018-008. 611

40. Gao H, Li K, Tu H, Pan X, Jiang H, Shi B, et al. Development of T cells redirected to 612

glypican-3 for the treatment of hepatocellular carcinoma. Clin Cancer Res 613

2014;20(24):6418-28 doi 10.1158/1078-0432.CCR-14-1170. 614

41. Ma YD, Wang Z, Gong RZ, Li LF, Wu HP, Jin HJ, et al. Specific cytotoxicity of MUC1 615

chimeric antigen receptor-engineered Jurkat T cells against hepatocellular 616

carcinoma. 2014. 1177-82 p. 617

42. Liu H, Xu Y, Xiang J, Long L, Green S, Yang Z, et al. Targeting Alpha-Fetoprotein 618

(AFP)-MHC Complex with CAR T-Cell Therapy for Liver Cancer. Clin Cancer Res 619

2017;23(2):478-88 doi 10.1158/1078-0432.CCR-16-1203. 620

43. Burga RA, Thorn M, Point GR, Guha P, Nguyen CT, Licata LA, et al. Liver myeloid-621

derived suppressor cells expand in response to liver metastases in mice and inhibit 622

the anti-tumor efficacy of anti-CEA CAR-T. Cancer Immunol Immunother 623

2015;64(7):817-29 doi 10.1007/s00262-015-1692-6. 624

44. Li K, Lan Y, Wang J, Liu L. Chimeric antigen receptor-engineered T cells for liver 625

cancers, progress and obstacles. Tumour Biol 2017;39(3):1010428317692229 doi 626

10.1177/1010428317692229. 627

45. Zhang T, Sentman CL. Mouse tumor vasculature expresses NKG2D ligands and can 628

be targeted by chimeric NKG2D-modified T cells. J Immunol 2013;190(5):2455-63 doi 629

10.4049/jimmunol.1201314. 630




24

46. Barber A, Rynda A, Sentman CL. Chimeric NKG2D Expressing T Cells Eliminate 631

Immunosuppression and Activate Immunity within the Ovarian Tumor 632

Microenvironment. Journal of Immunology 2009;183(11):6939-47 doi 633

10.4049/jimmunol.0902000. 634

47. Spear P, Barber A, Rynda-Apple A, Sentman CL. Chimeric Antigen Receptor T Cells 635

Shape Myeloid Cell Function within the Tumor Microenvironment through IFN-gamma 636

and GM-CSF. Journal of Immunology 2012;188(12):6389-98 doi 637

10.4049/jimmunol.1103019. 638

48. Soriani A, Fionda C, Ricci B, Iannitto ML, Cippitelli M, Santoni A. Chemotherapy-639

elicited upregulation of NKG2D and DNAM-1 ligands as a therapeutic target in 640

multiple myeloma. Oncoimmunology 2013;2(12) doi ARTN e26663 641

10.4161/onci.26663. 642

49. Amadori A, Zamarchi R, Desilvestro G, Forza G, Cavatton G, Danieli GA, et al. 643

Genetic-Control of the Cd4/Cd8 T-Cell Ratio in Humans. Nat Med 1995;1(12):1279-644

83 doi DOI 10.1038/nm1295-1279. 645

50. Morgan RA, Yang JC, Kitano M, Dudley ME, Laurencot CM, Rosenberg SA. Case 646

report of a serious adverse event following the administration of T cells transduced 647

with a chimeric antigen receptor recognizing ERBB2. Mol Ther 2010;18(4):843-51 doi 648

10.1038/mt.2010.24. 649

51. Parkhurst MR, Yang JC, Langan RC, Dudley ME, Nathan DAN, Feldman SA, et al. T 650

Cells Targeting Carcinoembryonic Antigen Can Mediate Regression of Metastatic 651

Colorectal Cancer but Induce Severe Transient Colitis. Molecular Therapy 652

2011;19(3):620-6 doi 10.1038/mt.2010.272. 653

52. Groh V, Bahram S, Bauer S, Herman A, Beauchamp M, Spies T. Cell stress-654

regulated human major histocompatibility complex class I gene expressed in 655

gastrointestinal epithelium. Proc Natl Acad Sci U S A 1996;93(22):12445-50. 656

53. Groh V, Rhinehart R, Secrist H, Bauer S, Grabstein KH, Spies T. Broad tumor-657

associated expression and recognition by tumor-derived gamma delta T cells of 658

MICA and MICB. Proc Natl Acad Sci U S A 1999;96(12):6879-84. 659

54. Hue S, Mention JJ, Monteiro RC, Zhang S, Cellier C, Schmitz J, et al. A direct role for 660

NKG2D/MICA interaction in villous atrophy during celiac disease. Immunity 661

2004;21(3):367-77 doi 10.1016/j.immuni.2004.06.018. 662

55. Nikiforow S, Werner L, Murad J, Jacobs M, Johnston L, Patches S, et al. Safety Data 663

from a First-in-Human Phase 1 Trial of NKG2D Chimeric Antigen Receptor-T Cells in 664

AML/MDS and Multiple Myeloma. Blood 2016;128(22). 665

666

Figures 667

668




25

Figure 1. NKG2D ligands were overexpressed in liver cancer. The 32 liver cancer 669

specimens in the OD-CT-DgLive02-002 microarray were stained with MICA 670

antibody (A) and ULBP2 antibody (B), respectively. The samples with overexpression 671

of MICA or ULBP2 are marked with a triangle, scale bar = 500 μm. (C) NKG2D 672

ligand expression in Hep3B, SMMC-7721, and MHCC97H cell lines was detected by 673

flow cytometry. Data are representative or two independent experiments. Percentage 674

of positive cells is detailed in the histograms. 675

676

Figure 2. NKG2D-BBz CAR-T cells efficiently lysed HCC cells. (A) Schematic 677

representation of CD19-BBz CAR and NKG2D-BBz CAR. (B) CD19 and NKG2D 678

CAR expression on human T cells transduced with a lentivirus and analyzed using 679

flow cytometry. Data are representative of three independent experiments. Percentage 680

of positive cells is detailed in the histograms. (C). Primary human T cells transduced 681

with the indicated lentivirus were co-incubated with the three HCC cell lines at 682

varying effector: target (E: T) ratios for 16 h, respectively. Cell lysis was determined 683

by a standard nonradioactive cytotoxic assay. Two independent experiments were 684

performed. Data are presented as the mean ± SD of triplicates, statistical significance 685

between the NKG2D-BBz group and the other two groups was calculated using one-686

way ANOVA with Sidak correction, * P < 0.05, *** P < 0.001. (D) Cytokines released 687

in the co-culture supernatant by NTD, CD19-BBz, and NKG2D-BBz CAR-T cells 688

when co-cultured with SMMC-7721 cells at E:T ratios of 0:1 and 5:1; TNF-α, IL-10, 689

IL-2, and IFN-γ were detected in the supernatant collected 16 h after the culture. Two 690

independent experiments were performed. Data are presented as the mean ± SD of 691

triplicates and analyzed by two-tailed unpaired Student t test with Welch correction, 692

***P < 0.001. 693




26

694

Figure 3. Cytotoxic effect of NKG2D-BBz CAR-T was dependent on expression 695

of NKG2D ligands. (A) MICA and ULBP2 expression in indicated cells was assessed 696

by flow cytometry. Data are representative of two independent experiments. 697

Percentage of positive cells is detailed in the histograms. (B) Cytotoxicity of NKG2D-698

BBz CAR-T cells on SMMC7721-shCOO2, SMMC7721-shMICA, SMMC7721-699

shULBP2 and SMMC7721-shMICA-shULBP2 cells. Two independent experiments 700

were performed. Data are presented as the mean ± SD of triplicates, statistical 701

significance between the SMMC7721-shMICA-shULBP2 group and the other three 702

groups was calculated using one-way ANOVA with Sidak correction, * P < 0.05, ** P 703

< 0.01. (C) Flow cytometry analysis of MICA and ULBP2 expression in Hep3B-704

MICA or Hep3B-ULBP2 cells. Data are representative of three independent 705

experiments. Percentage of positive cells is detailed in the histograms. (D) Cytotoxic 706

effect of NKG2D-BBz CAR-T on Hep3B-MICA and Hep3B-ULBP2. Two 707

independent experiments were performed. Data are presented as the mean ± SD of 708

triplicates, statistical significance between the Hep3B-vector and the other two groups 709

was analyzed by one-way ANOVA with Sidak correction, ***P < 0.001. 710

711

Figure 4. NKG2D-BBz CAR-T potently suppressed tumorigenesis in an SMMC-712

7721 xenograft model. (A) B-NDG mice bearing SMMC-7721-luciferase xenografts 713

were i treated with 100 l of saline (N=5), 1 × 107 non-transduced T cells (N=5), 1 × 714

107 CD19-BBz CAR-T cells (N=6), and 1 × 10

7 NKG2D-BBz CAR-T cells (N=6) by 715

tail vein injection. All the mice were imaged with an IVIS imager at the indicated 716

times. Tumor growth was assessed by total bioluminescence signals. Data are 717

representative of two independent experiments. (B) Growth curve of SMMC-7721-718




27

luciferase xenografts treated as described above. (C) NKG2D-BBz CAR-T cells 719

accumulated in SMMC-7721-luciferase xenograft tumors. Tumors and normal tissues 720

were collected from mice bearing SMMC-7721-luciferase subcutaneous xenografts 721

treated with CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells. Formalin-fixed, 722

paraffin-embedded tumor sections were consecutively cut and stained for human CD3 723

expression (brown), data are representative of two independent experiments, scale bar 724

= 100 μm. 725

726

Figure 5. Patient derived NKG2D-BBz CAR-T potently suppress liver cancer 727

both in vitro and in vivo. (A) Cytotoxic effect of patient derived NKG2D-BBz CAR-728

T cells on SMMC-7721 cells. Two independent experiments were performed. Data 729

are presented as the mean ± SD of triplicates, statistical significance between the 730

NKG2D-BBz group and the corresponding CD19-BBz group was calculated using 731

two-tailed unpaired Student t test with Welch correction, ***P < 0.001. (B) B-NDG 732

mice bearing SMMC-7721-luciferase xenografts were treated with 100 l of saline or 733

1 × 107 patient derived T cells by tail vein injection. NKG2D-BBz CAR-T cells derived 734

healthy donor were used as the positive control. Mice were imaged at the indicated 735

times. Tumor growth was assessed by total bioluminescence signals. This experiment 736

was done once. (C) Growth curve of SMMC-7721-luciferase xenografts treated with 737

indicated T cells or saline (n = 4 per group). 738

739

Figure 6. Safety assessment of NKG2D-BBz CAR-T. (A) The 90 normal human 740

tissues in the HOrgN09PT02 microarray were stained with MICA antibody. The 741

samples containing more than 10% MICA positive cells are marked in red. A1–A4 : 742

Thyroid; A5–A7: tongue; A8–A11: esophageal epithelium; A12–B5: gastric mucosa; 743




28

B6–B7: duodenal mucosa; B8–C1: jejunal mucous membrane; C2–C4: ileal mucous 744

membrane; C5–C9: appendix; C10–D1: mucous membrane of the colon; D2–D3: 745

mucous membrane of the rectum; D4–D5: liver; D6–D7: pancreas; D8–D10: trachea; 746

D11–E3: lung; E4–E6: myocardium; E7–E9: artery; E10–F4: skeletal muscle; F5–F7: 747

skin; F8: seminal vesicle; F9–F11: prostate; F12–G6: testis; G7–G10: bladder; G11: 748

medulla oblongata; G12–H1: telencephalon; H2–H3: epencephala; H4: brainstem; 749

H5–H6: spleen, scale bar = 500 μm. (B) Karyotype of non-transduced T cells and 750

NKG2D-BBz CAR-T cells, data are representative of two independent experiments. 751

752




Published OnlineFirst September 4, 2019.Cancer Immunol Res Bin Sun, Dong Yang, Hongjiu Dai, et al. CAR T-cellsEradication of hepatocellular carcinoma by NKG2D-specific

Updated version

10.1158/2326-6066.CIR-19-0026doi:

Access the most recent version of this article at:

Material

Supplementary

C1

http://cancerimmunolres.aacrjournals.org/content/suppl/2019/09/04/2326-6066.CIR-19-0026.DAccess the most recent supplemental material at:

Manuscript

Authorbeen edited. Author manuscripts have been peer reviewed and accepted for publication but have not yet

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/early/2019/09/04/2326-6066.CIR-19-0026To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-19-0026http://cancerimmunolres.aacrjournals.org/content/suppl/2019/09/04/2326-6066.CIR-19-0026.DC1http://cancerimmunolres.aacrjournals.org/content/suppl/2019/09/04/2326-6066.CIR-19-0026.DC1http://cancerimmunolres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerimmunolres.aacrjournals.org/content/early/2019/09/04/2326-6066.CIR-19-0026http://cancerimmunolres.aacrjournals.org/

Article FileFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6

eradication of hepatocellular carcinoma by nkg2d-specific ...€¦ · 04.09.2019 · tumors,...

Documents