Proc. NatL Acad. Sci. USAVol. 80, pp. 1-5, January 1983Biochemistry

Expression of hepatitis B surface antigen gene in yeast(recombinant DNA/serology/gene engineering/vaccine/acid phosphatase promoter)

ATSUSHI MIYANOHARA*, AKIo TOH-Et, CHIKATERU NOZAKI*, FUKUSABURO HAMADAt, NOBUYA OHTOMO*,AND KENICHI MATSUBARA**Institute for Molecular and Cellular Biology, Osaka University, Kita-ku, Osaka, 530 Japan; tFaculty of Engineering, Hiroshima University, Saijyo, HigashihiroshimaCity, 724 Japan; and Mihe Chemo-Sero-Therapeutic Research Institute, Shimizu, Kumamoto City, 860 Japan

Communicated by Hitoshi Kihara, September 10, 1982

ABSTRACT The DNA sequence coding for hepatitis B virussurface antigen (HBsAg) was placed under control of the repres-sible acid phosphatase promoter of the yeast Saccharomyces cere-visiae in a plasmid capable ofautonomous replication in both yeastand Escherichia coli Yeast transformed by this plasmid synthe-sized up to 5 x 105 molecules per cell of immunologically activeHBsAg polypeptide in phosphate-free medium. The HBsAg poly-peptides produced in the yeast cells were assembled into 20- to 22-nm spherical or oval particles and were immunogenic.

Hepatitis B virus (HBV) causes serious human liver disease,including hepatoma. Infection by this virus is a worldwidehealth problem, and a considerable number of people, partic-ularly in Southeast Asia, the Middle East, and some areas ofAfrica, suffer from transient or chronic HBV infection. The in-fectious agent has been identified as a 40- to 50-nm sphericalparticle, called the Dane particle, that is detected in patients'blood. The Dane particle contains a 3.2-kilobase (kb) circularDNA that has a single-stranded gap (1, 2).

Intensive efforts have been made to understand the struc-tural and behaviorial characteristics ofthis virus in order to con-trol the disease and to produce vaccines. However, such effortshave been hampered seriously by the fact that HBV replicatesonly in human and chimpanzee livers.The viral genome has been converted to double-stranded

form by filling-in and has been cloned and propagated in Esch-erichia coli (3-6). Analyses of the cloned HBV genome havebrought new insights into the structure and function ofthis viralgenome. At the same time, it was expected that vaccines mightbe produced in E. coli cells by allowing expression ofthe clonedsurface antigen (HBsAg) gene. Despite many efforts, however,production of vaccines in E. coli has not succeeded because, inE. coli cells, the HBsAg gene product seems to be either un-stable or to cause effects deleterious to the host, or both. In thepresent study, we report a yeast system that allows expressionof the HBsAg gene.One ofthe yeast acid phosphatases [APase; orthophosphoric-

monoester phosphohydrolase (acid optimum), EC 3.1.3.2] is anexocellular 60-kilodalton polypeptide designated P-60; theexpression of the gene for P-60 is controlled by the level of in-organic phosphate (7-12). We took this gene, freed its promoterfrom the coding sequence of the polypeptide, and joined thepromoter with the HBsAg gene in such a way that free, non-fusion polypeptides of HBsAg were made. The promoter-HBsAg gene complex was inserted into a shuttle vector thatreplicates in both yeast and E. coli and then was used to trans-form yeast. The transformants produce a large quantity ofHBsAg polypeptide in low P1 medium, and the HBsAg is as-sembled into spherical or oval immunogenic particles.

MATERIALS AND METHODSStrains and Media. Yeast strain AH22 (a leu2 his4 cani cir')

(13) and its APase constitutive derivative, AH22 pho80, werefrom our stock collection. Burkholder minimal medium (10) for-tified with histidine (20 mg/liter) was used to prepare high-Pimedium (1.5 g of KH2PO4 per liter) or low-Pi medium (1.5 gof KCl per liter).Enzymes and Linkers. Restriction enzymes were purchased

from New England BioLabs, Boehringer Mannheim, and Tak-ara Biochemicals (Kyoto, Japan). Exonuclease BAL-31 was pur-chased from Bethesda Research Laboratories. T4 DNA poly-merase, T4 DNA ligase, and polynucleotide kinase wereprepared in our laboratory. Zymolyase-60,000 was purchasedfrom Seikagaku Kogyo (Tokyo, Japan). Xho I linker was pur-chased from Collaborative Research (Waltham, MA) and phos-phorylated at its 5' termini before use (14).

Plasmids. The yeast-E. coli shuffle vector pAT77 (unpub-lished data) consists of a 5.5-kb DNA fragment from yeast thatcarries markers arsl (15), 2-pm ori (16), and leu2 (17) and a 3.7-kb DNA fragment from E. coli plasmid pBR322 (18) that carriesan ampicillin-resistance marker. Also present in this plasmid isa 2.8-kb DNA fragment of the yeast APase gene that includesthe region encoding the NH2-terminal portion of APase (poly-peptide P-60) and its control region (12) (see Fig. 1). PlasmidpHBV4 is a derivative ofpACYC177 (19) that carries the entireHBV (subtype adr) genome in double-stranded form insertedin the Xho I site of the vector (unpublished data). The plasmidDNAs were prepared as described by Clewell (20) or by Mat-subara et aL (21).

Exonuclease Digestion. pAT77 (1 jig) cleaved by Sal I wasincubated with 0.1 unit of exonuclease BAL-31 for 30-60 secat 300C in 50 A.l of 20 mM Tris-HCl, pH 8.2/12 mM CaCl2/12 mM MgCl2/0.2 M NaCl/1 mM EDTA. During this reac-tion, 85-130 base pairs (bp) of DNA were deleted. The reac-tion was stopped by treatment with phenol.

Transformation of Yeast Cells. Transformation was per-formed as described by Hinnen et aL (13). Leu+ transformantswere selected on Burkholder minimal medium containing 2%agar.

Yeast Cell Growth, Induction, and Preparation of Extracts.Yeast cells were grown in high-Pi Burkholder minimal mediumsupplemented with histidine (20 pAg/ml) at 30'C with aeration.When the cell density reached about 4 X 106 cells per ml, asample was taken out, centrifuged, and suspended in low-Piminimal medium for induction. Control samples were treatedsimilarly, except that high-Pi minimal medium was used. Whenthe density reached 1.5 x 107 cells per ml, 10-ml samples ofthe induced and noninduced cultures were centrifuged. The

Abbreviations: HBV, hepatitis B virus; HBsAg, hepatitis B surface an-tigen; HBcAg, hepatitis B core antigen; HBeAg, hepatitis B e antigen;APase, yeast acid phosphatase; kb, kilobase(s); bp, base pair(s).

1

The publication costs ofthis article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertise-ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 27

, 202

1

2 Biochemistry: Miyanohara et aL

cells were suspended in 3 ml ofa solution containing Zymolyase(100 tkg/ml), 1.2 M sorbitol, 50 mM phosphate (pH 7.2), and14 mM 2-mercaptoethanol and were incubated for 30 min at30'C. The spheroplasts were collected by centrifugation andlysed in 1 ml of0.1% Triton X-100/50 mM phosphate, pH 7.2/1mM phenylmethylsulphonyl fluoride. The lysate was clarifiedby centrifugation at 7,000 rpm for 10 min. Protein concentrationwas measured by the Lowry method.

Detection of HBV Proteins. Radioimmunoassay for HBVsurface antigen (HBsAg), core antigen (HBcAg), and e antigen(HBeAg) (1) were performed on samples of yeast extract con-taining 50 ,ug ofproteins by using the Abbott radioimmunoassaykit. Electron microscopy of HBsAg particles was performed asdescribed by Hirschman et al. (22).

RESULTSConstruction of the Expression Plasmid. The yeast-E. coli

shuttle vector pAT77 contains a fragment ofyeast DNA (EcoRI-BamHI-Sal I fragment) that carries the sequence of the NH2-terminal region ofthe P-60 polypeptide and its upstream controlregion (Fig. 1B) (12). A Goldberg-Hogness sequence T-A-T-A-T-A-A, which is believed to be the eukaryotic promoter se-quence (23), is located at positions -95 to -101 when the A inthe initiator codon AUG for the P-60 polypeptide is assignedposition + 1. The sequence T-T-C-A-T-C-T-C-T, believed to bethe transcription initiation site (23), is located at positions -51

A

Eco RI'

to -59. The unique Sal I site located at position +83 in the P-60 coding region defines the junction between this DNA andpBR322. To allow production of nonfused HBsAg, we com-pletely eliminated the P-60 polypeptide coding sequence andreplaced it with the HBsAg coding sequence that carries theinitiator codon. To do this, we cleaved pAT77 with Sal I, treatedit with exonuclease BAL-31 so that 85-130 bp of DNA wereremoved from the Sal I cleavage-site ends, and then ligated theproducts with Xho I linkers. The exact deletion end points weredetermined by DNA sequence analyses. One of the resultingplasmids, pAM82, which had lost 116-bp ofthe P-60 gene fromthe Sal I site ofpAT77, was found to have the intact APase pro-moter sequence. This plasmid was chosen for further studiesas an expression vector. The 3' terminus ofthe APase promoterregion was found to be at position -33, where a Xho I linkerhad been joined (Fig. 1).

Whole HBV DNA was recovered from pHBV4 by digestionwith Xho I. Fig. 2A shows the cleavage sites ofsome restrictionenzymes and the locations of the coding sequences of HBsAgand HBcAg. The Xho I terminus is located 27 bp upstream ofthe initiation codon for HBsAg. HBsAg consists of 226 aminoacids.

The whole HBV DNA with Xho I termini was inserted intothe Xho I site of the pAM82 expression vector, and the productwas named pAH203. Similarly, a 1.3-kb Xho I-BamHI fragmentcarrying the HBsAg gene was inserted into the same site ofpAM82, and the product was named pAH301. In this case, the

1, Sal I2. BAL-313. Xho I linkersT4 DNA ligase

Eco RI

Pnco K -/st||||f " SalIIcnCK I

Eco RI AGco Ii\EcoRII Xho IBan H I Ban. HI

B BaHI(-700) -100

pAT77M ------------ TGAAACGTATATAAGCGCTGATGTTTTGCTAAGTCGAGGTTAGTATGGCTTCATCTCTCpAM82, I -x

An Bst ElI (-174) Hogness box Cappingbo-49 + 1 +83pAT77: ATGAGAATAAGAACAACAACAAATAGAGCAAGCAAATTCGAGATTACCAATGTTT----- TGTCGACC -pBR 322

..--------- -- P-60 Sal IpAM82: ATGAGAATAAGAACAA - CCTCGAGG -pBR 322

Xho I linkertranslation

FIG. 1. (A) Construction of pAM82, a vector for expression of genes inserted at an Xho I site. The pAT77 plasmid DNA was opened by Sal Iand digested with BAL-31 exonuclease to eliminate the codingregion of the yeast P-60 polypeptide gene. BAL-31-digestedDNA (1 pg) was incubatedwith T4 DNA ligase in the presence of 1 pmol of Xho I linkers in 20 ,ul of 50 mM Tris HCl, pH 7.4/10 mM MgC12/10 mM dithiothreitol/0.5 mMATP/100 ug of bovine serum albumin per ml for 12 hr at 180C. The ligation mixture was transformed into E. coli strain x1776, and ampicillin-resistant colonies were selected. From these transformants, cells that carry a plasmid whose Sal I site had been replaced by anXho I site were usedfor further tests. The deletion endpoints were determined by sequence analysis (24). Finally, plasmid pAM82 was selected. This plasmid lost theentire P-60 polypeptide coding sequence because of a 116-bp deletion starting from its Sal I site. The heavy black segment represents the clonedyeast APase DNA. An arrow above the APase region shows the direction of transcription started by the APase promoter. (B) Sequence of the yeastAPase promoter region carried in pAT77 and pAM82. The vector plasmid pAT77 carries an -2.8-kb DNA fragment (EcoRI-BamHI-Sal I) fromthe yeastPHO5 locus, where the APase promoter and coding sequence for P-60 polypeptide are located. Only a portion of the DNA sequence aroundthe 5' noncoding and NH2-terminal region of the P-60 polypeptide is shown. pAT77 has one Sal I site, located 83 bp downstream of the P-60 codingsequence, that is used as the junction between yeast and pBR322 DNA. In pAM82, DNA to the right of position -32 (in the figure) was deletedby BAL-31 digestion. This terminus wasjoined to pBR322 through anXho I linker. The DNA sequences were determined according to Maxam andGilbert (24). The sequence shown with pAT77 has been determined independently by Kramer et al. (25); asterisks indicate the initiation sites formRNA synthesis as described (25).

Proc. Natl. Acad. Sci. USA 80 (1983)

a

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 27

, 202

1

Proc. Natd Acad. Sci. USA 80 (1983) 3

DACYCI77pHBV4

tggf -HBsAg- gene -f HBcAg

Ihol BSH I

Digest with zhoi

HBV DNA

Xsno I ; BaPHI thoI

Insert into XhoI-cleaved pAM82

pAM82 ' pAM82WlSL _= ~~~~~

)I",

-CAACCTCGAGGACTGGGGACCCTGCACCGAACATGGAG-XhoI HBsAg

transl ationpAH203

OC=2AYCl77gene

Digest with BanHI

Fill in with T4 DNA polymeraseand deoxynucleoside triphosphates

Ligate with XhoI linkers

Digest with MhaI

holI XhoI

Insert into xhoI-cleaved DAM82

pAM82 . _ pAM82

~~~~~~~I

pAH301

FIG. 2. (A) A linearized restriction map of the cloned HBV DNA. The entire nucleotide sequence and cleavage map of HBV DNA used in thisstudy will be published elsewhere. Genes for HBsAg and HBcAg are represented by horizontal filled arrows that also show the direction of tran-scription. (B) Structure of a recombinant plasmid pAH203 expressing the HBsAg gene. The whole HBV DNA was extracted from pHBV4 and in-serted into the uniqueXho I site in the vector plasmid pAM82. Orientation of the insertion was established byXho I andBamHI restriction analysis.The APase promoter and HBV DNAjunction sequence is shown at the bottom of the figure. The filled box with a horizontal arrow represents theyeastAPase promoter region and the direction of transcription from the promoter. Filled arrows represent the location and direction of transcriptionof the HBsAg and HBcAg genes. Structure of pAH301 is identical to pAH203 except that the 1.9-kb BamHI-Xho I segment covering the HBcAggene has been deleted.

BamHI terminus of the 1.3-kb fragment was converted to an

Xho I terminus by filling in with T4 DNA polymerase, followedby ligation with Xho I linkers. In the resulting recombinantplasmids, the genetic elements were joined in the followingorder: APase promoter-Xho I linker-HBsAg gene-Xho Ilinker-pBR322 (Fig. 2B).The recombinant plasmids propagated in E. coli x1776 were

transformed into a yeast recipient strain, AH22, or into its APaseconstitutive derivative, AH22 pho80, by standard transforma-tion procedure, selecting for Leu+ colonies.

Induction and Production of HBsAg in Yeast Cells. TheLeu+ cells were grown in liquid medium and then induced inphosphate-free medium. At appropriate times, cells were col-lected, converted to spheroplasts, and lysed by Triton X-100.After a high-speed centrifugation, the extracts were examinedby radioimmunoassay for HBsAg (Table 1). A substantialamount ofHBsAg was detected in an extract from induced AH22cells, whereas extracts from noninduced AH22 cells showedonly the background level ofHBsAg activity-namely, the levelin the extract of cells that carried only vector plasmid. A con-

stitutive mutant of AH22 synthesized a moderate level ofHBsAg without induction. This strain seems to be an incom-pletely derepressed derivative, as HBsAg gene expression was

partially induced by Pi starvation. The results were essentiallythe same irrespective ofwhether the recombinant plasmid car-

ried whole HBV DNA or the 1.3-kb fragment carrying only theHBsAg gene. Note, however, that in both recombinant plas-mids, the junction between APase promoter and the HBsAggene is identical. An important conclusion to be drawn is thatin both cases the HBsAg gene expression is controlled by yeast

APase promoter, which is under regulation by Pi concentrationin the medium.To assess the practical significance of the recombinant plas-

mids, we first examined their stability. After growth for six gen-

Table 1. Content of HBsAg polypeptide in yeast extracts

HBsAg,* MoleculesHost Plasmid Induction tg/ml per cellt

AH22 pAH203 + 2.5 400,000- <0.001 <200

pAH301 + 2.8 450,000- <0.001 <200

pAM82 + <0.001 <200- <0.001 <200

AH22pho8O pAH203 + 2.1 340,000- 1.0 160,000

pAH301 + 3.4 540,000- 1.8 280,000

pAM82 + <0.001 <200- <0.001 <200

Yeast cells carrying one of the plasmids as indicated were grown andinduced by transferring into phosphate-free medium. At the densityof 1.5 x 107 cells per ml, cells (induced and noninduced) were collected,lysed, and subjected to radioimmunoassay for estimating the amountof HBsAg in the extract.* The amount of HBsAg in the extract was calculated from a standardcurve obtained with native HBsAg in human sera by assuming thatHBsAgs in both yeast extract and human sera react similarly.

tThe number ofHBsAg molecules per cell was calculated by assumingthat the HBsAg subunit in yeast extract has a molecular weight of25,000.

A

B

I-

Biochemistry: Miyanohara et aL

111,3oci 6 we u%# fLr&w- %. - p,-- ---

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 27

, 202

1

4 Biochemistry: Miyanohara et al.

FIG. 3. Electron micrograph of HBsAg-positive spherical and oval particles appearing in induced yeast cell lysates. Extracts (100 ILI) from theinducedyeast cells were incubated with an equal volume of anti-HBsAgrabbit IgG (passive hemagglutinin titer, 1:29) for 12 hr atroom temperature.The mixture was then centrifuged at 12,000 x g for 30 min. The pellet was stained with uranyl acetate. (Bar = 20 nm.)

erations, more than 99.9% of the cells retained the Leu+ char-acter, showing that the recombinant plasmids are as stable asthe parental 2-pum plasmid (26). The expression level ofHBsAgwas calculated to be about 5 X 105 HBsAg subunits per yeastcell, assuming that the HBsAg in yeast extracts reacts with anti-HBsAg antibody with an efficiency equal to that of HBsAg inserum. This level is roughly the same as that reported for pro-duction of interferon D under control of the yeast alcohol de-hydrogenase I promoter (27).

Some Properties ofthe HBsAg Produced in Yeast Cells. TheHBsAg in the yeast extracts was precipitated by anti-HBsAgantibody and examined by electron microscopy. Aggregates of20- to 22-nm spherical or oval particles were observed (Fig. 3),which did not appear in control samples. Thus, HBsAg pro-duced by yeast seemed to be assembled into particles similarin size and shape to those small particles found in HBV-infectedpatients' sera. Note, however, that these particles do not carryDNA and are smaller than Dane particles (28).The yeast extract containing HBsAg was injected subcuta-

neously into guinea pigs (=400 ng ofHBsAg per animal). Aftertwo further boosters with a 1-wk interval, the sera were exam-ined for anti-HBsAg antibody titer by using the AUSAB ra-

dioimmunoassay (Abbott). The injected animals produced highlevels of anti-HBsAg antibody, which proves that the antigenproduced in yeast cells was sufficiently immunogenic (Table 2).We were not able to detect other HBV-related antigens, such

as HBcAg and HBeAg, by radioimmunoassay of extracts fromyeast cells carrying the complete HBV genome, plasmidpAH203.

DISCUSSIONIn this paper we demonstrated (i) that a cloned HBsAg genefrom subtype adrHBV can be expressed efficiently in yeast cells

under control of the yeast APase promoter, (ii) that the geneproducts are sufficiently immunogenic, and (iii) that the prod-ucts are assembled into spherical or oval particles similar tothose found in patients' sera. Because we did not leave any cod-ing sequences between the APase promoter and the initiationcodon ofthe HBsAg gene in the expression plasmid, the productshould be a nonfused complete HBsAg polypeptide. This hasyet to be proven by amino acid sequence studies.

Several attempts have been made to prepare HBsAg in E.coli cells. However, none of them have resulted in the pro-duction of nonfused HBsAg polypeptides. The cause for diffi-culty is not known, but in E. coli cells, the newly producedHBsAg polypeptides seem to be quickly degraded (29); in ad-dition, they seem to cause effects that are deleterious to the hostcells. The use of a eukaryotic host, yeast, seems to overcomethese problems. However, what feature or structure of yeastcells allowed accumulation ofa polypeptide that is restricted inE. coli cells remains to be elucidated.

The efficient expression ofthe HBsAg gene in nonfused com-plete polypeptide form in yeast not only will provide us with

Table 2. Immunogenic activity of HBsAg in yeast extractsInjected antigens Anti-HBsAg antibody titer, cpm

HBsAg-positive yeast extract* 6,180 17,034 2,680 852HBsAg-negative yeast extractt 102 116 - -

Purified HBsAg particlest 10,955 18,312 9,131

Numbers represent titer in guinea pig sera as measured by radioim-munoassay. Results of replicate experiments are shown. AUSUB con-trol, PCi: 11,505; NCI: 110.* Extract of cells carrying plasmid pAH203 (equivalent to 400 ng ofHBsAg).

tExtract of cells carrying plasmid pAM82.tPurified HBsAg particles from human serum (400 ng of HBsAg).

Proc. Natl. Acad. Sci. USA 80 (1983)

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 27

, 202

1

Proc. NatL Acad. Sci. USA 80' (1983) 5

an opportunity to make vaccines but also will allow us to studyother important mammalian or plant gene products. It also willfacilitate greatly studies of the-DNA signals controlling theexpression of eukaryotic genes.

During the preparation ofthis manuscript, a similar work waspublished (30).

We thank Drs. Asao Fujiyama and Osamu Chisaka at Osaka Univer-sity Medical School for their advice.and cooperation throughout thiswork. This work was supported in part by Special Coordination Fundsfor Promoting Science and Technology from The Science and Tech-nology Agency of Japan.

1. Zuckerman, A. Y. & Howard, C. R. (1979) in Hepatitis- VirusesofMan, eds. Tinsley, T. W. & Brown, F. (Academic, New York),pp. 1-269.

2. Landers, T. A., Greenberg, H. B. & Robinson, W. S. (1977)J.ViroL 23, 368-376.

3. Burrell, C. J., Mackay, P., Greenaway, P. J., Hofschneider, P.H. & Murray, K. (1979) Nature (London) 279, 43-47.

4. Sninsky, J. J., Siddiqui, A., Robinson, W. S. & Cohen, S. N.(1979) Nature (London) 279, 346-348.

5. Valenzuela, P., Gray, P.,. Quiroga, N., Zaldivar, J., Goodman,H. M. & Rutter, W. J. (1979) Nature (London) 280,-815-819.

6. Charnay, P., Pourcel, C., Louise, A., Fritsch, A. & Tiollais, P.(1979) Proc. NatL Acad. Sci. USA 76; 2222-2226.

7. Schurr, A. & Yagil, E. (1971)J. Gen. MicrobioL 65, 291-303.8. Toh-e, A., Ueda, Y., Kakimoto, S.-I. & Oshima, Y. (1973)J. Bac-

teriot 113, 727-738.9. Toh-e, A., Nakamura, H. & Oshima, Y. (1976) Biochim. Biophys.

Acta 428, 182-192.10. Bostian, K. A., Lemire, J. M., Cannon, L. E. & Halvorson, H.

0. (1980) Proc. NatL Acad. Sci. USA 77, 4504-4508.11. Kramer, R. A. & Anderson, N. (1980) Proc. Nati. Acad. Sci. USA

77, 6541-6545.

12. Rogers, D. T., Lemire, J. M. & Bostian, K. A. (1982) Proc. NatLAcad. Sci. USA 79, 2157-2161.

13. Hinnen, A., Hicks, J. B. & Fink, G. R. (1978) Proc. NatL Acad.Sci. USA 75, 1929-1933.

14. Richardson, C. C. (1965) Proc. NatL Acad. Sci. USA 54, 158-165.15. Stinchcomb, D. T., Struhl, K. & Davis, R. W. (1979) Nature

(London) 282, 39-43.16. Broach, J. R., Strathern, J. N., & Hicks, J. B. (1979) Gene 8, 121-

133.'17. Ratzkin, B. & Carbon, J. (1977) Proc. NatL Acad. Sci. USA 74,

487-491.18. Sutcliffe, J. G. (1979) Cold Spring Harbor Symp. Quant. BioL 43,

77-90.19. Chang, A. C. Y. & Cohen, S. N. (1978) J. Bacteriot 134, 1141-

1156.20. Clewell, D. B. (1972)J. Bacteriot 110,;667-676.21. Matsubara, K., Takagi, Y. & Mukai, T. (1975) J. Virot 16, 479-

485.22. Hirschman, S. Z., Gerber, M. & Garfinkel, E. (1974) Proc. NatL

Acad. Sci. USA 71, 3345-3349..23. Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P.,

Kedinger, C. & Chambon, P. (1980) Science 209, 1406-1414.24. Maxam, A. & Gilbert, W. (1977) Proc. NatL Acad. Sci. USA 74,

560-564.25. Thill, G. P., Kramer, R. A., Turner, K. J. & Bostian, K. A. (1982)

MoL CelL BioL, in press.26. Livingston, D. M. (1977) Genetics 86% 73-84.27. Hitzeman, R. A., Hagie, F. E., Levine, H. L., Goeddel, D. V.,

Ammerer, G. & Hall, B. D. (1981) Nature (London) 293, 717-722.

28. Gern, J. L., Holland, P. V. & Purcell, R. H. (1971) J. Virol. 7,569-570.

29. Edman, J. C., Hallewell, R. A., Valenzuela, P., Goodman, H.M. & Rutter, W. J. (1981) Nature (London) 291, 503-506.

30. Valenzuela, P., Medina, A., Rutter, W. J., Ammererj G. & Hall,B. D. (1982) Nature (London) 298, 347-350.

Biochemistry: Miyanohara et aL

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 27

, 202

1