expression of a toll signaling regulator serpin in a ... · expression of a toll signaling...

Expression of a Toll Signaling Regulator Serpin in a Mycoinsecticidefor Increased Virulence

Linzhi Yang,a Nemat O. Keyhani,b Guirong Tang,a Chuang Tian,a Ruipeng Lu,a Xin Wang,a Yan Pei,a Yanhua Fana

Biotechnology Research Center, Southwest University, Beibei, Chongqing, People’s Republic of Chinaa; Department of Microbiology and Cell Science, University ofFlorida, Gainesville, Florida, USAb

Serpins are ubiquitously distributed serine protease inhibitors that covalently bind to target proteases to exert their activities.Serpins regulate a wide range of activities, particularly those in which protease-mediated cascades are active. The Drosophilamelanogaster serpin Spn43Ac negatively controls the Toll pathway that is activated in response to fungal infection. The ento-mopathogenic fungus Beauveria bassiana offers an environmentally friendly alternative to chemical pesticides for insect con-trol. However, the use of mycoinsecticides remains limited in part due to issues of efficacy (low virulence) and the recalcitranceof the targets (due to strong immune responses). Since Spn43Ac acts to inhibit Toll-mediated activation of defense responses, weexplored the feasibility of a new strategy to engineer entomopathogenic fungi with increased virulence by expression of Spn43Acin the fungus. Compared to the 50% lethal dose (LD50) for the wild-type parent, the LD50 of B. bassiana expressing Spn43Ac(strain Bb::S43Ac-1) was reduced �3-fold, and the median lethal time against the greater wax moth (Galleria mellonella) wasdecreased by �24%, with the more rapid proliferation of hyphal bodies being seen in the host hemolymph. In vitro and in vivoassays showed inhibition of phenoloxidase (PO) activation in the presence of Spn43Ac, with Spn43Ac-mediated suppression ofactivation by chymotrypsin, trypsin, laminarin, and lipopolysaccharide occurring in the following order: chymotrypsin andtrypsin > laminarin > lipopolysaccharide. Expression of Spn43Ac had no effect on the activity of the endogenous B. bassiana-derived cuticle-degrading protease (CDEP-1). These results expand our understanding of Spn43Ac function and confirm thatsuppression of insect immune system defenses represents a feasible approach to engineering entomopathogenic fungi for greaterefficacy.

Entomopathogenic fungi are ubiquitously distributed in almostall ecosystems, where they act as important natural regulatorsof insect populations (1, 2). Due to their insecticidal activities,there has been much interest in broad-host-range entomogenousfungi, such as Metarhizium anisopliae and Beauveria bassiana, foruse as environmentally friendly alternatives to chemical pesticidesin insect control, and both are currently approved for commercialuse by the Environmental Protection Agency (3, 4). In B. bassiana,the pathogenic process is facultative and not required for comple-tion of the fungal life cycle. Mycosis involves several steps thatinclude (i) adhesion of spores (conidia) to the host cuticle, (ii)germination on the insect surface and hyphal penetration of theexoskeleton into the hemocoel, (iii) proliferation and immuneevasion in the hemocoel, and (iv) outward hyphal growth andsporulation on the host cadaver (5). Infection is affected by a widerange of factors, including temperature, humidity, UV exposure,nutrient availability, and even the physical state of the host, and itcan take between 6 and 14 days for the fungus to kill target insects,which imposes a significant limitation regarding the use of thesefungi as a biological control agent (6, 7). In addition, a number ofinsect targets display various degrees of resistance to infection byB. bassiana via expression of antifungal compounds or other as-pects of innate immune activation. These include hemocyte acti-vation and phagocytosis, encapsulation, reactive oxygen species(ROS) generation, and melanization, and these can be activated inresponse to complex environmental factors, including insect pop-ulation densities (8, 9).

Within this context, the Spaetzle/Toll/Cactus signaling cascadepathway in Drosophila melanogaster has been shown to mediateresponses to fungal infection (10). The transmembrane receptorToll does not recognize fungal determinants directly but is acti-

vated by a proteolytic fragment of Spaetzle, a cytokine-like mole-cule, which in Drosophila has been shown to directly bind Toll toestablish signaling (11). Spaetzle can be activated via recognitionof fungal cell wall components through the pattern recognitionreceptor (GNBP-3) or through detection of fungal (protease) vir-ulence factors which activate the serine protease Persephone (Psh)(12). A family of proteinase inhibitors known as serpins, in turn,negatively regulates the serine proteinases (13–15). The biochem-ical functions and structural features of a number of serpins havebeen at least partially defined; in Manduca sexta, serpin-5 has beenshown to regulate prophenoloxidase (proPO) activity (16), andAnopheles gambiae serpin-2 functions as a negative regulator ofmelanization (17). Far more extensive studies have been per-formed in Drosophila, where the loss of phenoloxidase (PO) activ-ity has been shown to decrease survival (18), and the serpinSpn43Ac (also known as the nec gene product) has been shown toinhibit Psh and thus act as a negative regulator of Toll-mediatedimmune defense response signaling (15). Indeed, constitutive ac-tivation of Toll-mediated antifungal defense is seen in the absenceof the appropriate serpin (19).

Received 11 April 2014 Accepted 7 May 2014

Published ahead of print 16 May 2014

Editor: A. A. Brakhage

Address correspondence to Yanhua Fan, [email protected].

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01197-14.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.01197-14

August 2014 Volume 80 Number 15 Applied and Environmental Microbiology p. 4531– 4539 aem.asm.org 4531

on March 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://dx.doi.org/10.1128/AEM.01197-14http://dx.doi.org/10.1128/AEM.01197-14http://dx.doi.org/10.1128/AEM.01197-14http://aem.asm.orghttp://aem.asm.org/

Genetic engineering has become a powerful tool to improvefungal performance (20–23), and the (over)expression of a varietyof cuticle-degrading enzymes in M. anisopliae and/or B. bassiana,including chitinases, proteases, and chitinase-protease hybrids,has led to improvements in the virulence of these fungi (24–27).More recently, small peptides, including trypsin-modulatingoostatic factor (TMOF) from the mosquito Aedes aegypti andpheromone biosynthesis-activating neuropeptide (PBAN) fromthe fire ant Solenopsis invicta, were expressed in B. bassiana andresulted in increased virulence against their respective targets (28,29). In the present paper, the consequences of the expression of aserpin, Spn43Ac, from Drosophila melanogaster in B. bassiana un-der the control of the constitutive gpdA promoter were assessed interms of increased fungal virulence and development within in-sect hosts, as were its effect on host PO activity. Spn43Ac was alsoexpressed and purified from an Escherichia coli heterologous host,and its activity was examined.

MATERIALS AND METHODSMicrobial strains and media. B. bassiana strain CGMCC7.34 (ChinaGeneral Microbiological Culture Collection Center) was isolated frominfected cadavers of Pieris rapae butterflies in China in 1997 and has beenconserved as a mixture of dry conidia at �80°C. Fungal strains were rou-tinely grown on potato dextrose broth (PDB) or potato dextrose agar(PDA), Sabouraud dextrose broth (SDB) or Sabouraud dextrose agar(SDA), and/or Czapek-Dox broth (CZB) or Czapek-Dox agar (CZA).Escherichia coli DH5� was used for plasmid propagation, and E. coliBL21(DE3) was used for protein expression. E. coli strains were culturedin Luria-Bertani (LB) medium supplemented with ampicillin (50 �g/ml)or kanamycin (50 �g/ml), on the basis of the plasmid selection markersused.

Molecular manipulations and transformation. The complete openreading frame (ORF) of the D. melanogaster Spn43Ac gene (GenBankaccession no. NM_080112) was cloned via fusion PCR using genomicDNA derived from D. melanogaster as the template. Primer pairs P1/P2and P3/P4 (Table 1) were used to amplify the fragments upstream anddownstream of a single intron present in the Spn43Ac gene, respectively,with primers P2 and P3 being designed to contain 20-bp overlappingsequences. The full length of Spn43Ac was produced by PCR in a reactionmixture containing 5 �l 5� Phusion Taq polymerase buffer, 2 �l 2.5 mMdeoxynucleoside triphosphates, 30 ng upstream fragment, 30 ng down-stream fragment, and 0.4 U Phusion Taq DNA polymerase in a totalvolume of 25 �l. PCR cycling conditions were as follows: 98°C for 2 min,followed by 25 cycles of 98°C for 20 s, 56°C for 30 s, and 72 for 1 min witha final extension at 72°C for 5 min. Primer pair P1 and P4 was then used toobtain the full-length Spn43Ac ORF using the assembled products as thetemplate. The PCR product was cloned into the pEASY-blunt vector

(Transgen, China) to yield pEASY-Spn43Ac, and the integrity of the insertwas verified by sequencing.

A secretion signal peptide (Bbsp) derived from B. bassiana Chit1(GenBank accession no. AY145440) was added to the cloned Spn43AcORF. Bbsp was amplified using primers P6 and P7 and B. bassianagenomic DNA as the template and cloned into the pGEM-T Easy vector(Promega), yielding pGEM-Bbsp. Primers P5 and P4 were then used toamplify the Spn43Ac ORF using pEASY-Spn43Ac as the template. pGEM-Bbsp was digested with NotI and SpeI to produce the Bbsp fragment, andthe Spn43Ac PCR product was digested with XbaI and SmaI. The Bbsp andSpn43Ac fragments were cloned into the pGEM-Pgpda-TtrpC vectorcontaining the glyceraldehyde phosphate dehydrogenase (gpd) promoterfrom Aspergillus nidulans and the TrpC terminator sequences to producePgpda-Bbsp:Spn43Ac-TtrpC. The Pgpda-Bbsp:Spn43Ac-TtrpC fragmentwas subsequently cloned into the pBAR-GFP vector (24), yielding pBAR-GFP-Pgpda-Bbsp:Spn43Ac-TtrpC for use in fungal transformation. B.bassiana fungal transformation and screening of transformants were con-ducted as previously described (24). Integration of the vector into thetransformants was confirmed by PCR using primers P4 and P5.

For construction of the E. coli heterologous expression vector, the ORFof Spn43Ac was amplified by PCR using primers Pser-Exp1/Pser-Exp2and pGEM-Spn43Ac as the template. The PCR product was cloned intothe pGEM-T Easy vector, and the integrity of the insert was verified bysequencing. The fragment containing the Spn43Ac gene was subclonedfrom the pGEM-T Easy vector into the corresponding sites of pGEX-6p-1(GE Healthcare) by EcoRI and NotI restriction enzyme digestion to pro-duce pGEX-GST-Spn43Ac. For protein expression and purification, therecombinant plasmid (pGEX-GST-Spn43Ac) was transformed into E. coliBL21(DE3) cells. The empty vector pGEX-6p-1 was also transformed intoBL21(DE3) cells and used as a negative control.

Gene expression analysis of Spn43Ac in transformants. Total RNAwas extracted from wild-type and fungal transformants (grown in 0.5�SDB for 3 days) using an Aurum total RNA minikit (Bio-Rad), and theextraction included a step of on-column removal of genomic DNA per themanufacturer’s instructions. cDNA was synthesized using a RevertAidFirst-Strand cDNA synthesis kit (MBI Fermentas, Canada). Real-timePCR was performed using an iCycler iQ multicolor real-time PCR detec-tion system with SYBR green (Bio-Rad). Reaction mixtures contained 5 �lof iQ SYBR green Supermix (Bio-Rad), 0.5 �l each of primers Pserpinrt1and Pserpinrt2 (10 �M), and 4 �l of 1:10-diluted cDNA template andwere incubated as follows: a 5-min denaturation step at 95°C, followed by40 cycles of 95°C for 15 s, 56°C for 30 s, and 72 for 30 s. The relativeexpression levels of Spn43Ac were normalized using actin (GenBank ac-cession no. HQ232398), gpd (GenBank accession no. AY679162), andcypA (GenBank accession no. HQ610831) as reference genes in iQ5 opti-cal system software (version 2; Bio-Rad). The primers used in the real-time PCR are listed in Table 1.

TABLE 1 Primers used in this study

Primer Sequencea Restriction enzyme site

P1 GAATTCATGGCGAGCAAAGTCTCGATCCTTCTCCTGC EcoRIP2 GGGGTACGAACTTGGCATAGGAAGCTGCCGAGGCCP3 GGCCTCGGCAGCTTCCTATGCCAAGTTCGTACCCCP4 CCCGGGTTAGACGCTCATGGGCGTGGGAT SmaIP5 TCTAGAGAGCTCATCGCTTGGCAACG XbaIP6 AAGGAAAAAAGCGGCCGCATGGCTCCTTTTCTTCAAACC NotIP7 GGACTAGTGCCGGCTCGCGGCGCCAAGGG SpeIPserpinrt1 TCTACTTCCAGGGTCGTTGGPserpinrt2 GGTCATGTCCTGCTCGAACTPser-Exp1 GAATTCGAGCTCATCGCTTGGCAACG EcoRIPser-Exp2 GCGGCCGCTTAGACGCTCATGGGCGTGG NotIa Underlined sequences are the restriction enzyme sites.

Yang et al.

4532 aem.asm.org Applied and Environmental Microbiology


http://aem.asm

.org/D

ownloaded from

http://www.ncbi.nlm.nih.gov/nuccore?term=NM_080112http://www.ncbi.nlm.nih.gov/nuccore?term=AY145440http://www.ncbi.nlm.nih.gov/nuccore?term=HQ232398http://www.ncbi.nlm.nih.gov/nuccore?term=AY679162http://www.ncbi.nlm.nih.gov/nuccore?term=HQ610831http://aem.asm.orghttp://aem.asm.org/

Colony growth and conidial germination assays. Fungal growth andconidial germination of the wild-type and Bb::S43Ac strains were ana-lyzed as described previously (30). Briefly, conidial suspensions (1 �l of1 � 107 conidia/ml) were spot inoculated onto PDA, SDA, and CZA platesand examined over a 5-day interval. Conidial germination was observedmicroscopically by inoculating 10- to 100-�l aliquots of conidial suspen-sions (1 � 106 conidia/ml) onto PDA plates, followed by culture at 26°Cfor 12 to 24 h and direct visualization of germ tubes via light microscopy.Conidial germination and vegetative growth were also tested on cicada(Cryptotympana atrata Fabricius) hind wings. The wings were surfacesterilized in oxymethylene overnight and rinsed 4 times (for 5 min eachtime) in sterile distilled water. The wings were placed on wet filter paperand inoculated with 1.0 ml of conidia (5 � 107 conidia/ml, prepared withsterile distilled water). Samples were incubated at 26°C for 22 h, and thepercent spore germination and hyphal growth/appressorium formationwas examined microscopically.

Insect bioassays. Fungal cultures were grown on PDA plates for 14 to20 days. Aerial conidia were harvested into sterile 0.05% Tween 80. The3rd instar larvae of Galleria mellonella (wax moth) and adult Myzus per-sicae (green peach aphid) were treated via topical application of conidialsolutions. Briefly, the larvae were immersed in fungal conidial solutions atvarious concentrations (5 � 106, 3 �107, and 1 � 108 conidia/ml) for 3 to6 s and then taken out and placed on a dry paper towel to remove theexcess liquid on the insect bodies. Controls were treated with sterile 0.05%Tween 80. Treated larvae were placed in large (150-mm) petri dishes andincubated at 26°C. All experiments were repeated three times, and eachreplicate contained a minimum of 25 insects. The number of dead insectswas recorded daily, and the median (50%) lethal time (LT50) and lethaldose (LD50) were calculated by probit analysis.

Fungal proliferation within the insect hemocoel. Hyphal bodies rep-resent a biochemically distinct yeast-like fungal cell type produced in theinsect hemolymph after hyphal penetration through the integument (31,32). For collection of hemolymph, infected and control larvae were anes-thetized on ice and the rear leg was cut off with a scissor at 12-h intervalsstarting 60 h after topical inoculation (107 conidia/ml). The hemolymphthat exuded from the wound was collected. Fungal hyphal bodies presentin the insect hemolymph were observed via bright-field microscopy(Olympus IX81 microscope), and the number of hyphal bodies was de-termined by direct counting using a hemocytometer. Three replicateswere performed for each treatment, and each replicate contained fourrandomly picked larvae.

Phenoloxidase assay. Hemolymph from larvae was collected andplaced into 1.5-ml microcentrifuge tubes on ice by cutting the rear leg andcollecting the drops. For the PO assay, samples were centrifuged at10,000 � g for 20 min at 4°C, and 50 �l of the supernatant was added to150 �l of phenoloxidase substrate solution (5 g/liter dopamine in 50 mMsodium phosphate, pH 6.9). Samples were incubated at 25°C for 30 min,and the absorbance at 490 nm (A490) was measured. One unit of POactivity was defined as a change in the A490 of 0.01 after 30 min, as de-scribed previously (27). PO activity was determined in insects subjected tothe following treatments: 2 �l (1 � 107conidia/ml) of wild-type and Bb::S43Ac conidial suspensions prepared in 0.05% Tween 80 was injected intothe hemocoel of G. mellonella larvae, with injections of 0.05% Tween 80used as controls. In order to test the effect of inactive conidia on POactivity, fungal conidia were treated at 65°C for 20 min and then placed onice for 5 min, after which 2 �l (1 � 107conidia/ml) of the conidial suspen-sions was injected into the hemocoel of the larvae. Experiments using eachstrain were repeated three times, and each repeat contained 30 larvae.Hemolymph was collected and assayed for PO activity over time (0, 2, 8,12, 24 h) after injection.

Purification of Spn43Ac. E. coli cell growth, induction, and harvestingwere conducted according to the manufacturer’s instructions (Invitro-gen). Briefly, E. coli BL21(DE3) cells harboring plasmid pGEX-GST-Spn43Ac or the empty vector control were grown in LB medium supple-mented with 50 �g/ml ampicillin to an optical density at 600 nm of 0.5

(4 � 108 cells/ml), after which isopropyl-�-D-thiogalactoside (IPTG) wasadded and the culture was allowed to grow as indicated until the cells wereharvested via centrifugation. Expression parameters, including the IPTGconcentration (0.05 to 1.0 mM), induction temperature (16 to 37°C), andinduction time (0.5 to 8 h), were analyzed. Harvested cells were washedonce in buffer (phosphate-buffered saline [PBS]), and cells were lysed byuse of the MagneGST cell lysis reagent (Promega). Cell lysates were cen-trifuged (12,000 � g, 10 min), and the supernatant was designated thecrude extract. Soluble GST-Spn43Ac protein in the crude extract was pu-rified using a MagneGST protein purification system (Promega). Gluta-thione S-transferase (GST) from the pGEX-6p-1 empty vector was alsopurified using the same method. The purified proteins were dialyzedagainst PBS (pH 6.9) four times at 4°C and analyzed by SDS-PAGE. West-ern blot assays were performed using standard protocols, and the blotswere probed using a GST antibody (Abcam, England) and visualized us-ing Clarity Western ECL substrate (Bio-Rad). The effect of Spn43Ac onthe activity of the B. bassiana cuticle-degrading protease CDEP-1 wasanalyzed with the synthetic peptide succinyl–(alanyl)2–prolyl–phenylala-nine–p-nitroanilide [Suc-(Ala)2-Pro-Phe-NA; Sigma] as the substrate(33). The CDEP-1 enzyme was produced and purified from Pichia pastorisas indicated in our previous study (34).

The effect of various purified proteins on PO activity was analyzed inreaction mixtures containing 150 �l 25 mM PBS (pH 6.9), 0.25 mg L-3,4-dihydroxyphenylalanine (L-DOPA), and the following: (i) purified GST,GST-Spn43Ac, or inactivated GST-Spn43Ac (boiled in water for 10 min)at concentrations ranging from 0 to 6 �M and (ii) the PO activator lipo-polysaccharide (LPS), trypsin, laminarin, or chymotrypsin (final concen-tration, 0.25 mg/ml), which was added to activate the PO cascade. In someexperiments, chymostatin (final concentration 2.5 ng/ml), an inhibitor ofchymotrypsin, was added as a control.

Statistical analysis. All statistical analyses were conducted using SPSSsoftware (version 17.0). A P value of �0.05 was considered statisticallysignificant.

RESULTSConstruction of B. bassiana Spn43Ac expression strains. Due tothe presence of a single intron in the ORF of the D. melanogasterSpn43Ac gene, a fusion PCR approach was used to construct thevector for expression in B. bassiana, as detailed in Materials andMethods. The A. nidulans gpd promoter was used to drive theexpression of Spn43Ac, and the construct contained a TrpC ter-minator sequence. The A. nidulans gpd promoter has been dem-onstrated to be functionally active and essentially constitutivelyproduce recombinant protein in B. bassiana (24, 34). In addition,a secretion signal peptide derived from the B. bassiana Chit1(chitinase) gene was fused to the N terminus of the Spn43Ac pro-tein to drive extracellular secretion of the protein. The expressionvector was transformed into B. bassiana strain CGMCC7.34, andputative transformants were further screened for genomic inser-tion of the Spn43Ac construct by PCR (see Fig. S1 in the supple-mental material). To determine whether expression of Spn43Acresulted in any effects on fungal morphology or development,transformants were examined for growth on PDA, SDA, and CZA.No significant differences in germination, radial and mycelialgrowth, or conidiation were seen between the transformants andthe wild-type strain (data not shown). The wild-type and trans-genic strains showed similar germination rates on PDA medium(at 14 h postinoculation, 95% versus 96%; P 0.05). In addition,no significant differences in growth or appressorium formation ofthe fungal strains grown on cicada wings were noted (Fig. 1). Inorder to select for strains with the highest levels of heterologousprotein expression, transformants were screened using real-timePCR for quantification of Spn43Ac expression levels. All tested

Engineering B. bassiana with Host Immune Regulator

August 2014 Volume 80 Number 15 aem.asm.org 4533


http://aem.asm

.org/D

ownloaded from

http://aem.asm.orghttp://aem.asm.org/

transformants showed production of Spn43Ac transcripts (whichwas absent in the wild-type strain), although a significant varia-tion in expression levels was noted between different isolates (Fig.2). One strain, designated Bb::S43Ac-1, exhibited the highest ex-pression level and was chosen for further study.

Expression of Spn43Ac in B. bassiana increases virulence.Topical bioassays, which represent the natural route of infection,revealed enhanced virulence of the Bb::S43Ac-1 strain comparedto that of the wild-type parent, with LT50s (3 � 10

7 conidia/ml) of84 h and 110 h for the Bb::S43Ac-1 and wild-type strains, respec-tively, against G. mellonella (Fig. 3A; Table 2). Topical bioassaysusing Myzus persicae adults resulted in an LT50 of 98 h for theBb::S43Ac-1 and an LT50 of 117 h for the wild type (at 1 � 10

7

conidia/ml) (Fig. 3B). These data indicate a 16 to 24% decrease inthe LT50 for the Spn43Ac-expressing strain compared to that forthe wild-type parent. Expression of Spn43Ac also decreased theLD50. Using G. mellonella, the LD50 for Bb::S43Ac-1 was 2.0 � 10

7

conidia/ml, and that for the wild type was 6.0 � 107 conidia/ml,indicating a 3-fold reduction in the number of spores required forthe same level of mortality (Table 2).

Hyphal body development in infected G. mellonella larvae.G. mellonella hemolymph was analyzed over time after inocula-tion with Bb::S43Ac-1 or wild-type conidia as described in theMaterials and Methods section. Microscopic observation ofhemolymph samples showed greater hyphal body proliferation inlarvae inoculated with strain Bb::S43Ac-1 than in larvae inocu-lated with the wild type at 84 h postinoculation (Fig. 4A). Quan-tification of hyphal body production over time postinoculation

(60 to 108 h) indicated a 2- to 4-fold increase in hyphal bodiesduring the later stages of infection for the Bb::S43Ac-1 strain com-pared to that for the wild type (Fig. 4B).

In vivo inhibition of phenoloxidase activation. Phenoloxi-dase activity in G. mellonella hemolymph was analyzed over timeafter challenge with fungal conidia. At 2 h postinjection, PO activ-ity was similar between all samples (Fig. 5). However, significantdifferences (P � 0.01) in PO activity between Bb::S43Ac-1 and theother strains were seen at 8 h postinfection. PO activity peaked at8 h in control injections and injections with heat-inactivated(65°C, 20 min) wild-type or Bb::S43Ac-1 conidia, after which theactivity tapered off, reaching basal levels at 24 h. Compared to theresults for the control, injection of wild-type conidia resulted in an�50% suppression of the peak activity at 8 h, whereas injection ofBb::S43Ac-1 conidia resulted in the same level of PO activity seenat the baseline.

Heterologous expression and purification of Spn43Ac fromE. coli and its inhibition of PO activation. The Spn43Ac ORF wassubcloned into the pGEX-6p-1 vector as an N-terminal glutathi-one S-transferase-tagged fusion protein. Optimal production ofSpn43Ac in the soluble crude extract fraction was found to occurwhen induction of protein expression with 0.2 mM IPTG oc-curred at 26°C for 4 h. The fusion protein (as well as GST for use incontrol experiments) was purified to homogeneity using GST af-finity chromatography. The molecular mass of GST-Spn43Acmatched the calculated value based on its amino acid sequence(�74 kDa), as detected by SDS-PAGE and Western blotting (Fig.6). A concentration-dependent inhibition of chymotrypsin acti-vation of PO activity was observed (Fig. 7A), with an �75% de-crease in PO activity seen in reaction mixtures containing 6 �MGST-Spn43Ac compared to that for the controls that includedGST and inactivated GST-Spn43Ac (95°C, 10 min). The effect ofGST-Spn43Ac on various other PO activators was also examined.Addition of lipopolysaccharide resulted in a 2-fold increase in POactivity over control (PBS treatment) levels, and this activity wasonly moderately (�14%) inhibited by addition of GST-Spn43Ac(Fig. 7B). In contrast, activation of PO activity by trypsin or chy-motrypsin was inhibited by 28 to 44% when GST-Spn43Ac wasadded, whereas laminarin activated PO levels �2.5-fold abovethat for the control (the highest seen), and addition of GST-Spn43Ac suppressed this activation by �25% (Fig. 7B). We alsodetermined the effect of GST-Spn43Ac on the activity of the B.

FIG 1 Micrographs of B. bassiana (wild-type [WT] and Bb::S43Ac-1) adhe-sion to cicada (C. atrata Fabricius) wings for 22 h. Arrows, the appressorium.Bars 50 �m.

FIG 2 Spn43Ac gene expression analysis. Quantitative reverse transcriptase PCR analysis of Spn43Ac expression normalized to gpd, actin, and cypA expressionin B. bassiana. WT, B. bassiana wild-type strain; Bb::S43Ac-1 to Bb::S43Ac-3, three transformants expressing the Spn43Ac gene. All strains were cultured in 0.5�SDB for 3 days, and then total RNA was extracted and quantitative reverse transcriptase PCR was performed as described in the Materials and Methods section.

Yang et al.



http://aem.asm

.org/D

ownloaded from


bassiana cuticle-degrading protease CDEP-1, which has beenshown to be a virulence factor (27). As shown in Fig. 8, the activityof CDEP-1 was not affected by addition of the GST-Spn43Ac pro-tein.

DISCUSSION

The insect cuticle and subsequent interactions of the fungus withthe immune system represent the two predominant obstacles tosuccessful mycosis. Cuticular defenses can include both endoge-nous factors (e.g., antimicrobial peptides, fatty acids, wax esters,and quinones) and exogenous factors (e.g., beneficial microbes),as well as communal behaviors, such as grooming and antisepticwashing mechanisms, that pose a formidable barrier for most mi-crobes (5). In some instances, when integrated with cuticular de-fenses, the insect immune system can recognize and attempt toeliminate invading microbes via a series of immune reactions thatcan include hemocyte activation and phagocytosis, encapsulation,melanization, and activation/expression of antimicrobial proteinsand molecules (8, 9). B. bassiana, however, has evolved mecha-nisms for overcoming these barriers that include secretion ofcuticle-degrading enzymes, toxic metabolite production, me-chanical penetration, and host immune evasion and suppression(35–38). However, the length of time required to kill target insectsand the high spore concentrations required have constrained theuse of these fungi for insect control. Increased expression of cuti-cle-degrading hydrolases has been shown to increase virulence,resulting in 6 to 40% decreases in LT50 values, depending upon theenzyme expressed (24, 26, 34, 39). In this study, expression of an

immune-regulating serpin gene, Spn43Ac, from Drosophila mela-nogaster in B. bassiana significantly increased fungal virulence,resulting in an �16 to 24% decrease in the LT50 and a 3-folddecrease in the LD50, indicating that 2 times fewer conidia areneeded to achieve the same level of control. These data indicate thefeasibility of genetic engineering of entomopathogenic fungi totarget the insect immune system for increased efficacy.

Insect innate immunity involves identification of pathogen-associated molecular patterns (PAMPs) that include bacterialLPSs, peptidoglycans (PGs), and fungal cell wall carbohydrates,e.g., �-1,3-glucans (40, 41). Pattern recognition involves mem-brane receptors and soluble proteins and with respect to fungiappears to be mediated via Toll-like receptor signaling pathwaysthat result in hemocyte activation (phagocytosis, nodule forma-tion, or encapsulation), synthesis of antimicrobial peptides, andactivation of prophenoloxidase (proPO) and melanization path-ways. In the mosquito malaria vector Anopheles gambiae, themelanization response has been implicated in defense against B.bassiana, with silencing of two mosquito-positive regulators ofmelanization, Tep1 and CLIPA8, resulting in increased suscepti-bility to infection by the fungus (42). Toll-mediated activation iscontrolled by (serine) protease cascades that, in the absence of asignal (i.e., a PAMP), are kept in check by the activities of serpins,i.e., serine protease inhibitors. Several insect viruses produce POcascade inhibitors that are thought to aid them in their ability toovercome host immune reactions (43). Thus, we reasoned thatexpression of a serpin by a fungal pathogen during the invasionprocess might inhibit innate immune activation to increase thevirulence of the fungus.

Transformation of B. bassiana with a vector containing theDrosophila serpin Spn43Ac, implicated in regulating Toll-medi-ated signaling, under the control of a constitutive A. nidulans gpdpromoter and with a B. bassiana Chit1 signal peptide was used todrive expression of the heterologous gene. A greater than 10-folddifference in Spn43Ac transcript levels was seen between variousclones, indicating the potential for significant genome localizationeffects regarding integration of the vector into the host fungal ge-nome. The localization effects were also observed in our previousstudy for protease CDEP-1 and hybrid protease CDEP:BmChBD(BmChBD is a chitin binding domain from Bombyx mori) (34).The B. bassiana transformant displaying the highest Spn43Ac ex-

TABLE 2 Calculated LD50s and LT50s of WT and Spn43Ac-expressingB. bassiana strains against G. mellonella and M. persicae

Strain HostLD50

a

(no. of conidia/ml) LT50 (h)

Wild-type B. bassiana G. mellonella 6.0 � 0.7 � 107a 110.5 � 3.8b

Bb::S43Ac G. mellonella 2.0 � 0.2 � 107a 84 � 3.1b

Wild-type B. bassiana M. persicae NDd 117 � 4.5c

Bb::S43Ac M. persicae ND 98 � 4.2c

a The LD50 was calculated from the 96-h time point.b The bioassay was performed using a spore concentration of 3 � 107 conidia/ml.c The bioassay was performed using a spore concentration of 1 � 107 conidia/ml.d ND, not determined.

FIG 3 Insect bioassays. Survival curves of G. mellonella (A) (3 � 107 conidia/ml) and M. persicae (B) (1 � 107 conidia/ml) infected with the wild-type andBb::S43Ac-1 strains are shown.




http://aem.asm

.org/D

ownloaded from


pression levels displayed both reduced LT50 and LD50 valuesagainst a lepidopteran host (G. mellonella) and a hemipteranaphid (M. persicae). During the normal course of infection, afterthe fungus has breached the insect integument, proliferation ofsingle-celled propagules known as hyphal bodies is seen in thehemolymph in vivo (31, 32). Infection by the Spn43Ac-expressingB. bassiana strain resulted in a 2- to 4-fold increase in hyphal bodyproduction, suggesting that innate immune systems do attempt tolimit the microbial infection. The mechanism underlying these

observations was further probed via demonstration of PO sup-pression in the hemolymph of Bb::S43Ac-1-infected hosts. Heter-ologous expression and purification of the Drosophila Spn43Ac inE. coli confirmed the concentration-dependent inhibition of POactivation by various proteases (trypsin and chymotrypsin). In-triguingly, only a low level of Spn43Ac inhibition (14%) of POactivation by LPS and a moderate level of Spn43Ac inhibition(�25%) of PO activation by laminarin were noted, indicatingregulation of these activation pathways by other serpins. Hyphalbody proliferation was enhanced in the Spn43Ac-expressingstrain, indicating an increased ability to evade the host immunesystem. We also observed some fluctuation in PO activity in G.

FIG 4 Fungal hyphal body production in G. mellonella hemocoel. The 3rd instar larvae of G. mellonella were topically inoculated with fungal spores (107

conidia/ml) in 0.05% Tween 80. (A) Hyphal bodies observed at 84 h postinoculation using light microscopy. Arrows, hyphal bodies. (B) Time course of hyphalbody proliferation postinoculation of wild-type and Bb::S43Ac-1 spores. Hyphal body concentrations were determined by direct counting using ahemocytometer over the indicated time course. The experiment was repeated three times, and each treatment contained four replicates. Error barsindicate SDs.

FIG 5 PO activity in G. mellonella hemolymph. Larvae were injected withwild-type, Bb::S43Ac-1, heat-inactivated wild-type (IAW), and heat-inacti-vated Bb::S43Ac-1 (IAS) spores and 0.05% Tween 80 (control). To inactivefungal spores, the spore suspension was treated at 65°C for 20 min and thenplaced on ice for 5 min. Hemolymph samples were collected over the indicatedtime course, and the PO activity was measured as described in Materials andMethods. The experiment was repeated three times, and each treatment con-tained three replicates. Error bars indicate SDs.

FIG 6 SDS-PAGE and Western blot analysis of Spn43Ac expressed in E. coliBL21(DE3). (A) SDS-PAGE analysis of purification of GST-Spn43Ac from anE. coli host. Lanes M, molecular mass markers; lane 1, crude extract fromuntransformed E. coli control; lane 2, crude extract from E. coli BL21(DE3)transformed with plasmid pGEX-GST-Spn43Ac; lane 3, purified GST-Spn43Ac protein. The samples in both lanes 1 and 2 were induced with 0.2 mMIPTG at 25°C for 4 h before harvesting and analysis. (B) Western blot analysisof GST-Spn43Ac probed with anti-GST antibody as described in the Materialsand Methods section (arrow).

Yang et al.



http://aem.asm

.org/D

ownloaded from


mellonella hemolymph after challenge with the various fungalstrains. PO activity increased to a maximum at 8 h after infection(by the form of injection) and then decreased to basal levels at 24h. These data indicate robust host immune responses to fungalchallenge leading to an increase of PO activity. Challenge with theSpn43Ac-expressing strain suppressed PO activation, consistentwith the more rapid hyphal body proliferation in the hemocoelseen with this strain. Not too surprisingly, even with challenge bythe wild type, suppression of PO activity was seen over time (i.e.,by 24 h postinoculation), confirming that the fungus also containsendogenous mechanisms for immune suppression and/or eva-sion.

Although Spn43Ac is a serine protease inhibitor, our resultsindicate that expression in B. bassiana did not affect spore germi-nation, growth, or hyphal penetration of the insect exoskeleton.The last process involves the expression of fungus-derived serineproteases required for degrading parts of the target cuticle. Ourdata showed that the protease activity of CDEP-1, a serine pro-tease from B. bassiana involved in cuticle degradation, was notaffected by addition of purified Spn43Ac in vitro (Fig. 8). In addi-tion, Spn43Ac-expressing and wild-type strains showed similar

phenotypes on artificial medium and during growth on cicadawings (Fig. 6). Finally, the hyphal bodies of the wild-type andSpn43Ac strains appeared in the hemolymph at the same time (72h postinoculation), although they were more numerous in theengineered strains, indicating that they have similar abilities topenetrate the insect cuticle. These data suggest that Spn43Ac hassome specificity regarding target serine proteases, as has been ob-served for other serpin proteins. For example, the serpin fromTenebrio molitor (spn48) could inhibit the amidase activity ofSpaetzle-processing enzyme but not that of thrombin or trypsin(44).

Overall, our data indicated an improvement in infection rates,allowing control to be achieved with fewer spores, while decreas-ing the opportunity for the insect to feed, continue development,and/or reproduce. Due to the significant difference between ver-tebrate and invertebrate immunity pathways, targeting of insectimmune systems may provide a safe and effective means of pestcontrol. Use of fungal pathogens as a vehicle for delivery of im-mune-modulating molecules can also shed light on the functionsof those molecules themselves. Given the diversity of serpins, fu-ture work to evaluate different serpins within the host-pathogencontext is warranted.

ACKNOWLEDGMENTS

This research was supported by grants from the Initial Special Researchfor 973 Program (2012CB126304), the New Century Excellent Talents inUniversity (NCET-10-0698), the Foundation for the Author of NationalExcellent Doctoral Dissertation of the People’s Republic of China(201067), the National Natural Science Foundation of China (30971919and 31270092), and Fundamental Research Funds for the Central Univer-sities of China (project no. XDJK2014B018) and a U.S. National ScienceFoundation (NSF) grant (IOS-1121392 to N.O.K.).

REFERENCES1. Hesketh H, Roy HE, Eilenberg J, Pell JK, Hails RS. 2010. Challenges in

modelling complexity of fungal entomopathogens in semi-natural popu-lations of insects. Biocontrol 55:55–73. http://dx.doi.org/10.1007/s10526-009-9249-2.

2. Roy HE, Steinkraus DC, Eilenberg J, Hajek AE, Pell JK. 2006. Bizarreinteractions and endgames: entomopathogenic fungi and their arthropod

FIG 7 Inhibition of PO activation by purified GST-Spn43Ac. (A) Concentra-tion-dependent inhibition of chymotrypsin-mediated PO activation byGST-Spn43Ac (0 to 6 �M). G. mellonella hemolymph was collected and chy-motrypsin (0.25 mg/ml) was added to activate the PO cascade. Spn43Ac-IA,GST-Spn43Ac protein inactivated by heat denaturation (boiling, 10 min, 6�M). (B) Effect of purified GST-Spn43Ac on PO activation by different stim-ulants. PO activity in G. mellonella-derived hemolymph was induced by PBS(0.1 M, pH 6.9, control), LPS, trypsin, laminarin, or chymotrypsin in theabsence or presence of GST-Spn43Ac. Negative controls included a reactionmixture with GST, and a reaction mixture with chymostatin, a known inhib-itor of chymotrypsin, was used as a positive control. The experiment wasrepeated three times, and each treatment contained three replicates. Error barsindicate SDs.

FIG 8 Effects of Spn43Ac on the activity of a cuticle-degrading protease,CDEP-1, of B. bassiana. The activity of CDEP-1 (1.5 �M) was analyzed usingSuc-(Ala)2-Pro-Phe-NA (1 mg/ml; Sigma) as the substrate with different con-centrations of GST-Spn43Ac (0 to 4 �M) as the inhibitor. Phenylmethylsulfo-nyl fluoride (PMSF; 15 �M), a serine protease inhibitor, was used as a negativecontrol. No inhibition activity of GST-Spn43Ac on CDEP-1 was observed.Each treatment contained three replicates.




http://aem.asm

.org/D

ownloaded from

http://dx.doi.org/10.1007/s10526-009-9249-2http://dx.doi.org/10.1007/s10526-009-9249-2http://aem.asm.orghttp://aem.asm.org/

hosts. Annu. Rev. Entomol. 51:331–357. http://dx.doi.org/10.1146/annurev.ento.51.110104.150941.

3. Jaronski ST. 2010. Ecological factors in the inundative use of fungalentomopathogens. Biocontrol 55:159 –185. http://dx.doi.org/10.1007/s10526-009-9248-3.

4. Pell JK, Hannam JJ, Steinkraus DC. 2010. Conservation biological con-trol using fungal entomopathogens. Biocontrol 55:187–198. http://dx.doi.org/10.1007/s10526-009-9245-6.

5. Ortiz-Urquiza A, Keyhani N. 2013. Action on the surface: entomopatho-genic fungi versus the insect cuticle. Insects 4:357–374. http://dx.doi.org/10.3390/insects4030357.

6. Wang ZL, Zhang LB, Ying SH, Feng MG. 2013. Catalases play differen-tiated roles in the adaptation of a fungal entomopathogen to environmen-tal stresses. Environ. Microbiol. 15:409 – 418. http://dx.doi.org/10.1111/j.1462-2920.2012.02848.x.

7. Xie XQ, Li F, Ying SH, Feng MG. 2012. Additive contributions of twomanganese-cored superoxide dismutases (MnSODs) to antioxidation,UV tolerance and virulence of Beauveria bassiana. PLoS One 7:e30298.http://dx.doi.org/10.1371/journal.pone.0030298.

8. Jiang HB. 2008. The biochemical basis of antimicrobial responses in Man-duca sexta. Insect Sci. 15:53– 66. http://dx.doi.org/10.1111/j.1744-7917.2008.00187.x.

9. Wilson K, Cotter SC, Reeson AF, Pell JK. 2001. Melanism and diseaseresistance in insects. Ecol. Lett. 4:637– 649. http://dx.doi.org/10.1046/j.1461-0248.2001.00279.x.

10. Valanne S, Wang JH, Ramet M. 2011. The Drosophila Toll signalingpathway. J. Immunol. 186:649 – 656. http://dx.doi.org/10.4049/jimmunol.1002302.

11. Weber ANR, Tauszig-Delamasure S, Hoffmann JA, Lelievre E, GascanH, Ray KP, Morse MA, Imler JL, Gay NJ. 2003. Binding of the Drosophilacytokine Spatzle to Toll is direct and establishes signaling. Nat. Immunol.4:794 – 800. http://dx.doi.org/10.1038/ni955.

12. Levitin A, Whiteway M. 2008. Drosophila innate immunity and responseto fungal infections. Cell. Microbiol. 10:1021–1026. http://dx.doi.org/10.1111/j.1462-5822.2008.01120.x.

13. Gulley MM, Zhang X, Michel K. 2013. The roles of serpins in mosquitoimmunology and physiology. J. Insect Physiol. 59:138 –147. http://dx.doi.org/10.1016/j.jinsphys.2012.08.015.

14. Kanost MR. 1999. Serine proteinase inhibitors in arthropod immunity.Dev. Comp. Immunol. 23:291–301. http://dx.doi.org/10.1016/S0145-305X(99)00012-9.

15. Reichhart JM, Gubb D, Leclerc V. 2011. The Drosophila serpins: multi-ple functions in immunity and morphogenesis. Methods Enzymol. 499:205–225. http://dx.doi.org/10.1016/B978-0-12-386471-0.00011-0.

16. An CJ, Kanost MR. 2010. Manduca sexta serpin-5 regulates proph-enoloxidase activation and the Toll signaling pathway by inhibiting hemo-lymph proteinase HP6. Insect Biochem. Mol. Biol. 40:683– 689. http://dx.doi.org/10.1016/j.ibmb.2010.07.001.

17. An CJ, Lovell S, Kanost MR, Battaile KP, Michel K. 2011. Crystalstructure of native Anopheles gambiae serpin-2, a negative regulator ofmelanization in mosquitoes. Proteins 79:1999 –2003. http://dx.doi.org/10.1002/prot.23002.

18. Asada N, Kawamoto N, Sezaki H. 1999. Deleterious effect of nullphenoloxidase mutation on the survival rate in Drosophila melanogaster.Dev. Comp. Immunol. 23:535–543. http://dx.doi.org/10.1016/S0145-305X(99)00035-X.

19. Levashina EA, Langley E, Green C, Gubb D, Ashburner M, HoffmannJA, Reichhart JM. 1999. Constitutive activation of Toll-mediated anti-fungal defense in serpin-deficient Drosophila. Science 285:1917–1919.http://dx.doi.org/10.1126/science.285.5435.1917.

20. Fang WG, Vega-Rodriguez J, Ghosh AK, Jacobs-Lorena M, Kang A, StLeger RJ. 2011. Development of transgenic fungi that kill human malariaparasites in mosquitoes. Science 331:1074 –1077. http://dx.doi.org/10.1126/science.1199115.

21. Keyhani NO. 2012. Using host molecules to increase fungal virulence forbiological control of insects. Virulence 3:415– 418. http://dx.doi.org/10.4161/viru.20956.

22. St Leger RJ, Wang CS. 2010. Genetic engineering of fungal biocontrolagents to achieve greater efficacy against insect pests. Appl. Microbiol.Biotechnol. 85:901–907. http://dx.doi.org/10.1007/s00253-009-2306-z.

23. Wang CS, St Leger RJ. 2007. A scorpion neurotoxin increases the potencyof a fungal insecticide. Nat. Biotechnol. 25:1455–1456. http://dx.doi.org/10.1038/nbt1357.

24. Fan YH, Fang WG, Guo SJ, Pei XQ, Zhang YJ, Xiao YH, Li DM, Jin K,Bidochka MJ, Pei Y. 2007. Increased insect virulence in Beauveria bassi-ana strains overexpressing an engineered chitinase. Appl. Environ. Micro-biol. 73:295–302. http://dx.doi.org/10.1128/AEM.01974-06.

25. Fang WG, Feng J, Fan YH, Zhang YJ, Bidochka MJ, St Leger RJ, PeiY. 2009. Expressing a fusion protein with protease and chitinase activ-ities increases the virulence of the insect pathogen Beauveria bassiana. J.Invertebr. Pathol. 102:155–159. http://dx.doi.org/10.1016/j.jip.2009.07.013.

26. St Leger RJ, Joshi L, Bidochka MJ, Roberts DW. 1996. Construction ofan improved mycoinsecticide overexpressing a toxic protease. Proc. Natl.Acad. Sci. U. S. A. 93:6349 – 6354. http://dx.doi.org/10.1073/pnas.93.13.6349.

27. Zhang YJ, Feng MG, Fan YH, Luo ZB, Yang XY, Wu D, Pei Y. 2008. Acuticle-degrading protease (CDEP-1) of Beauveria bassiana enhances vir-ulence. Biocontrol Sci. Technol. 18:551–563. http://dx.doi.org/10.1080/09583150802082239.

28. Fan YH, Borovsky D, Hawkings C, Ortiz-Urquiza A, Keyhani NO.2012. Exploiting host molecules to augment mycoinsecticide virulence.Nat. Biotechnol. 30:35–37. http://dx.doi.org/10.1038/nbt.2080.

29. Fan YH, Pereira RM, Kilic E, Casella G, Keyhani NO. 2012. Pyro-kinin beta-neuropeptide affects necrophoretic behavior in fire ants (S.invicta), and expression of beta-NP in a mycoinsecticide increases itsvirulence. PLoS One 7:e26924. http://dx.doi.org/10.1371/journal.pone.0026924.

30. Zhang SZ, Xia YX, Kim B, Keyhani NO. 2011. Two hydrophobins areinvolved in fungal spore coat rodlet layer assembly and each play distinctroles in surface interactions, development and pathogenesis in the ento-mopathogenic fungus, Beauveria bassiana. Mol. Microbiol. 80:811– 826.http://dx.doi.org/10.1111/j.1365-2958.2011.07613.x.

31. Lewis MW, Robalino IV, Keyhani NO. 2009. Uptake of the fluorescentprobe FM4-64 by hyphae and haemolymph-derived in vivo hyphal bodiesof the entomopathogenic fungus Beauveria bassiana. Microbiology 155:3110 –3120. http://dx.doi.org/10.1099/mic.0.029165-0.

32. Wanchoo A, Lewis MW, Keyhani NO. 2009. Lectin mapping revealsstage-specific display of surface carbohydrates in in vitro and haemo-lymph-derived cells of the entomopathogenic fungus Beauveria bassiana.Microbiology 155:3121–3133. http://dx.doi.org/10.1099/mic.0.029157-0.

33. St Leger RJ, Charnley AK, Cooper RM. 1987. Characterization of cuticle-degrading proteases produced by the entomopathogen Metarhizium-Anisopliae. Arch. Biochem. Biophys. 253:221–232. http://dx.doi.org/10.1016/0003-9861(87)90655-2.

34. Fan YH, Pei XQ, Guo SJ, Zhang YJ, Luo ZB, Liao XG, Pei Y. 2010.Increased virulence using engineered protease-chitin binding domain hy-brid expressed in the entomopathogenic fungus Beauveria bassiana. Mi-crob. Pathog. 49:376 –380. http://dx.doi.org/10.1016/j.micpath.2010.06.013.

35. Bidochka MJ, Clark DC, Lewis MW, Keyhani NO. 2010. Could insectphagocytic avoidance by entomogenous fungi have evolved via selectionagainst soil amoeboid predators? Microbiology 156:2164 –2171. http://dx.doi.org/10.1099/mic.0.038216-0.

36. Kirkland BH, Eisa A, Keyhani NO. 2005. Oxalic acid as a fungal acar-acidal virulence factor. J. Med. Entomol. 42:346 –351. http://dx.doi.org/10.1603/0022-2585(2005)042[0346:OAAAFA]2.0.CO;2.

37. Ortiz-Urquiza A, Keyhani NO, Quesada-Moraga E. 2013. Culture con-ditions affect virulence and production of insect toxic proteins in theentomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Tech-nol. 23:1199 –1212. http://dx.doi.org/10.1080/09583157.2013.822474.

38. Pedrini N, Ortiz-Urquiza A, Huarte-Bonnet C, Zhang S, Keyhani NO.2013. Targeting of insect epicuticular lipids by the entomopathogenic fun-gus Beauveria bassiana: hydrocarbon oxidation within the context of ahost-pathogen interaction. Front. Microbiol. 4:24. http://dx.doi.org/10.3389/fmicb.2013.00024.

39. Wang CS, Feng MG. 2014. Advances in fundamental and applied studiesin China of fungal biocontrol agents for use against arthropod pests. Biol.Control 68:129 –135. http://dx.doi.org/10.1016/j.biocontrol.2013.06.017.

40. Jiang H, Vilcinskas A, Kanost MR. 2010. Immunity in lepidopteraninsects. Adv. Exp. Med. Biol. 708:181–204. http://dx.doi.org/10.1007/978-1-4419-8059-5_10.

41. Park JW, Kim CH, Rui J, Park KH, Ryu KH, Chai JH, Hwang HO,Kurokawa K, Ha NC, Soderhill I, Soderhill K, Lee BL. 2010. Beetleimmunity. Adv. Exp. Med. Biol. 708:163–180. http://dx.doi.org/10.1007/978-1-4419-8059-5_9.

Yang et al.



http://aem.asm

.org/D

ownloaded from

http://dx.doi.org/10.1146/annurev.ento.51.110104.150941http://dx.doi.org/10.1146/annurev.ento.51.110104.150941http://dx.doi.org/10.1007/s10526-009-9248-3http://dx.doi.org/10.1007/s10526-009-9248-3http://dx.doi.org/10.1007/s10526-009-9245-6http://dx.doi.org/10.1007/s10526-009-9245-6http://dx.doi.org/10.3390/insects4030357http://dx.doi.org/10.3390/insects4030357http://dx.doi.org/10.1111/j.1462-2920.2012.02848.xhttp://dx.doi.org/10.1111/j.1462-2920.2012.02848.xhttp://dx.doi.org/10.1371/journal.pone.0030298http://dx.doi.org/10.1111/j.1744-7917.2008.00187.xhttp://dx.doi.org/10.1111/j.1744-7917.2008.00187.xhttp://dx.doi.org/10.1046/j.1461-0248.2001.00279.xhttp://dx.doi.org/10.1046/j.1461-0248.2001.00279.xhttp://dx.doi.org/10.4049/jimmunol.1002302http://dx.doi.org/10.4049/jimmunol.1002302http://dx.doi.org/10.1038/ni955http://dx.doi.org/10.1111/j.1462-5822.2008.01120.xhttp://dx.doi.org/10.1111/j.1462-5822.2008.01120.xhttp://dx.doi.org/10.1016/j.jinsphys.2012.08.015http://dx.doi.org/10.1016/j.jinsphys.2012.08.015http://dx.doi.org/10.1016/S0145-305X(99)00012-9http://dx.doi.org/10.1016/S0145-305X(99)00012-9http://dx.doi.org/10.1016/B978-0-12-386471-0.00011-0http://dx.doi.org/10.1016/j.ibmb.2010.07.001http://dx.doi.org/10.1016/j.ibmb.2010.07.001http://dx.doi.org/10.1002/prot.23002http://dx.doi.org/10.1002/prot.23002http://dx.doi.org/10.1016/S0145-305X(99)00035-Xhttp://dx.doi.org/10.1016/S0145-305X(99)00035-Xhttp://dx.doi.org/10.1126/science.285.5435.1917http://dx.doi.org/10.1126/science.1199115http://dx.doi.org/10.1126/science.1199115http://dx.doi.org/10.4161/viru.20956http://dx.doi.org/10.4161/viru.20956http://dx.doi.org/10.1007/s00253-009-2306-zhttp://dx.doi.org/10.1038/nbt1357http://dx.doi.org/10.1038/nbt1357http://dx.doi.org/10.1128/AEM.01974-06http://dx.doi.org/10.1016/j.jip.2009.07.013http://dx.doi.org/10.1016/j.jip.2009.07.013http://dx.doi.org/10.1073/pnas.93.13.6349http://dx.doi.org/10.1073/pnas.93.13.6349http://dx.doi.org/10.1080/09583150802082239http://dx.doi.org/10.1080/09583150802082239http://dx.doi.org/10.1038/nbt.2080http://dx.doi.org/10.1371/journal.pone.0026924http://dx.doi.org/10.1371/journal.pone.0026924http://dx.doi.org/10.1111/j.1365-2958.2011.07613.xhttp://dx.doi.org/10.1099/mic.0.029165-0http://dx.doi.org/10.1099/mic.0.029157-0http://dx.doi.org/10.1016/0003-9861(87)90655-2http://dx.doi.org/10.1016/0003-9861(87)90655-2http://dx.doi.org/10.1016/j.micpath.2010.06.013http://dx.doi.org/10.1016/j.micpath.2010.06.013http://dx.doi.org/10.1099/mic.0.038216-0http://dx.doi.org/10.1099/mic.0.038216-0http://dx.doi.org/10.1603/0022-2585(2005)042[0346:OAAAFA]2.0.CO;2http://dx.doi.org/10.1603/0022-2585(2005)042[0346:OAAAFA]2.0.CO;2http://dx.doi.org/10.1080/09583157.2013.822474http://dx.doi.org/10.3389/fmicb.2013.00024http://dx.doi.org/10.3389/fmicb.2013.00024http://dx.doi.org/10.1016/j.biocontrol.2013.06.017http://dx.doi.org/10.1007/978-1-4419-8059-5_10http://dx.doi.org/10.1007/978-1-4419-8059-5_10http://dx.doi.org/10.1007/978-1-4419-8059-5_9http://dx.doi.org/10.1007/978-1-4419-8059-5_9http://aem.asm.orghttp://aem.asm.org/

42. Yassine H, Kamareddine L, Osta MA. 2012. The mosquito melanizationresponse is implicated in defense against the entomopathogenic fungusBeauveria bassiana. PLoS Pathog. 8:e1003029. http://dx.doi.org/10.1371/journal.ppat.1003029.

43. Rodriguez-Andres J, Rani S, Varjak M, Chase-Topping ME, Beck MH,Ferguson MC, Schnettler E, Fragkoudis R, Barry G, Merits A, Fazak-erley JK, Strand MR, Kohl A. 2012. Phenoloxidase activity acts as a

mosquito innate immune response against infection with Semliki forestvirus. PLoS Pathog. 8:e1002977. http://dx.doi.org/10.1371/journal.ppat.1002977.

44. Park SH, Jiang R, Piao SF, Zhang B, Kim EH, Kwon HM, Jin XL, LeeBL, Ha NC. 2011. Structural and functional characterization of a highlyspecific serpin in the insect innate immunity. J. Biol. Chem. 286:1567–1575. http://dx.doi.org/10.1074/jbc.M110.144006.




http://aem.asm

.org/D

ownloaded from

http://dx.doi.org/10.1371/journal.ppat.1003029http://dx.doi.org/10.1371/journal.ppat.1003029http://dx.doi.org/10.1371/journal.ppat.1002977http://dx.doi.org/10.1371/journal.ppat.1002977http://dx.doi.org/10.1074/jbc.M110.144006http://aem.asm.orghttp://aem.asm.org/

Expression of a Toll Signaling Regulator Serpin in a Mycoinsecticide for Increased VirulenceMATERIALS AND METHODSMicrobial strains and media.Molecular manipulations and transformation.Gene expression analysis of Spn43Ac in transformants.Colony growth and conidial germination assays.Insect bioassays.Fungal proliferation within the insect hemocoel.Phenoloxidase assay.Purification of Spn43Ac.Statistical analysis.

RESULTSConstruction of B. bassiana Spn43Ac expression strains.Expression of Spn43Ac in B. bassiana increases virulence.Hyphal body development in infected G. mellonella larvae.In vivo inhibition of phenoloxidase activation.Heterologous expression and purification of Spn43Ac from E. coli and its inhibition of PO activation.

DISCUSSIONACKNOWLEDGMENTSREFERENCES

expression of a toll signaling regulator serpin in a ... · expression of a toll signaling...

Documents