Upload File

exon table

1

Upload: tali-kaplan

Post on 08-Mar-2016

225 views

Category:

Documents


1 download

Report

DESCRIPTION

טבלת האקסונים של גן הדיסטרופין

TRANSCRIPT

Page 1: Exon Table

Exon Mobile Drilling Guide

Exon Autumn 2010

Exon Junction Complexes: Supervising the Gene Expression ...biology.hunter.cuny.edu/molecularbio/Class... · Review Exon Junction Complexes: Supervising the Gene Expression Assembly

Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

EXON - exeter.ox.ac.uk

EXON FT- M570.00 TECHNISCHES DATENBLATT

Identification of NURR1 (Exon 4) and FOXA1 (Exon 3 ...Parkinson’sDisease 5 100 400 300 200 MNURR1 exon 4 (1) M 349bp (a) 100 200 400 300 500 M NURR1 exon 4 (2) 416bp (b) 100 200

Table of Contents - gffcc.orggffcc.org/journal/docs/issue24/pp43-47_M.Alam.pdf · Table of Contents Original articles ... detection Mutations of JaK2 exon 12 in Patients with JaK2

74354267 Exon Mobile Drilling Guide

Splicing of phenylalanine hydroxylase (PAH) exon 11 is ... · Splicing of phenylalanine hydroxylase (PAH) exon 11 is vulnerable: Molecular pathology of mutations in PAH exon 11 Caroline

DECONVOLUTING BAC–GENE RELATIONSHIPS USING A ...stelo/papers/jbcb08.pdfGenes Unigenes exon intron probe Unigene Chromosome exon intron exon BACs BACs contig contig Fig. 1. An illustration

Grupo 5. 5’site 3’site branchpoint site exon 1 intron 1 exon 2 intron 2 AG/GT CAG/NT

DEFECTIVE(EXON(RECOGNITION( …library/doktorati/genetika/4Alanis.pdf · 2011. 10. 26. · 2.3.2.*Effect*of*modified*U1*snRNAs*on*FIX*exon*5*splicing**61 Section*2.4.!Effect!of!Exon!Specific!U1!snRNAs!(ExSpeU1s)!on!CFTR!exon!

Alternative Splicing Genomic DNA Sequence GmGm AAAAA Exon Intron Exon GmGm AAAAA Transcription mRNA RNA Processing pre-mRNA

Desastre Exon Valdez

PLA2G2A Exon 6 FGFR2 Exon 4Exon 3 CGI junction site: Chr1: 20304620xchr10:123317039 RELATEDJUNCTIONIDS : 4381 C0996N C0996T RTPCR Chromatogram PLA2G2A

Infantile Epilepsy Panel, Sequence Analysis and Exon

Exon mobil new

Ryan Exon Portfolio

Establishment exon- trapping - Fordham University

4: Genome evolution. Exon Shuffling 3 types of exon shuffling exon duplication = the duplication of one or more exons within a gene (internal duplication)

Response Heterogeneity of EGFR and HER2 Exon 20 Insertions to … · exon 20 mutations were identified (Table 1). The most common mutation resulted in a duplication of codon 772

Exon Mobil Mock Case

Hepatocellular Carcinoma - Exon Publications

PowerPoint Presentation · Retinoblastoma WT QRX-421 Exon 12 Exon 13 Exon 14 Exon 12 Exon 14 In-frame Exon 11 Exon 14 Out of-frame No AON QRX-421 Exon 12 Exon 13 Exon 14 Erwin van

Exon Mobil Spill 2011

 · Gefitinib Gefitinib 1. Non-small cell lung cancer EGFR DNA EGF-R exon 19 deletion, exon 21 [1.858R] substitution mutations, L861Q G719X EGFR exon 20

Exon-Mobile Drilling Guide

Prevalence of Mutation in BRCA1 gene, exons-2, 3, 5, 11 ... · exon 20 . were 94% homologous with USA; (Gene Bank . exon 20 from ACCESSION Number DQ478408.1) (Table 2). D. ISCUSSION

CRISPR/Cas9-mediated genome editing induces exon skipping ... · HeLa cells can cause skipping of exon 3, exon 4, or exons 3, 4, and 5 [18]. We also detected infrequent exon skipping

Supporting Information - PNAS · Supporting Information Aoki et al. 10.1073/pnas.1204638109 Fig. S1. Applicability of antisense-mediated exon skipping targeting each exon and exon

1 exon 2 exon - Nature · exon 1 p.Arg10Lysfs*60 ... In contrast to control patients with non‐NPHS2 associated glomerulopathies (C1 ... Microsoft Word - Tory-Supplementary data-jav.docx

Dysferlin-Exon-42-deletion in pUC57-Kan 8545 bp€¦ · Dysferlin-Exon-42-deletion_in_pUC57-Kan 5' gcctgccgctggcctccaccactcagtacagccgtgcagtctttgacgggtgccactactactacctacc Dysferlin-Exon-42-deletion

sample IDgene cHGVS pHGVS exon/intronallele frequencyfunctionfp.amegroups.cn/cms/ea9ba561f7823c93a42e9c8ef64a84bb/TLCR-2… · sample IDgene cHGVS pHGVS exon/intronallele frequencyfunction

Lineage-specific splicing of a brain-enriched alternative exon promotes …dm5migu4zj3pb.cloudfront.net/manuscripts/68000/68836… ·  · 2014-06-19brain-enriched alternative exon