R

Ei

DKa

b

c

a

ARRA

KACI

1

ii

CMT

0d

Veterinary Immunology and Immunopathology 144 (2011) 382– 388

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology

j o ur nal ho me p age: w ww.elsev ier .com/ locate /vet imm

esearch paper

xpression and distribution of canine antimicrobial peptidesn the skin of healthy and atopic beagles

omenico Santoroa,∗, Rosanna Marsellab, David Bunickc, Thomas K. Gravesa,aren L. Campbell a

Department of Veterinary Clinical Medicine, University of Illinois at Urbana-Champaign, Urbana, IL, USADepartment of Small Animal Clinical Sciences, University of Florida, Gainesville, FL, USADepartment of Comparative Biosciences, University of Illinois at Urbana-Champaign, Urbana, IL, USA

r t i c l e i n f o

rticle history:eceived 9 June 2011eceived in revised form 4 August 2011ccepted 9 August 2011

eywords:ntimicrobial peptidesanine beta defensins and cathelicidin

n canine atopic dermatitis

a b s t r a c t

Antimicrobial peptides (AMPs) are small immuno-modulatory proteins important indefense against pathogenic organisms. Defensins and cathelicidin are the most frequentlystudied human AMPs. An increase in AMPs in atopic humans has been reported recently.Our goals were to determine the distribution of AMPs and evaluate their mRNA and pro-tein expression in non-lesional (Day 0), acute lesional skin (Day 3) and post-challenged skinafter resolution of skin lesions (Day 10) using a canine model of atopic dermatitis (AD). Alldogs were environmentally challenged for three consecutive days with house dust mite.Clinical evaluation of atopic beagles was performed using a CADESI score at each time pointbefore and after environmental challenge. Skin biopsies were taken from six healthy andseven atopic beagles before and after allergen challenge (Day 0, Day 3 and Day 10). Thetranscription of canine cathelicidin (cCath) and beta-defensins (cBD)-1, -2 and -3 mRNAwas quantified using quantitative-RT-PCR while the protein distribution of cBD2, cBD3 andcCath was detected by indirect immunofluorescence. A significant effect, over-time, wasseen in CADESI score in AD beagles with an increase score after challenge (Day 3). Quanti-tative analysis showed a significant difference in mRNA transcript levels between groups

(with atopic dogs having more than controls) for all AMPs but cBD2. No effect over time wasevident for either group. No significant differences were seen for the AMP protein patternsof distribution (homogenous distribution). Although, these results showed no differencesin AMP’s localization after allergen exposure in each group; atopic dogs had a higher mRNAexpression of AMPs when compared with healthy dogs, a similar finding to humans.

© 2011 Elsevier B.V. All rights reserved.

. Introduction

In the past decade the interest in skin barrier defects innflammatory skin diseases, like atopic dermatitis (AD), hasncreased notably in both human and veterinary medicine.

∗ Corresponding author at: University of Illinois at Urbana-Champaign,ollege of Veterinary Medicine, Department of Veterinary Clinicaledicine, 1008 W Hazelwood Drive, Urbana, IL 61802, USA.

el.: +1 217 265 6412; fax: +1 217 244 9554.E-mail address: dsantor2@illinois.edu (D. Santoro).

165-2427/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.vetimm.2011.08.004

As part of the skin barrier, antimicrobial peptides (AMPs),a diverse group of small, mainly cationic endogenous pro-teins have been largely studied. To date over 1000 AMPs,sub-classified based on their molecular structure, havebeen identified in diverse species (Marshall and Arenas,2003; Jenssen et al., 2006). Of such peptides, �-defensins(BD) and cathelicidins (Cath) have been the most studied.

They are primarily secreted by keratinocytes, sebocytes,sweat glands, mast cells, neutrophils and natural killercells (Di Nardo et al., 2003; Lee et al., 2008; Braff et al.,2005; Murakami et al., 2002; Agerberth et al., 2000; Linde

gy and I

D. Santoro et al. / Veterinary Immunolo

et al., 2008). Such peptides have two main functions;they have antimicrobial activity against bacteria, fungi andviruses and they also modulate the innate and adaptiveimmune responses in higher organisms (Jenssen et al.,2006; Gallo et al., 2002; Schauber and Gallo, 2008). Dueto their immune-modulating activity, they have gainedincreased interest in inflammatory skin conditions, like ADand psoriasis. In fact, it has been suggested that a decreasedexpression of AMPs in patients affected by atopic eczema,when compared with humans affected by psoriasis, couldbe part of the reason why atopic patients are more sus-ceptible to skin infection compared with healthy humansor patients affected by psoriasis (Zanetti et al., 1995; Fultonet al., 1997; Gallo et al., 2002; Ong et al., 2002; Howell et al.,2005; Harder and Schroder, 2005; de Jongh et al., 2005;Howell et al., 2006; Howell, 2007; Stryjewski et al., 2007;Guttman-Yassky et al., 2008; Pálffy et al., 2009). However,this theory has been recently challenged by several stud-ies showing, at both the molecular and protein level, anincreased expression of AMPs like BDs, Cath, psoriasin andribonuclease7 (RNAase7) (Bellardini et al., 2009; Glaseret al., 2009; Harder et al., 2010). Similarly to human, ani-mal AMPs have been localized in tissues most frequently incontact with external agents, such as mucosal epithelia andskin, along with testes and blood (Sang et al., 2005, 2007;Jenssen et al., 2006; Schauber et al., 2008; Wingate et al.,2009; Van Damme et al., 2009; Santoro et al., 2011). Whileseveral AMPs have been identified in different species,defensins (� and �) and Cath have been the most studied(Schauber et al., 2008; Linde et al., 2008).

To date, four BDs (hBD1–4) have been identified inhuman skin (Schauber et al., 2008), whereas eight BDs havebeen identified in canine skin (cBD1, cBD1-like, cBD2, cBD3,cBD102, cBD103, cBD122 and cBD127) (Wingate et al.,2009; Van Damme et al., 2009; Santoro et al., 2011). Ofthese, three (cBD1, 2 and 3) have been also identified in thetestis (Sang et al., 2005). From the above mentioned studiesit has been assessed that the canine BDs have a homol-ogy that varies from 51% to 80% compared with the humanpeptides, with cBD103 and hBD3/103A being the most sim-ilar (Sang et al., 2005; Wingate et al., 2009; Van Dammeet al., 2009). Presently, only one Cath has been identified inboth humans (LL-37) and dogs (cCath) (Jenssen et al., 2006;Linde et al., 2008). Comparing the canine sequence withthe human cathelicidin precursor (CAMP18), a 68% mRNAsequence similarity and a 57% protein sequence similarityhave been identified by the authors.

Very little information on the relationship betweenAMPs and AD has been reported in dogs. One groupof investigators analyzed the expression of cBD103 indogs with chronic AD showing a decreased expression ofcBD103 in lesional skin compared with non-lesional andhealthy skin (Van Damme et al., 2009). Unfortunately,the investigation of such AMPs and its involvement inthe pathogenesis of AD in dogs with naturally occurringdisease is difficult to assess due to the presence of multipleconfounding factors (e.g. different breeds, living conditions

and diet). Recently, a model for canine AD has been iden-tified in a colony of high IgE atopic beagles which developclinically, histologically, and immunohistochemically,lesions similar to naturally occurring canine AD, after envi-

mmunopathology 144 (2011) 382– 388 383

ronmental challenge with house dust mite allergen (HDM)(Marsella et al., 2006; Marsella and Girolomoni, 2009).

Thus to gain more insight into the role of AMPs incAD, we analyzed the mRNA expression of three cBDs(cBD1, cBD2, and cBD3) and cCath in healthy and atopicdogs (lesional and non-lesional skin). The cBDs and cCathused were selected based on previously demonstratedantimicrobial properties. In addition, we evaluated theirdistribution in the epidermis using Indirect Immunofluo-rescence (IF).

2. Materials and methods

2.1. Animals

Seven experimentally sensitized atopic beagle dogs (3male, 4 female; age: 4 years) were studied. They are mem-bers of a colony that has been validated as a model forcanine atopic dermatitis (Marsella et al., 2006; Marsellaand Girolomoni, 2009). These dogs are sensitized to theHDM but have minimal or no signs of atopic disease whennot under antigenic challenge. Six clinically healthy, femalebeagle dogs (age range: 4–6 years) with no history of skindiseases, skin allergies or pruritus were used as controls.The study protocol was approved by the Institutional Ani-mal Care and Use Committees of the University of Illinoisand University of Florida.

2.2. Atopic dogs

All dogs were housed in a research facility at theUniversity of Florida, housed indoors in temperature-and humidity-controlled cement runs (72–75 ◦F; relativehumidity of 68–72%) that are washed daily using hightemperature and pressure wash (water and bleach). Fil-ters are changed routinely and stuffed toys, carpets, softbedding or anything that could trap dust are not allowedin the runs. Walls of the runs and filters are checkedmonthly to ensure the absence of HDM in the environ-ment in between challenges [results are below detectionlevel of test used (MITE-T-FastTM Allergen Detection Sys-tem, Aveho Biosciences). The dogs were fed maintenancediet (Hill’s Science Diet Adult Maintenance kibble formula-tion; Hill’s Pet Nutrition Inc., Topeka, KS, USA).

2.3. Clinically healthy dogs

The six dogs belonging to a research colony at the Uni-versity of Illinois are housed indoors in a temperature- andhumidity-controlled facility (72–75 ◦F; relative humidity of68–72%). The dogs were housed in individual cement runscleaned daily using high-temperature and high-pressurewash. The dogs were fed maintenance diet (Hill’s Sci-ence Diet Adult Maintenance kibble formulation; Hill’s PetNutrition Inc., Topeka, KS, USA).

2.4. Environmental challenge with HDM in sensitized

dogs

All dogs (AD and control) were challenged for HDM aspreviously described (Marsella et al., 2006). Briefly, the

3 gy and I

aCdi

2

atbba(ldfttsT

2

vccToItdwowac

2

nPRtd

TP

84 D. Santoro et al. / Veterinary Immunolo

nimals were exposed to 50 mg of D. farinae (Greer®, Northarolina, USA) placed on the bottom of their kennels. Allogs were allowed to stay in the kennels for 3 h/day, 3 days

n a row, as previously described (Marsella et al., 2006).

.5. Clinical evaluation

Severity of clinical signs was scored using the caninetopic dermatitis extent and severity index scoring sys-em (CADESI) (Marsella et al., 2006). Dogs were scored ataseline (before allergen exposure), three days after theeginning of the challenge (Day 3 – acute lesional skin)nd seven days after discontinuation of allergen exposureDay 10 – post-challenged skin with resolution of the skinesions). In the CADESI scoring system, the dog’s body isivided into small areas and each of them receives a scoreor erythema, erythematous macules, papules, excoria-ions, and alopecia. Individual score ranges from 0 (absent)o 3 (severe) for each site and each symptom and the totalcores are calculated by adding the scores of all body sites.otal CADESI scores were used in the statistical analysis.

.6. Skin sample collection

One 8-mm biopsy punch from either the inguinal or theentral thorax area from lesional and not lesional areas wasollected following subcutaneous injection of 1 ml of lido-aine (Lidocaine HCl 2%, Hospira Inc., Lake Forest, USA).he skin biopsy was immediately divided in two halves,f which one half was fixed in 10% buffered formalin forIF evaluation, while the other half was further divided inwo quarters, placed in 1.5 ml microfuge tubes, and imme-iately flash frozen in Liquid Nitrogen. These latter samplesere stored at −80 ◦C until processed for molecular biol-

gy evaluation (QRT-PCR). The inguinal or ventral thoraxas chosen for the skin biopsy as it is an easily accessible

rea with low level of hair density and since it is the mostommon area involved in AD.

.7. Quantitative RT-PCR

One quarter of the 8 mm biopsy punch was homoge-ized using a PowerGen 125 (Fisher Scientific, Pittsburgh,

A) and then processed into RNA using the AllPrep®

NA/protein kit (Qiagen, Valencia, CA) reagents andhe according to manufacturer’s protocol as previouslyescribed (Santoro et al., 2011) Briefly, the total RNA

able 1rimers used.

Canine gene Primer sequences

cBD1 Forward: CCTGAAGACATGAAGGCTTTReverse: TGAGATCAGACTTGGGACAGG

cBD2 Forward: AGTGGGAAACTATGCTGTCTReverse: GTGCTAAGTGTCAGAATTGC

cBD3 Forward: CAGACATAAAAACAGACACAReverse: AGTTGACCATATAGGTGTAG

cCath Forward: CACTGTTGCTACTGCTGCTGReverse: GTTGAAGCCATTCACAGCAC

RPLO Forward: TTGTGGCTGCTGCTCCTGTGReverse: ATCCTCGTCCGATTCCTCCG

mmunopathology 144 (2011) 382– 388

concentrations were determined at 260 nm using UVspectrophotometry then the integrity and quality ofthe RNA was checked using an Agilent 2100 Bioan-alyzer (Agilent Biotechnologies Inc. Santa Clara, CA,USA). After DNAse treatment using a Turbo DNA-freeTM

kit (Invitrogen, Carlsbad, CA), total RNA (0.5 �g) wasconverted to complementary DNA (cDNA) by reversetranscription of mRNA using SuperScript First-StrandSynthesis System (Invitrogen, Carlsbad, CA). Sense andantisense primers for each AMP (Table 1) were gen-erated using Primer Designer software (Scientific andEducational Software, Inc.). Each primer was designedto cross an exon–exon boundary, maximizing the ampli-fication of the mRNA transcript target and minimizingamplification of any residual contaminating genomicDNA. The primers were generated from previouslypublished Gene Bank (http://www.ncbi.nlm.nih.gov/)AMP sequences (Sang et al., 2005, 2007). All primersequences were subjected to BLAST analysis for unintendedhomologies (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Therelative mRNA expression levels were quantified usinga SYBR® Green assay (Qiagen, Valencia, CA) and ABI(Applied Biosystems Inc, Foster City, CA) quantitative-RT-PCR methodology (User bulletin applied biosystems75000/75000 fast real-time PCR systems. Available at:www3.appliedbiosystems.com/cms/groups/mcb support/documents/generaldocuments/cms 050637.pdf. AccessedJune 13, 2009). All samples were performed in triplicate50 �l RT reactions in an ABI 7500 Real Time PCR System(Applied Biosystems Inc, Foster City, CA). PCR amplifi-cations were carried out as followed: 50 ◦C for 2 min;95 ◦C for 10 min; 40 cycles of 95 ◦C for 15 s, 60 ◦C for 60 s.Amplifications were followed by dissociation (melting)curves to ensure specificity of the primers. In initial tests,dilution curves were generated for each gene primer setto determine their amplification efficiencies (Table 1)(Santoro et al., 2011). The results were analyzed usingthe comparative CT (cycle threshold) method and therelative mRNA expression of each AMP was comparedusing the ��CT method compare the defensins and cathe-licidin. This method is effective when the amplificationefficiencies of the housekeeping gene and target geneare similar. When this criteria is fulfilled the formula is

2−[�CT experimental sample−�CT control sample] where �CT is thedifference between the target gene and the normalizergene expression (Pfaffl, 2001). All samples were normal-ized against the canine ribosomal protein L15 (RPLO). This

Efficiency (%) Amplicon length

95 267

110 79

100 78

110 98

101 107

gy and I

the two groups, a statistically significant higher expressionof cBD1, cBD3 and cCath, but not cBD2 was shown inatopic dogs (Table 2). At Day 0 cBD1, cBD3 and cCath

mRNA expressions were 10.0-, 6.0- and 5.0-fold more

D. Santoro et al. / Veterinary Immunolo

gene was chosen due to the highly stable and consistentexpression, previously shown for ribosomal genes incanine skin (Wood et al., 2008).

2.8. Antibody preparation

Polyclonal anti-canine-AMP antibodies were generatedas previously described (Santoro et al., 2011). Briefly,the canine anti-AMP antibodies were produced based onthe genetic sequences previously identified (Sang et al.,2005, 2007) and published in GenBank (http://www.ncbi.nlm.nih.gov/). Based on these genetic and amino acidsequences the most immunogenic epitopes were chosenfor each protein and synthetic peptides were created. Theamino acid sequences were then analyzed against theBLAST database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) forcomparative evaluation. Since the amino acid sequence ofcBD1 overlaps with part of both cBD2 and cBD3 sequences,it was not possible to generate an appropriate polyclonalantibody against it. The specificity of the anti-canine-AMPantibodies was tested by immunoabsorption on tissue sec-tions and by ELISA showing no cross reaction. All animalcare and work was done in compliance with federal regu-lations and Institutional Animal Care and Use Committeeof the University of Illinois guidelines.

2.9. Indirect immunofluorescence

One-half of the 8-mm skin biopsy was fixed in 10%buffered formalin solution for no more than 48 h and thenplaced in phosphate buffer solution until processed for IF(Santoro et al., 2011). Briefly, 3-�m skin-tissue sectionswere processed using the immunohistochemical polymerprocedure. The sections were blocked using a casein solu-tion (Power Block®; BioGenex, San Ramon, CA) followedby an extra wash using normal goat serum (BioGenex,San Ramon, CA) as a blocking solution. Epitope retrievalwas not necessary for cBD2 and cBD3, whereas it wasrequired for cCath. In the latter case, the method consistedof using boiled sections, performed at 125–130 ◦C under17–23 lbs pressure for 30 s followed by a 10 s treatmentat 90 ◦C. The sections were then stained for 1 h at roomtemperature using primary polyclonal rabbit antibodiesspecific for cBD2, cBD3 and cCath. The primary antibod-ies were used at 1:200 dilution. Negative controls wereestablished using the pre-immune serum at 1:200 dilution.The sections were washed with a blocking solution (PowerBlock®; BioGenex, San Ramon, CA) and then incubated for30 min at room temperature with a polyclonal goat anti-rabbit antibody bound with a green fluorochrome (AlexaFluor® 488, Invitrogen, USA) at 1:1000 dilution, accordingto manufacturer’s recommendations. Finally, DAPI (4′,6-diamidino-2-phenylindole) (Invitrogen, Carlsbad, CA) wasused as a counterstain for nuclear detection. Specimenswere mounted on glass slides using Vectashield® Mount-ing Medium (Vector Laboratories, USA). The skin sections

were examined using an inverted fluorescence microscope(Nikon Eclipse TE 2000-S®). The images were analyzedusing MetaMorph® software (Version 63r1; MolecularDevices, Sunnyvale, CA). Five representative fields at 40×

mmunopathology 144 (2011) 382– 388 385

magnification were examined for each section and picturesrecorded.

2.10. Statistical analysis

Mean values and 95% confidence intervals were calcu-lated for all results. Differences between �CT [CTAMP − CTRPLO] of each AMP were compared using one-way ANOVA.The Kolmogorov–Smirnov test of normality was used(alpha = 0.05), and Tukey’s Multiple Comparison Test wasused for post hoc testing. The clinical score obtained over-time in the atopic group was also analyzed using one-wayANOVA. The Kolmogorov–Smirnov test of normality wasused (alpha = 0.05), and Tukey’s Multiple Comparison Testwas used for post hoc testing. P values of ≤0.05 wereconsidered significant. Statistical analysis was done usingGraphPad Prism software (GraphPad Software, Inc., SanDiego, CA).

3. Results

3.1. Clinical scores

For CADESI, the Analysis of Variance showed signifi-cant effects of time (P = 0.0118). In particular, the Tukey’sMultiple Comparison Test detected a difference betweenDay 0 and Day 3 (P < 0.05) and between Day 3 and Day10 (P < 0.05); however no difference was detected betweenDay 0 and Day 10 (P > 0.05) (Fig. 1).

3.2. mRNA expression

QRT-PCR was used to compare AMP expression inhealthy versus non-lesional AD skin (Day 0), acute lesionalAD skin (Day 3) and post-challenged AD skin afterresolution of the skin lesions (Day 10). After statisticalanalysis, a significant effect over-time was not presentfor any AMPs in any group (P > 0.05). When we comparedmRNA expression of each AMP at each time point, between

Fig. 1. Average of CADESI-03 score before, during and after environmentalchallenge (*: P ≤ 0.05; bars: standard errors of the mean).

386 D. Santoro et al. / Veterinary Immunology and I

Table 2P values of mRNA expression of each AMP at each time point betweenatopic and healthy beagles (*: P ≤ 0.05).

cBD1 cBD2 cBD3 cCath

Day 0 0.01* 0.5 0.002* 0.005*

eAr5

FdbGP3

Day 3 0.004* 1 0.008* 0.05*Day 10 0.004* 0.7 0.008* 0.001*

xpressed in AD beagles than in healthy dogs, respectively.t Day 3 the differences were of 9.5-, 8.8-, and 6.5-fold,

espectively. At Day 10 cBD1, cBD3 and cCath were 9.0-,.0- and 8.0-fold more expressed, respectively (Fig. 2).

ig. 2. mRNA expression for each antimicrobial peptide (canine �-efensin [cBD]1, cBD2, cBD3 and canine cathelicidin [cCath]) in atopiceagles compared with normal age and breed-matched control dogs.roups were compared using the Tukey’s Multiple Comparison Test (*:

≤ 0.05; bars: standard error of the mean) (Day 0: non-lesional skin; Day: acute lesional skin; Day 10: post-challenged skin).

mmunopathology 144 (2011) 382– 388

3.3. Indirect immunofluorescence

We used IF to analyze the distribution of AMPs in theskin of healthy and AD dogs. In both groups the pro-teins were homogeneously distributed with cBD2 and cBD3detectable in all layers of the epidermis, whereas cCath wasdetected predominantly in the stratum granulosum andstratum corneum, as previously reported in healthy dogs(Santoro et al., 2011). When the pattern of distribution ofeach AMP in healthy beagles was compared with the pat-tern of distribution in AD dogs, there were no differencesdetected.

4. Discussion

Low expression of AMPs has been proposed as anexplanation for recurrent skin infections in atopic humanpatients (Zanetti et al., 1995; Fulton et al., 1997; Galloet al., 2002; Ong et al., 2002; Harder and Schroder, 2005;Howell et al., 2005, 2006; Howell, 2007; Stryjewski et al.,2007; Pálffy et al., 2009). In fact, it is well known thatatopic patients have an increased risk of staphylococcalpyoderma, Malassezia dermatitis and eczema herpeticum(Wollenberg et al., 2010). Investigators have reportedaltered expression of AMPs in atopic eczema showing asignificant reduction of BD and Cath expression comparedwith patients with psoriasis (Ong et al., 2002; de Jonghet al., 2005; Guttman-Yassky et al., 2008). These resultssuggested that AMPs were involved in the local immunode-ficiency affecting atopic patients. However, more recently,a few papers have contradicted this hypothesis by show-ing an actual increase of AMPs (BDs, Cath and psoriasin)in atopic patients when compared with healthy humans(Bellardini et al., 2009; Glaser et al., 2009; Harder et al.,2010).

Atopic dogs, like atopic humans, are more susceptibleto bacterial and Malassezia skin infection, but only recentlythere have been an increased interest in the role of AMPsas possible cause of such predisposition (Sang et al., 2005,2007; Schauber and Gallo, 2008; Wingate et al., 2009; VanDamme et al., 2009; Santoro et al., 2011). Of those, onlyVan Damme et al. (2009) have analyzed the expression ofcBD103 in atopic dogs showing a decrease protein expres-sion of this peptide in AD dogs.

Our results show that some canine �-defensins (cBD1,cBD2 and cBD3) and canine cathelicidin are increased inlesional, non-lesional and post-challenged skin after reso-lution of the skin lesions in atopic beagles when comparedwith healthy controls. These results are in accordance withBellardini et al. (2009) and Harder et al. (2010) in demon-strating a clear increase of LL-37, and BDs (hBD2 and hBD3)in atopic eczema when compared with healthy individuals.In addition, our study showed that there is no difference incutaneous distribution between lesional, non-lesional andpost-challenged AD and healthy skin.

According with the most recent studies, the higher

expression of AMPs in lesional and non-lesional AD skin inboth humans and dogs may contradict with the hypothesisof their decrease as major cause of recurrent skin infectionin AD patients. These results also seem to contrast previous

gy and I

D. Santoro et al. / Veterinary Immunolo

works which seemed to clearly show an inverse correla-tion between AMPs and T-helper 2 cytokines expression(Fulton et al., 1997; Nomura et al., 2003; Howell et al.,2005, 2006). In fact, AMPs seem to be lower in presence ofInterleukin (IL)-4, IL-10 and IL-13 whereas IL-1, IL-17 andIL-22 seem to stimulate their production (Nomura et al.,2003; Liu et al., 2003; Howell et al., 2005, 2006). How-ever, Harder et al. (2010) have shown a higher expressionof hBD2 and hBD3 in acute AD compared with chronicdisease suggesting that maybe a T-helper 2 environmentis not enough to inhibit AMPs production. For veterinarymedicine, to the authors’ best knowledge, no studies havebeen published analyzing the AMPs expression in differentT-helper milieus, but it is reasonable to think that a simi-lar explanation would be applicable in canine patients aswell.

An higher mRNA expression of AMP could be explainedby an alteration of the skin barrier occurring after aller-gen exposure. In fact, recently, Ahrens et al. (2011) haveshown an increase of AMPs production after strip testin mice. In addition, an alternative possible explanationfor higher expression of AMPs in AD dogs may be thepresence of high secretion of non-functional peptides inatopic patients compared with healthy controls or a lack ofincreased secretion in AD patients as suggested for hBD3(Harder et al., 2010). Another possible scenario could be anincreased degradation of AMPs in atopic disease comparedwith healthy subjects. This latter hypothesis could be duehyper-activation of several endogenous as well as exoge-nous proteases (Elias, 2005; Takai and Ikeda, 2010). Finally,another explanation of an inverse correlation betweenAMPs expression and skin infection may be the lack ofsufficient stimulation in AD patients to reach AMPs con-centrations above the minimum inhibition concentration(MIC) able to kill pathogenic microorganisms.

In conclusion, we have demonstrated that, similar tohumans, a higher mRNA expression of cBDs and cCath ispresent in atopic beagles when compared with healthycontrols. We also demonstrated that no difference appearsto exist in the distributional expression pattern of AMPsbetween atopic and healthy dogs. Consequently, furtherstudies are needed to examine the functional role of AMPsin inflammatory and/or infectious skin diseases in dogs.

Conflict of interest

The authors state no conflict of interest.

Acknowledgements

This publication was made possible with support fromthe European Society of Veterinary Dermatology. Theauthors would like to thank also Liping Wang and RachelBreitenfeld for assistance in the production of antibodies.The authors thank Thierry Olivry for his technical advice

to optimize the indirect immunofluorescence technique.The authors are grateful to Kelly Swanson for providing thecolony of healthy beagles. They are also grateful to SandyGrable and Kim Ahrens, for assistance during the collectionof the skin samples.

mmunopathology 144 (2011) 382– 388 387

References

Agerberth, B., Charo, J., Werr, J., Olsson, B., Idali, F., Lindbom, L., Kiess-ing, R., Jornvall, H., Wigzell, H., Gudmundsson, G.H., 2000. The humanantimicrobial and chemotactic peptides LL-37 and alpha-defensinsare expressed by specific lymphocyte and monocytes populations.Blood 96, 3086–3093.

Ahrens, K., Schunck, M., Podda, G.F., Meingassner, J., Stuetz, A., Schroder,J.M., Harder, J., Proksc, E., 2011. Mechanical and metabolic injury to theskin barrier leads to increased expression of murine �-defensin-1, -3,and -14. J. Invest. Dermatol. 131, 443–452.

Bellardini, N., Johansson, C., Lilja, G., Lindh, M., Linde, Y., Scheynius, A.,Agerberth, B., 2009. Enhanced expression of the antimicrobial peptideLL-37 in lesional skin of adults with atopic eczerma. Br. J. Dermatol.161, 40–47.

Braff, M.H., Zaiou, M., Fierer, J., Nizet, V., Gallo, R.L., 2005. Keratinocyteproduction of cathelicidin provides direct activity against bacterialskin pathogens. Infect. Immun. 73, 6771–6781.

de Jongh, G.J., Zeeuwen, P.L., Kucharekova, M., Pfundt, R., van der Valk, P.G.,Blokx, W., Dogan, A., hiemstra, P.S., van der Kerkhof, P.C., Schalkwijk,J., 2005. High expression levels of keratinocyte antimicrobial proteinsin psoriasis compared with atopic dermatitis. J. Invest. Dermatol. 125,1163–1173.

Di Nardo, A., Vitiello, A., Gallo, R.L., 2003. Cutting edge: mast cell antimi-crobial activity is mediated by expression of cathelicidin antimicrobialpeptide. J. Immunol. 170, 2274–2278.

Elias, P.M., 2005. Stratum corneum defensive functions: an integratedview. J. Invest. Dermatol. 125, 183–200.

Fulton, C., Anderson, G.M., Zasloff, M., Bull, R., Quinn, A.G., 1997. Expres-sion of natural peptide antibiotics in human skin. Lancet 350, 1750–1751.

Gallo, R.L., Muratami, M., Ohtake, T., Zaiou, M., 2002. Biology and clinicalrelevance of naturally occurring antimicrobial peptides. J. Allergy Clin.Immunol. 110, 823–831.

Glaser, R., Meyer-Hoffert, U., Harder, J., Cordes, J., Wittersheim, M., Kobli-akova, J., Folster-Holst, R., Proksch, E., Schroder, J.M., Schwarz, T., 2009.The antimicrobial protein psoriasin (S100A7) is upregulated in atopicdermatitis and after experimental skin barrier disruption. J. Invest.Dermatol. 129, 641–649.

Guttman-Yassky, E., Lowes, M.A., Fuentes-Duculan, J., Zaba, L.C., Cardinale,I., Nograles, K.E., Khatcherian, A., Novitskaya, I., Carucci, J.A., Bergman,R., Krueger, J.G., 2008. Low expression of the IL-23/Th17 pathwayin atopic dermatitis compared to psoriasis. J. Immunol. 181, 7420–7427.

Harder, J., Dressel, S., Wittersheim, M., Cordes, J., Meyer-Hoffert, U.,Mrowietz, U., Folster-Holst, R., Proksch, E., Schroder, J.M., Schwarz,T., Glaser, R., 2010. Enhanced expression and secretion of antimicro-bial peptides in atopic dermatitis and after superficial skin injury. J.Invest. Dermatol. 130, 1355–1364.

Harder, J., Schroder, J.M., 2005. Antimicrobial peptides in human skin.Chem. Immunol. Allergy 86, 22–41.

Howell, M.D., Boguniewicz, M., Pastore, S., Novak, N., Bieber, T.,Girolomoni, G., Leung, D.Y., 2006. Mechanism of HBD-3 deficiency inatopic dermatitis. Clin. Immunol. 121, 332–338.

Howell, M.D., Novak, N., Bieber, T., Pastore, S., Girolomoni, G., Boquniewicz,M., Streib, J., Wong, C., Gallo, R.L., Leung, D.Y., 2005. IL-10 down-regulates antimicrobial peptide expression in atopic dermatitis. J.Invest. Dermatol. 125, 738–745.

Howell, M.D., 2007. The role of beta defensins and cathelicidins in atopicdermatitis. Curr. Opin. Allergy Clin. Immunol. 7, 413–417.

Jenssen, H., Hamill, P., Hancock, R.E.W., 2006. Peptide antimicrobialagents. Clin. Microbiol. Rev. 19, 491–511.

Lee, D.Y., Yamasaki, K., Rudsil, J., Zouboulis, C.C., Park, G.T., Yang, J.M.,Gallo, R.L., 2008. Sebocytes express functional cathelicidin antimicro-bial peptides and can act to kill Propionibacterium acnes. J. Invest.Dermatol. 128, 1863–1866.

Linde, A., Ross, C.R., Davis, E.G., Dib, L., Blecha, F., Melgarejo, T., 2008. Innateimmunity and host defense peptides in veterinary medicine. J. Vet. Int.Med. 22, 247–265.

Liu, L., Roberts, A.A., Ganz, T., 2003. By IL-1 signaling, monocytes-derivedcells dramatically enhance the epidermal antimicrobial responses tolipopolysaccharides. J. Immunol. 170, 575–580.

Marsella, R., Girolomoni, G., 2009. Canine models of atopic dermati-tis: a useful tool with untapped potential. J. Invest. Dermatol. 129,

2351–2357.

Marsella, R., Olivry, T., Nicklin, C., Lopez, J., 2006. Pilot investigation of amodel for canine atopic dermatitis: environmental house dust mitechallenge of high-IgE–producing beagles, mite hypersensitive dogswith atopic dermatitis and normal dogs. Vet. Dermatol. 17, 24–35.

3 gy and I

M

M

N

O

P

P

S

S

88 D. Santoro et al. / Veterinary Immunolo

arshall, S.H., Arenas, G., 2003. Antimicrobial peptides: a natural alterna-tive to chemical antibiotics and a potential for applied biotechnology.Electron. J. Biotechnol. 6, 271–284.

urakami, M., Ohtake, T., Dorschner, R.A., Schittek, B., Garbe, C., Gallo,R.L., 2002. Cathelicidin anti-microbial peptide expression in sweat,an innate defense system for the skin. J. Invest. Dermatol. 119,1090–1095.

omura, I., Goleva, E., Howell, M.D., Hamid, Q.A., Ong, P.Y., Hall, C.F.,Darst, M.A., Gao, B., Boquniewicz, M., Travers, J.B., Leung, D.Y., 2003.Cytokine milieu of atopic dermatitis, as compared to psoriasis, skinprevents induction of innate immune response genes. J. Immunol. 171,3262–3269.

ng, P.Y., Ohtake, T., Brandt, C., Strickland, I., Boquniewicz, M., Ganz,T., Gallo, R.L., Leung, D.Y., 2002. Endogenous antimicrobial peptidesand skin infections in atopic dermatitis. N. Engl. J. Med. 347, 1151–1160.

álffy, R., Gardlík, R., Behuliak, M., Kadasi, L., Turna, J., Celec, P., 2009. Onthe physiology and pathophysiology of antimicrobial peptides. Mol.Med. 15, 51–59.

faffl, M.W., 2001. A new mathematical model for relative quantificationin real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007.

ang, Y., Ortega, T., Blecha, F., Prakash, O., Melgarejo, T., 2005. Molecularcloning and characterization of three �-defensins from canine testes.Infect. Immun. 73, 2611–2620.

ang, Y., Ortegab, T., Rune, K., Xiau, W., Zhang, G., Soulages, J.L., Lushing-ton, G.H., Fang, J., Williams, T.D., Blecha, F., Melgarejo, T., 2007. Caninecathelicidin (K9CATH): gene cloning, expression, and biochemicalactivity of a novel pro-myeloid antimicrobial peptide. Dev. Comp.Immunol. 31, 1278–1296.

mmunopathology 144 (2011) 382– 388

Santoro, D., Bunick, D., Graves, T.K., Campbell, K.L., 2011. Expression anddistribution of antimicrobial peptides in the skin of healthy beagles.Vet. Dermatol. 22, 61–67.

Schauber, J., Gallo, R.L., 2008. Antimicrobial peptides and the skin immunedefense system. J. Allergy Clin. Immunol. 122, 261–266.

Stryjewski, M.E., Hall, R.P., Chu, V.H., Kanafani, Z.A., O’Riordan, W.D., Wein-stock, M.S., Stienecker, R.S., Streilein, R., Dorschner, R.A., Fowler Jr.,V.G., Corey, G.R., Gallo, R.L., 2007. Expression of antimicrobial peptidesin the normal and involved skin of patients with infective cellulitis. J.Infect. Dis. 196, 1425–1430.

Takai, T., Ikeda, S., 2010. Barrier dysfunction caused by environmen-tal proteases in the pathogenesis of allergic diseases. Allergol. Int.(advance online publication December 25, doi:10.2332 allergolint.10-RAI-0273).

Van Damme, C.M., Willemse, T., van Dijk, A., Haagsman, H.P., Veldhuizeen,E.J., 2009. Altered cutaneous expression of beta-defensins in dogs withatopic dermatitis. Mol. Immunol. 46, 2449–2455.

Wingate, K.V., Torres, S.M., Silverstein, K.A.T., Hendrickson, J.A., Ruther-ford, M.S., 2009. Expression of endogenous antimicrobial peptides innormal canine skin. Vet. Dermatol. 20, 19–26.

Wollenberg, A., Rawer, H.C., Schauber, J., 2010. Innate immunity in atopicdermatitis. Clin. Rev. Allergy Immunol., doi:10.1007/s12016-010-8227-x (advance online publication December 22).

Wood, S.H., Clements, D.N., McEwan, N.A., Nuttall, T., Canter, S.D., 2008.

Reference genes for canine skin when using quantitative real-timePCR. Vet. Immunol. Immunopathol. 126, 392–395.

Zanetti, M., Gennaro, R., Romeo, D., 1995. Cathelicidins: a novel proteinfamily with a common proregion and a variable C-terminal antimi-crobial domain. FEBS Lett. 374, 1–5.