Journal of Dermatological Science 65 (2012) 19–26

Expression of antimicrobial peptides in diabetic foot ulcer

Bruno Rivas-Santiago a,*, Valentın Trujillo a, Alejandra Montoya a, Irma Gonzalez-Curiel a,Julio Castaneda-Delgado a, Albertina Cardenas a, Kublai Rincon a, Maria L. Hernandez a,Rogelio Hernandez-Pando b

a Medical Research Unit-Zacatecas, Mexican Institute of Social Security (IMSS), Zacatecas, Mexicob Department of Experimental Pathology, National Institute for Medica Sciences and Nutrition Salvador Zubiran, Mexico City, Mexico

A R T I C L E I N F O

Article history:

Received 15 August 2011

Received in revised form 26 September 2011

Accepted 27 September 2011

Keywords:

Diabetic foot ulcer

Antimicrobial peptides

Defensin

Cathelicidin

A B S T R A C T

Background: Foot ulcers are one of the main diabetes complications due to its high frequency and

difficulty of complete healing. There are several factors that participate in diabetic ulcers development

and limited information exists about the role of antimicrobial peptides (AMP) in its pathogenesis.

Objective: The aim of this study was to analyze the expression pattern of the main AMPs: Human

Neutrophil Peptide (HNP)-1, Human b-defensin (HBD)-1, HBD-2, HBD-3, HBD-4 and cathelicidin LL-37

in biopsies from diabetic foot ulcers (DFU).

Methods: 20 biopsies from DFU grade 3 according to Wagner’s classification and 20 biopsies from healthy

donors were obtained. Real time PCR, immunohistochemistry and primary cell cultures were performed.

Results: b-Defensins were overexpressed in DFU, whereas LL-37 has low or none expression in

comparison with healthy skin. When primary cell culture from these biopsies were performed and

infected with Staphylococcus aureus, epidermal cell from diabetic ulcers showed lower LL-37 expression

compared with cell cultures from healthy donors skin.

Conclusion: These results suggest that though most AMPs are expressed in DFU, this production is not

appropriate to promote wound healing and contain secondary infections.

� 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights

reserved.

Contents lists available at SciVerse ScienceDirect

Journal of Dermatological Science

jou r nal h o mep ag e: w ww .e lsev ier . co m / jds

1. Introduction

Skin is the largest organ of the human body. It is formed by twolayers: epidermis and dermis, being the former constituted byseveral epithelium cell layers. The skin is our first anatomicalbarrier against pathogens and diverse potential injury agents fromthe external environment. As a consequence of these importantfunctions, the skin posses a highly efficient wound healingresponse and well developed innate and acquired immunologicalsystems. Regarding to the innate immune system, epidermal cellsproduce several antimicrobial peptides (AMP) [1]. The mainfunction of AMP is mediated by direct killing of invadermicroorganisms. If the skin is intact, bacterial growth will becontrolled by bacteriostatic peptides such as psoriasin and RNAse7[2,3]. During injury and infection, skin keratinocytes and recruitedneutrophils up-regulate and overexpress several AMPs which

Abbreviations: AMP, antimicrobial peptide; DFU, diabetic foot ulcer; DM2, type 2

diabetes; HBD-2, Human b-defensin; HNP, Human Neutrophil Peptide; PBMC,

peripheral blood mononuclear blood cells.

* Corresponding author at: Medical Research Unit Zacatecas, IMSS, Interior de la

Alameda #45, Col. Centro, Cp. 98000 Zacatecas, Mexico. Tel.: +52 4929226019.

E-mail address: rondo_vm@yahoo.com (B. Rivas-Santiago).

0923-1811/$36.00 � 2011 Japanese Society for Investigative Dermatology. Published b

doi:10.1016/j.jdermsci.2011.09.013

protect the skin and subcutaneous tissue against the growth anddissemination of diverse microorganisms [3].

A wide variety of AMPs is expressed by the epidermal cells, suchas Human b-defensin (HBD)-1, HBD-2, HBD-3 and HBD-4, as wellas cathelicidin LL-37 [1,4–6]. It is also important the contributionof human neutrophils peptides (HNP) to mount an efficientimmune response in the skin [1,7]. Besides their antimicrobialeffect, AMP also support processes of wound healing, such asproliferation and migration of keratinocytes induced by HBD-1 to -4 [8], or angiogenesis [10] and keratinocyte migration [9]promoted by LL-37. HNP is also important in skin healing,considering its ability to induce collagen synthesis and inductionof keratinocytes proliferation [7]. Thus, during normal circum-stances wound healing and infection control are efficiently carriedout in the skin by antimicrobial peptides and other molecules suchas growth factors. These important activities should be abnormalin diabetic foot ulcers (DFU).

In patients with diabetes, any foot laceration is potentially aserious condition. Peripheral neuropathy, vascular insufficiency,and diminished immune response are major factors in thedevelopment of skin ulceration and infection [9,10]. Peripheralneuropathy occurs in about 30–50% of patients. Diabetic patientslose the protective sensations for temperature and pain, impairing

y Elsevier Ireland Ltd. All rights reserved.

Table 1Clinical characteristics of the patients in each group.

Non DM2

(n = 20)

DM2 with foot

ulceration (n = 20)

P value

Age (years) 36.58 � 14.66 57.95 � 13.85 <0.001***

Gender (male/female) 10/10 15/5 –

Hb (g/dl) 13.44 � 2.31 11.8 � 2.49 0.0704

DM2 evolution (years) – 14.89 � 7.47 –

BMI (kg/m2) 24.35 � 2.51 26.32 � 1.52 0.0061**

Smoking habit 7/20 12/20 –

Glucose (mg/dl) 98 � 25 241 � 111 0.0002***

Arterial hypertension 6/20 6/20 –

DM2: type II diabetes mellitus, M: male, F: female, BMI: body mass index. All data

are represented as mean � SD except in the case of glucose because data did not pass a

normality test it is expressed as median � IQR (interquartile range). In the case of

variables with a KS normality test and quantitative data an unpaired T test was

performed, when the normality test was not passed a Mann–Whitney U test was

performed.** P < 0.01.*** P < 0.001.

B. Rivas-Santiago et al. / Journal of Dermatological Science 65 (2012) 19–2620

awareness of trauma such as abrasions, blistering, or penetratingforeign body. The lifetime risk of a person with diabetes developingfoot ulceration is reported to be as high as 25%. It is estimated thatmore than a million people with diabetes will require limbamputation each year, suggesting that one major amputation isperformed worldwide every 30 s [11,12]. Amputation is associatedwith significant morbidity and mortality, besides having immensesocial, psychological and economical consequences. As themajority of limb amputations in patients with diabetes arepreceded by foot ulceration, it is essential to find strategiesdirected towards promoting wound healing and preventing ulcerinfection.

Due to that antimicrobial peptides have the double effect ofbacterial killing and promotion of angiogenesis and keratinocyteproliferation, it is reasonable to hypothesize that these versatilepeptides are involved in the abnormal DFU healing. In fact, AMPlocal production has been studied in chronic venous ulcers [13–16], but limited information exists in DFU. Therefore, the aim ofthis work was to determine the expression of the main AMP in DFU.

2. Materials and methods

2.1. Patients

The study was approved by the National Committee of Ethics(2008-785-066) and National Commission of Scientific Research ofthe Mexican Institute of Social Security (IMSS). Written informedconsent was obtained from all participants. The study wasperformed according to the Declaration of Helsinki. We recruited20 hospitalized patients (Hospital #1-IMSS Zacatecas, Mexico)with type 2 diabetes and foot ulcer grade 3 according to Wagner’sclassification. Ulcers were debrided and patients were treated withsystemic antibiotics for 7 days. Then, a biopsy was taken asdescribed below, and patients were treated again with systemicantibiotics for other 7 days, cleaning the foot wound by strictwashes every day until ulcer showed clinical improvement. Forhealthy controls, normal skin fragments were taken from 20clinically healthy-non diabetic patients submitted to orthopedicsurgery. None of the patients had any systemic or autoimmunedisease, neither steroids nor any other hormone therapy weresupplied. All patients were HIV negative. Clinical data is summa-rized in Table 1.

2.2. Biopsies

Biopsies were obtained under local anesthesia with 2% lidocainefrom the border area of the ulcer and from similar anatomical site ofnon-diabetic subjects undergoing orthopedic surgery. The obtainedtissue corresponded to a rectangle of 10 mm of length for 5 mmwide, comprising the ulcer edge and surrounding skin. Each biopsywas divided in two halves, one was fixed in formaldehyde bufferwith 10% glycine, while the other half was kept in RNAlater (Qiagen,Duesseldorf, Germany). For primary cell culture, the tissue was keptin Dulbecco’s Modified Eagle’s Medium and HAM F-12 (DMEM-HAM-F12, Safc biosciences, Lenexa, Kansas, USA) for no longer than

Table 2Sequence of primers and Taqman probes used for RT-qPCR assays.

Gene name AMP Probe sequence R

CAMP LL-37 TCCAGGTC G

DEFA1 HNP-1 CAGGAGAA T

DEFB4 HBD-2 TGTGGCTG G

DEFB103A HBD-3 CTGCCTTC G

DEFB104 HBD-4 TGGAAGAT T

HPRT – GCTGAGGA C

2 h. In order to discard bacterial infection, swabs for microbiologystudies were obtained from all cases at the same time when biopsywas taken.

2.3. RNA isolation, reverse transcription and gene expression analysis

determined by real time PCR

Each biopsy was homogenized with an ultra-turrax disperser(Ika, wolmington, NC, USA). RNA was isolated from homogenatesusing the RNeasy fibrous tissue mini kit (Qiagen, Duesseldorf,Germany). Reverse mRNA transcription was performed using 5 mgRNA, 2 mM Oligo (dT) 15 primer (Promega, Ontario, Canada), 10units ribonuclease inhibitor (10 units/ml) (Invitrogen, Carslbard,CA), 1� RT Buffer, 0.5 mM of each dNTP, and 4 units OmniscriptReverse Transcriptase (Qiagen, Inc., Mexico). Real-time PCR wasperformed using the Light Cycler 2.0 (Roche, Germany), Light CyclerTaqman mastermix, and the specific probe for each gene wasselected from the Universal Probe Library (Roche, Germany). Allprimers were designed with Universal Probe Library software fromRoche (see Table 2). The relative expression of each sample wascalculated using human HPRT mRNA as reference gene and the2�

DDCt method as described previously [17]. This method is based onthe expression levels of a target gene (AMPs) versus one referencegene (HPRT) comparing between control group and target group.

2.4. Preparation of biopsies for immunohistochemistry and

morphometry

Biopsies were fixed for 24 h and embedded in paraffin. Sections4 mm thick were mounted on silane coated slides, deparaffinized,and the endogenous peroxidase quenched with 0.03% H2O2 inabsolute methanol. Then, the sections were washed and blockedwith PBS supplemented with 2% goat serum. Skin sections wereincubated with one of the next antibodies for 18 h, anti-LL-37(Santa Cruz Biotechnology, CA, USA), anti-HBD-1 (Santa CruzBiotechnology, CA, USA), anti-HBD-2 (Santa Cruz Biotechnology,

ight primer Left primer

TCTGGGTCCCCATCCAT TCGGATGCTAACCCTACG

CCCTGGTAGATGCAGGTTC CTTGGCTCCAAAGCATCC

AGGGAGCCCTTTTCTGAATC GTCTCCCTGGAACAAAATGC

AGCACTTGCCGATCTGTTC CAGAAATATTATTGCAGAGTCAGAGG

GTCGCAGCCAAGAATACAG TCCCATTTTCTCAAACAGCA

GAGCAAGACGTTCAGTCCT TGACCTTGATTATTTTGCATACC

Fig. 1. Antimicrobial peptides gene expression in diabetic foot ulcers biopsies. Real

time PCR was performed from biopsies of 20 patients and 20 healthy donors.

Graphic shows the AMP production from DFU compared with healthy donors. Fold

increase was calculated with the 2�DDCt method and compared with healthy

donors. *P < 0.05, ***P < 0.001.

B. Rivas-Santiago et al. / Journal of Dermatological Science 65 (2012) 19–26 21

CA, USA), anti-HBD-3 (Santa Cruz Biotechnology, CA, USA), anti-HBD-4 (Santa Cruz Biotechnology, CA, USA) or anti-HNP-1 (AbDserotec, Raleight, NC, USA). Then washed and incubated for 2 hwith anti-goat or anti-rabbit IgG biotin-labeled antibody (R&Dsystems, Minneapolis, MN, USA). Bound antibodies were detectedwith avidin–biotin peroxidase (Biocare Medical, CA, USA) andcounterstained with hematoxylin. For quantification the wholebiopsy area was taken. At 100� magnification, all negative orpositive cells from the epidermis were counted using an imageanalyzer (Axiovision v4.6, Carl Zeiss, Germany). The sameprocedure was used in the dermis.

2.5. Primary epidermal keratinocytes culture

Skin was disaggregated mechanically with a scalp. Explantswere cultured in a 25 cm2 culture bottles (Nunclon, Roskilde-Kamstrupvej, Denmark), filled with DMEM-HAM-F12 supplemen-ted with 10% fetal bovine serum (Equitech-Bio, Inc., Kerrville, TX,USA), HEPES 15 mM (Safc Biosciences Inc., Lenexa, KS, USA) andincubated at 37 8C with 5% CO2 atmosphere until adhesion. Onceadhered, cells were supplemented with a keratinocyte growth kit(ATCC, Manassas, VA, USA) until cells growth to 95% confluencewhich approximately took 30 days, then they were disaggregatedwith trypsin (Gibco, Carlsbad, CA) and seeded into 24-well plates ata concentration of 2.5 � 105 cells per ml of culture medium andrested for 24 h in the presence of 5% CO2 at 37 8C until infection.

2.6. Phenotype identification and infection

To confirm that primary epidermal cells were keratinocytesinstead of fibroblasts. Cell lysates were obtained and suspended inRIPA lysis buffer (NaCl 150 mM, Tris–HCl 50 mM, pH 7.4, EDTA1 mM, Triton X-100 1%, SDS 0.1%) supplemented with proteasesinhibitor (Sigma–Aldrich; St. Louis, USA). Equal amounts of totalproteins were subjected to 10% SDS-PAGE. After non-specificbinding sites were blocked, the blots were incubated overnightwith antibodies against cytokeratin-5 (KRT5) (Santa Cruz Biotech-nology, Inc., Delaware, CA, USA), which is a protein specificallyexpressed in keratinocytes from the basal layer [18], and for b-actin (Sigma–Aldrich, St. Louis, USA). The membrane wasdeveloped with an enhanced chemiluminescence detection kit(Amersham, ECL Plus Western Blotting Detection Reagents,Sunnyvale, CA) and analyzed with ChemiDocTM XRS software(Biorad, Mexico City, Mexico). The percentage of keratinocytes incell cultures was determined by fluorescence-activated cell sorting(FACS) analysis using KRT5 antibody and isotype control. Viabilitywas checked by the Guava Viacount Assay (Millipore, Billerica, MA,USA) showing 95% of viability.

Once the cell phenotype and viability was confirmed, cells wereinfected with a clinical isolate of Staphylococcus aureus atmultiplicities of infection (MOI) of 100 and 200 for 90 min. Cellswere washed twice with PBS and then trizol was added. RNAisolation, cDNA synthesis and RT-qPCR were done as describedabove. Before RNA isolation was carried out, viability of cell culturewas checked, showing 99% of viability.

2.7. Statistics

Normality was analyzed using a Kolmogorov–Smirnov test foreach data set. Followed by non-parametric multiple comparisontest of Kruskal–Wallis to identify differences among groups. In thecase of finding statistical significance (P < 0.05) a Dunn’s post testwas performed. For the analysis of the clinical characteristics,normality was verified using the same test after which a non-parametric multiple comparison test of Kruskal Wallis was used toidentify differences among groups. Two-sided P values of <0.05

were considered statistically significant. Statistical analyses wereperformed by the GraphPad Prism software for Windows(GraphPad Software version 5.02, San Diego, CA).

3. Results

3.1. Individual’s clinical data analysis

To discard that any clinical variant besides DM2 may interferewith the production of antimicrobial peptides, main clinicalparameters were compared between groups (Table 1). Agescomparisons among the different groups showed statisticaldifference (P = 0.001) as well as BMI (0.0061). As expected, therewere differences among the different groups in glucose levels(P = 0.0002).

3.2. Differential antimicrobial peptides gene expression in diabetic

foot ulcer

RT-qPCR analysis from diabetic foot ulcer biopsies revealed thatDEFB4, DEFB103A and DEFB104 genes are over expressed in allDFU in comparison with skin from healthy controls (P < 0.001).However, DEFB1 gene expression did not show statisticalsignificance when was compared with healthy controls, while asignificant difference was seen in DEFA1 gene expression(P < 0.05). Interestingly, only 4 patients out of 20 had CAMP geneexpression and these 4 patients were the same that stronglyexpressed DEFA1 in the external epidermal layer (Fig. 1).

3.3. Immunohistochemical comparison between different

antimicrobial peptides

Since not all transcribed mRNA necessarily is traduced intoAMPs, we sought to determine the production of protein at the DFUas well as in healthy controls through immunostaining in paraffin-embedded skin tissue. Immunostaining revealed a higher produc-tion of HBD-2, HBD-3 and HBD-4 in DFU ulcers in comparison withhealthy controls; this expression was seen in both epidermis anddermis. For both sort of samples the main immunostained cell typewere keratinocytes. HBD-1 did not show evident difference in the

Fig. 2. Immunohistochemical comparison between biopsies from healthy donors and biopsies from diabetic ulcers. LL-37, HNP-1, HBD-1, HBD-2, HBD-3 and HBD-4

immunostaining from healthy donors (A–F, respectively) and their counterparts in biopsies form diabetic foot ulcers (G–L). Panel H, shows a scrase immunostaining for HNP-

1 in ulcers, the inset disclose that immunostained cell are neutrophils according to their morphology. Pictures a representative of all patients. Figures A, B, D, E, G, H, J and K:

100�, figures C, F, I and L: 200�, inset 1000�.

B. Rivas-Santiago et al. / Journal of Dermatological Science 65 (2012) 19–2622

immunostaining pattern between ulcers and healthy skin (Fig. 2Cand I). When HNP-1 immunostaining was evaluated, there was nodifference between diabetic foot ulcers and healthy controls;however, three patients showed abundant neutrophils infiltrationin the dermal tissue and strong immunostaining to HNP-1 in thesecells (Fig. 2B and H). Intriguingly, while skin from healthy controlsshowed optimal LL-37, those biopsies from DFU showed minimalcathelicidin production (Fig. 2A and G), except in the three patientswho showed highly HNP-1 located in the neutrophils infiltrates(data not shown).

In order to determine differential expression and quantitativeexpression of AMPs in different skin layers such as dermis andepidermis, an immunohistochemical quantitative analysis withsemi-automated counting of the percentage of cells immunos-tained for the different peptides in both dermis and epidermis wasperformed. Results confirm the low production of LL-37 in biopsiesfrom DFU in both epidermis (Fig. 3A) and dermis (Fig. 4A). In thecase of HNP-1, there was only statistical significance (P < 0.0001)between ulcers and healthy skin in dermis (Fig. 4B), probably dueto the subjects with neutrophils infiltrates mentioned above. HBD-1 expression did not show statistical significance between DFU andhealthy skin in dermis nor epidermis (Figs. 3E and 4C), while HBD-2, -3 and -4 were statistical different in epidermis (Fig. 3D–F).Similar results were seen in dermis, nonetheless for this skin layerHBD-3 did not show statistical difference (Fig. 4E). Noteworthy, wecould not detect any immunostaining of HBD-4 in dermis forhealthy donors.

3.4. Explants from healthy donors have higher antimicrobial peptide

gene expression than skin from diabetic foot ulcers

The results described above showed that HBD-2, HBD-3 andHBD-4 are highly expressed in DFU. Since these peptides aremainly inducible through pathogen-associated molecular patternsas well as pro inflammatory molecules, it is not out of place toassume that there is an inflammatory milieu in the diabetic ulcerdue to active tissue reparation despite we took necessaryprecautions to avoid contamination of infected tissue and theswab cultures were negative. To discard that this milieu couldinterfere with AMP expression, we obtained primary cell culturesfrom healthy skin and skin from DFU and infect them with live S.

aureus and evaluate AMP’s gene transcription. To asses thatprimary epidermal cell cultures were not contaminated withfibroblasts, a Western-blot assay and a FACS analysis for KRT5 wasperformed, our results showed that >95 of our cell cultures werekeratinocytes (data not shown). Then, we infected and measured

AMP’s gene expression. The RT-qPCR gene expression analysisshowed that cell cultures from DFU had significant AMP lowerexpression than cell cultures from healthy skin (Fig. 5).

4. Discussion

Foot ulcerations in diabetic patients often lead to severeinfections, which sometime needs lower extremity amputations,being this a major cause of disability, significant morbidity,extensive periods of hospitalization, and higher mortality. Thepathogenesis of DFU is complex and the factors that delay theirhealing are poorly understood. AMP might be a significantparticipant in the pathogenesis of DFU due to their antimicrobialactivity and high activity to promote angiogenesis and keratino-cyte migration and proliferation. In fact, it is known that theseactivities are essential for a proper wound healing. This informa-tion motivated us to enquire whether antimicrobial peptidesexpression is altered in DFU. To asses this aim, we recruited 20patients with foot ulcer grade 3 according to Wagner’s classifica-tion and performed RT-qPCR and immunohistochemical studies toevaluate expression and production of the main antimicrobialpeptides produced in skin.

When DEFB1 gene expression was evaluated, we found thatthere was no difference between healthy controls and biopsiesfrom diabetic ulcers, neither in gene expression nor in immuno-staining. HBD-1 is constitutively expressed and up-regulatedduring inflammation [5], however, we did not detect any changesbetween both groups.

The presence of neutrophils in the injured area prepare thewound for healing by producing proteolytic enzymes such asmetalloproteases to remove necrotic tissue, debris and produceinflammatory cytokines/chemokines, generate ROS, and releaseantimicrobial peptides, these factors altogether lead to properwound healing [19,20]. Nevertheless, diabetic patients have animpaired neutrophil chemotaxis [21,22], which produce delayedwound healing and recurrent infection in foot ulcers. Regarded tothis, our HNP-1 expression and immunohistochemical analysisshowed that although there were differences between healthydonors and biopsies from diabetic ulcers this difference wasbecause of the three patients that showed neutrophilic infiltrationin dermis which correlated with higher HNP-1 production.Considering that swabs taken from ulcer showed no microbialcontamination, neutrophils infiltration might be related to woundhealing and not with infection. These patients showed the lowestglucose levels and their clinical follow up showed better woundhealing (data not shown), nonetheless we cannot assume any

Fig. 3. Percentage of AMPs immunostained cells determined by immunohistochemistry and automated morphometry in biopsies from diabetic foot ulcers and healthy

controls in epidermis. All negative or positive cells from each biopsy were counted and the percentage of the indicated cells was determined for each peptide. Data are

represented as median with interquartile range. Statistics were calculated by Kruskal–Wallis test. In each experimental group, n = 20. **P < 0.01, ***P < 0.001 compared with

control group.

B. Rivas-Santiago et al. / Journal of Dermatological Science 65 (2012) 19–26 23

correlation between neutrophil infiltration and improved ulcerhealing because of the low sample size. In contrast, other studywith chronic venous ulcers have shown increased HNP-1 produc-tion [23]. Perhaps, this difference could be associated with type 2diabetes in our study subjects.

The expression of b-defensin-2, -3, and -4 is usually increasedafter infection, inflammation, injury, and epidermal differentiation[24]. In many skin infections, low or lack of AMP expression iscommon [1,24–26]. Results from animal models and in patientswith chronic venous leg ulcer suggest the possibility of active AMPparticipation in the control of infection and promotion of woundhealing in DFU, considering their direct antimicrobial activity,

cytokine/chemokine production and keratinocyte migration andproliferation [8].

Previous studies have demonstrated the up-regulation of HBD-2 and HBD-3 in chronic wounds [14,15,27]. These results correlatewith ours, which showed in DFU significant higher gene expressionand immunoreactivity of HBD-2, -3 and -4, when compared withthe skin from healthy donors. This up-regulation could beproduced from tissue repair and inflammatory milieu in ulcers,since bacterial cultures from ulcer swabs were negative. Con-versely, previous results by our group showed that defensins are inlower concentrations in PBMC from diabetic patients [28]. Theseapparent contradictory results suggest that despite chronic ulcers

Fig. 4. Percentage of AMPs immunostained cells determined by immunohistochemistry and automated morphometry in biopsies from diabetic foot ulcers and healthy

controls in dermis. Total dermis area was measured in cm2 and the percentage of the positive immunostained area was determined for each peptide. Data are represented as

median with interquartile range. Statistics were calculated by Kruskal–Wallis test. In each experimental group, n = 20. **P < 0.01, ***P < 0.001 compared with control group.

B. Rivas-Santiago et al. / Journal of Dermatological Science 65 (2012) 19–2624

from diabetic patients showed b-defensins up-regulation, theproduction of these antimicrobial peptides might be insufficient tomount a proper antimicrobial control and wound healing. Toassess this query, we performed primary cultures from bothhealthy donors skin and diabetic foot ulcers, once the cultures wereestablished and have the same conditions and keratinocytephenotype was confirmed, we infected them with a S. aureus

clinical isolate obtained from a diabetic ulcer. Intriguingly ourresults showed that this infection induced lower levels of AMPsexpression in keratinocytes from diabetic foot ulcer biopsies thanin those keratinocytes from healthy donor biopsies, which showedsignificant higher levels. These results indicate that although cellsfrom diabetic patients are capable to produce b-defensins inresponse to infection, probably these peptides are not sufficient tocontrol and induce a proper wound healing.

Psoriasin is also a very important host defense peptide for skin,while some researchers claim that this peptide is only important inintact skin [2,3], other authors have found intensely elevatedprotein levels of psoriasin in infected wounds, and differences indistribution with respect to the epithelial layers [26]. However, therole of psoriasin in DFU needs to be further elucidated.

It is widely known that cathelicidin promotes wound healing byincreasing the re-epithelialization rate and granulation tissueformation, because induces keratinocyte migration through thesignaling of FPRL-1 [29] or transactivation of epidermal growthfactor receptor [30,31], besides it has remarkable angiogenicproperties and considerable direct antimicrobial action. Thus, dueto these pro-wounding functions, cathelicidin is apparentlyessential for a proper wound healing process. Interestingly, ourresults revealed that biopsies from DFU had low or none

Fig. 5. AMP expression in S. aureus infected primary keratinocyte cell cultures.

Primary cell cultures from diabetic foot ulcers (black bars) and healthy donors

(white bars) were infected with a live clinical isolate of S. aureus at different MOIs

for 90 min and DEFB4 (A), DEFB103A (B) and CAMP (C) gene expression was

measured. mRNA levels of control (non infected) for ulcer and normal keratinocytes

for each AMP were normalized with HPRT values; results obtained from infected

cells were compared with its, respectively, control. Data are represented as median

with interquartile range. Statistics were calculated by Kruskal–Wallis test. In each

experimental group, n = 3. **P < 0.01, ***P < 0.001.

B. Rivas-Santiago et al. / Journal of Dermatological Science 65 (2012) 19–26 25

cathelicidin expression. Indeed, only three patients out of twentyshowed comparable cathelicidin levels to those seen in biopsiesfrom healthy donors. The same patients showed also higher HNP-1production which correlated with more neutrophil infiltration.When primary cell cultures form ulcer were infected with differentS. aureus multiplicities of infection (MOI), all DFU biopsies showeddown expression of cathelicidin in comparison with primary cellcultures from healthy donors. These results correlates withprevious studies by our group that demonstrated in peripheralblood cells from diabetic patients no detectable expression of

cathelicidin [28]. This absence of cathelicidin may contributedirectly with the delay or incapacity of DFU for wound healing.Whether high glucose levels could interfere with an appropriateCAMP gene transcription need to be further studied.

Our clinical analysis showed that there is a statisticallysignificant difference in regards with age between groups; it isworthwhile to note that patients with prolonged DM2 evolutionare more prone to develop DFU which may indicate the differencebetween groups [9]. To date, there is no available data that mayindicate that aging could impair antimicrobial peptides produc-tion; however, this matter needs to be elucidated.

In conclusion, our results show that although defensins areexpressed in DFU their production seems to be not enough tocontain infection and promote proper wound healing, while thelow or lack production of cathelicidin might contribute to thepathogenesis of DFU.

Acknowledgements

We acknowledge all medical personal from Hospital #1, IMSS-Zacatecas for their valuable help for collecting samples. This workwas supported by the National Council of Science and Technologyin Mexico (FOMIX-Zacatecas-2008-C01-109189 and CONACYT-FOSSIS 2008-87863).

References

[1] Harder J, Schroder JM. Antimicrobial peptides in human skin. Chem ImmunolAllergy 2005;86:22–41.

[2] Glaser R, Harder J, Lange H, Bartels J, Christophers E, Schroder JM. Antimicro-bial psoriasin (S100A7) protects human skin from Escherichia coli infection. NatImmunol 2005;6:57–64.

[3] Steinstraesser L, Koehler T, Jacobsen F, Daigeler A, Goertz O, Langer S, et al. Hostdefense peptides in wound healing. Mol Med 2008;14:528–37.

[4] Harder J, Meyer-Hoffert U, Wehkamp K, Schwichtenberg L, Schroder JM.Differential gene induction of human beta-defensins (hBD-1, -2, -3, and -4)in keratinocytes is inhibited by retinoic acid. J Invest Dermatol 2004;123:522–9.

[5] Fulton C, Anderson GM, Zasloff M, Bull R, Quinn AG. Expression of naturalpeptide antibiotics in human skin. Lancet 1997;350:1750–1.

[6] Harder J, Bartels J, Christophers E, Schroder JM. Isolation and characterizationof human beta-defensin-3 a novel human inducible peptide antibiotic. J BiolChem 2001;276:5707–13.

[7] Oono T, Shirafuji Y, Huh WK, Akiyama H, Iwatsuki K. Effects of humanneutrophil peptide-1 on the expression of interstitial collagenase and type Icollagen in human dermal fibroblasts. Arch Dermatol Res 2002;294:185–9.

[8] Niyonsaba F, Ushio H, Nakano N, Ng W, Sayama K, Hashimoto K, et al.Antimicrobial peptides human beta-defensins stimulate epidermal keratino-cyte migration, proliferation and production of proinflammatory cytokinesand chemokines. J Invest Dermatol 2007;127:594–604.

[9] Khanolkar MP, Bain SC, Stephens JW. The diabetic foot. QJM 2008;101:685–95.[10] Bader MS. Diabetic foot infection. Am Fam Physician 2008;78:71–9.[11] Jeffcoate WJ, Game F, Cavanagh PR. The role of proinflammatory cytokines in

the cause of neuropathic osteoarthropathy (acute charcot foot) in diabetes.Lancet 2005;366:2058–61.

[12] Jeffcoate WJ. Theories concerning the pathogenesis of the acute charcot footsuggest future therapy. Curr Diab Rep 2005;5:430–5.

[13] Heilborn JD, Nilsson MF, Kratz G, Weber G, Sorensen O, Borregaard N, et al. Thecathelicidin anti-microbial peptide LL-37 is involved in re-epithelialization ofhuman skin wounds and is lacking in chronic ulcer epithelium. J InvestDermatol 2003;120:379–89.

[14] Dressel S, Harder J, Cordes J, Wittersheim M, Meyer-Hoffert U, Sunderkotter C,et al. Differential expression of antimicrobial peptides in margins of chronicwounds. Exp Dermatol 2010;19:628–32.

[15] Butmarc J, Yufit T, Carson P, Falanga V. Human beta-defensin-2 expression isincreased in chronic wounds. Wound Repair Regen 2004;12:439–43.

[16] Galkowska H, Olszewski WL, Wojewodzka U. Keratinocyte and dermal vascu-lar endothelial cell capacities remain unimpaired in the margin of chronicvenous ulcer. Arch Dermatol Res 2005;296:286–95.

[17] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(�Delta Delta C(T)) method. Methods2001;25:402–8.

[18] Stephens K, Zlotogorski A, Smith L, Ehrlich P, Wijsman E, Livingston RJ, et al.Epidermolysis bullosa simplex: a keratin 5 mutation is a fully dominantallele in epidermal cytoskeleton function. Am J Hum Genet 1995;56:577–85.

[19] Ochoa O, Torres FM, Shireman PK. Chemokines and diabetic wound healing.Vascular 2007;15:350–5.

B. Rivas-Santiago et al. / Journal of Dermatological Science 65 (2012) 19–2626

[20] Zheng Y, Niyonsaba F, Ushio H, Ikeda S, Nagaoka I, Okumura K, et al. Microbi-cidal protein psoriasin is a multifunctional modulator of neutrophil activation.Immunology 2008;124:357–67.

[21] Mowat A, Baum J. Chemotaxis of polymorphonuclear leukocytes from patientswith diabetes mellitus. N Engl J Med 1971;284:621–7.

[22] Mowat AG, Baum J. Polymorphonuclear leucocyte chemotaxis in patients withbacterial infections. Br Med J 1971;3:617–9.

[23] Lundqvist K, Sorensen OE, Schmidtchen A. Increased levels of human neutrophilalpha-defensins in chronic venous leg ulcers. J Dermatol Sci 2008;51:131–4.

[24] Yamasaki K, Gallo RL. Antimicrobial peptides in human skin disease. Eur JDermatol 2008;18:11–21.

[25] Rivas-Santiago B, Serrano CJ, Enciso-Moreno JA. Susceptibility to infectiousdiseases based on antimicrobial peptide production. Infect Immun 2009;77:4690–5.

[26] Kesting MR, Stoeckelhuber M, Holzle F, Mucke T, Neumann K, Woermann K,et al. Expression of antimicrobial peptides in cutaneous infections after skinsurgery. Br J Dermatol 2010;163:121–7.

[27] Galkowska Hanna OW. Wojewodzka Urzula: expression of natural antimicro-bial peptides b-defensin-2 and langherhans cell accumulation in epidermisfrom human non-healing leg ulcer. Folia Histochem Cytobiol 2005;43:4.

[28] Gonzalez-Curiel I, Castaneda-Delgado J, Lopez-Lopez N, Araujo Z, Hernandez-Pando R, Gandara-Jasso B, et al. Differential expression of antimicrobialpeptides in active and latent tuberculosis and its relationship with diabetesmellitus. Hum Immunol 2011;72:656–62.

[29] Carretero M, Escamez MJ, Garcia M, Duarte B, Holguin A, Retamosa L, et al. Invitro and in vivo wound healing-promoting activities of human cathelicidinLL-37. J Invest Dermatol 2008;128:223–36.

[30] Yin J, Yu FS. LL-37 via EGFR transactivation to promote high glucose-attenu-ated epithelial wound healing in organ-cultured corneas. Invest OphthalmolVis Sci 2010;51:1891–7.

[31] Tokumaru S, Sayama K, Shirakata Y, Komatsuzawa H, Ouhara K, Hanakawa Y,et al. Induction of keratinocyte migration via transactivation of the epidermalgrowth factor receptor by the antimicrobial peptide LL-37. J Immunol2005;175:4662–8.